| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and a range of proinflammatory cytokines such as
TNF-
, IL-1, IL-6, and IL-12 (2, 9). Despite its crucial
role in immunoregulation, the factors regulating expression of IL-10
gene are poorly understood at both the transcriptional and
posttranscriptional levels. Control at the posttranscriptional level
has been implied from the identification of potential
mRNA-destabilizing sequences (AUUUA with A + U-rich sequences) in
3'-untranslated regions of mouse and human IL-10 mRNA
(10, 11, 12). In the accompanying paper (13), we
show direct evidence for such posttranscriptional control. In this
paper, however, we examine how IL-10 is controlled at the
transcriptional level. The mouse IL-10 gene was cloned, and its DNA sequence including the 5'-flanking region was determined (14). This gene comprises five exons distributed over 5.1 kb of DNA. A typical TATA box sequence is located 97 bp upstream of the first ATG within a corresponding region previously shown to have promoter activity for human IL-10 (15).
We have made the novel and surprising observation that, unlike most other cytokines, IL-10 gene expression is regulated by the constitutively and ubiquitously expressed Sp1 and Sp3 as key transcription factors. This may explain how the IL-10 gene can continue to be transcribed when other cytokine genes are inactive. This combination of constitutive expression and fine control at the posttranscriptional level may permit a rapid homeostatic response to inflammation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
IL-10 mRNA levels were determined by RT-PCR. First strand cDNA was prepared from 1 µg total RNA using an oligo(dT) primer. This reaction mixture (20 µl) was diluted with 80 or 180 µl water, and then 0, 5, 10, or 20 µl of the cDNA solution were utilized for PCR amplification using sense and antisense primers (IL-10; 25 cycles, hypoxanthine phosphoribosyltransferase (HPRT)3; 17 cycles). The primer sequences used were: IL-10 sense primer, CCAGTTTTACCTGGTAGAAGTGATG; IL-10 antisense primer, TGTCTAGGTCCTGGAGTCCAGCAGACTC; HPRT sense primer, ACAGCCCCAAAATGGTTAAGG; and HPRT antisense primer, TCTGGGGACGCAGCAACTGAC. The amplified cDNAs were detected by Southern blot hybridization using cDNA probes.
Mapping of transcription start sites
To determine transcription start sites, we performed the rapid amplification of cDNA ends procedure (RACE) as described previously (16). cDNA for 5'-RACE was prepared using an antisense primer (GGAGTCGGTTAGCAGTATGTTGTCC) and 10 µg total RNA. After adding a G-tail at 5'-end, IL-10 cDNA was amplified using a poly(C) primer and an antisense primer (CACCTGGCTGAAGGCAGTCCGCAGCTC). Amplified fragments were cloned, and the DNA sequences were determined.
Assessment of promoter activity using the luciferase assay
Luciferase reporter plasmids were constructed using deletion
mutants of the 5'-flanking region of the IL-10 gene and pGL3-Basic
Vector (Promega, Madison, WI). This 5'-flanking fragment was subcloned
from a 
IL-10 genomic clone, a kind gift from Dr. K. Moore (DNAX
Research Institute, Palo Alto, CA). These deletion mutants (D1 to D11)
were generated by the exonuclease III/mung bean nuclease procedure or
by PCR. The structures of these deletion mutants are indicated in Fig. 2
A. The resulting deletion mutants,
KpnI/SacI fragments, were cloned upstream of the
luciferase gene in pGL3-Basic Vector. The SacI site (3'-end
of the deletion mutants) is located at +63 in the IL-10 gene.
|
EL-4 and RAW 264 cells (2 x 107) were transfected by electroporation using 10 µg of luciferase reporter plasmids with 0.1 µg pRL-SV40 or pRL-TK (Promega) as an internal control plasmid. If required, cells were stimulated with PMA (50 ng/ml)/ionomycin (1 µM) or LPS (20 µg/ml) 7 h postelectroporation. Cells were harvested 48 h postelectroporation, and promoter activities were analyzed by the Dual-luciferase Reporter Assay System (Promega). These assays were repeated more than three times, and the activities were normalized to Renilla luciferase activities.
Drosophila SL2 cells (2 x 106) were transfected using 0.5 µg of the luciferase reporter plasmid containing the IL-10 promoter (D6; -305 to +63) with pPac, pPacSp1, and pPacUSp3. Scheider SL2 cells were obtained from American Type Culture Collection (Manassas, VA). The expression plasmids were kind gifts from Dr. G. Suske (Philipps-Universitat, Marburg, Germany). Transfection was performed using Pfx-20 transfection reagent (Promega). Luciferase activities were analyzed 48 h posttransfection. These assays were repeated more than three times.
Gel mobility band shift assays
A nuclear extract from EL-4 cells was prepared using methods described by Dignam et al. (17). Gel mobility band shift assay was performed as described previously (18). To perform super gel mobility band shift assay, the reaction mixture was incubated with anti-Sp1 (Santa Cruz, PEP2) and/or anti-Sp3 (Santa Cruz D-20) Abs.
DNase I footprinting
A DNase I footprinting assay was performed according to the method described by Dynan and Tjian (19). A DNA fragment of the promoter region was amplified by PCR using a 32P-labeled primer (CTGAAGGCTCAGTGGGGCCTTCC) and an unlabeled primer (CCAGTTCTTTAGCGCTTACAATGC). The PCR product was isolated and incubated with 0–50 µg of a nuclear extract in 20 mM HEPES (pH 7.9), 2 mM MgCl2, 50 mM NaCl, 1 mM DTT, 20% glycerol, and 4 µg poly[d(I-C)]-poly[d(I-C)]. The mixtures were treated with DNase I at 25°C for 1 min. Purified DNAs from these mixtures were analyzed by sequencing gel with sequence ladders generated using the same labeled primer.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
IL-10 production has been demonstrated in diverse cell types
(2, 3, 4, 5, 6, 7, 8). We have analyzed IL-10 mRNA levels by RT-PCR using
RNAs from a fibroblast cell line, L929, a T cell line, EL-4, a
macrophage cell line, RAW 264, and a B cell line, A20, as well as bone
marrow-derived dendritic cells (bmDC). IL-10 mRNA was detected in all
these cell types, albeit at different levels (Fig. 1). High level expression of IL-10 mRNA
was observed in PMA/ionomycin-stimulated EL-4, A20, PMA-stimulated A20,
and LPS-stimulated bmDC (Fig. 1). We have investigated IL-10
transcription in two of these populations, namely, EL4 (lymphoid) and
RAW 264 (nonlymphoid) cells.
|
Promoter activity of the 5'-flanking region was analyzed by luciferase
reporter assays using a series of deletion mutants in stimulated and
nonstimulated EL-4 and RAW 264 cells. The structures of the luciferase
reporter plasmids are shown in Fig. 2
A. Luciferase activities
generated in these cells using the reporter plasmids were compared with
that using a negative control plasmid (no insert, pGL3-Basic Vector)
(Fig. 2B). The negative control plasmid exhibited
high background luciferase activity in PMA/ionomycin-stimulated EL-4
cells (often >4-fold above that in nonstimulated cells). This meant
that the calculated relative luciferase activities in these cells was
low, thus precluding useful comparison between stimulated and
nonstimulated cells. IL-10 promoter activity was observed in all tested
cells. Surprisingly, no significant reduction of promoter activity was
observed by the 673-bp deletion from -802 to -129 (Fig. 2B, D1 to D9). In all tested cells, a large reduction of
promoter activity was caused by the 55-bp deletion from -129 to -74
(Fig. 2B, D9 to D10), suggesting that critical
cis-acting elements for IL-10 promoter activity are located
in this region. To analyze binding of NFs to this region and its
surrounding sequence, a gel mobility band shift assay was performed
using a nuclear extract from EL-4 cells. Five oligonucleotide probes,
P1 (-140 to -116), P2 (-125 to -101), P3 (-110 to -86), P4 (-95
to -71), and P5 (-80 to -56) were synthesized and annealed.
Positions of these probes in the promoter region are shown in Fig. 3A. Three slowly migrating
complexes were detected with probe P4 (Fig. 3B, C1–C3). To
confirm DNA-dependent complex formation, a competition assay was
performed. NF binding to the 32P-labeled probe P4
was inhibited with a 100-fold excess of unlabeled P4 but not with P3
and P5 (Fig. 3C), indicating that this interaction is DNA
sequence specific.
|
). This region overlapped
with the NF-binding region detected by the gel mobility band shift
assay using probe P4 (-95 to -71). To determine a more accurate
location for the cis-acting element, seven mutant
oligonucleotide probes (M1 to M7) were designed, synthesized, and
annealed. The DNA sequence of the mutant probes are shown in Fig. 5B. The complexes C1, C2, and
C3 were detected with wild-type probe P4 and mutant probes M1 and M7
but not with probes M2 to M6 (Fig. 5A), indicating that
13-bp sequence AGGGAGGAGGAGC is required for NF binding (Fig. 5B, CONSENSUS).
|
|
We could find no potential NF recognition sequence in this 13-bp
region using the transcription factor database (20).
However, transcription of the human epidermal growth factor receptor
(EGFR) (21) and CD58 (22) genes is known to
be regulated by cis-acting elements containing TCC repeats.
We noticed the presence of TCC repeats in the complementary sequence
(GCTCCTCCTCCCT) of the 13-bp region. This 13-bp sequence (antisense)
plus the boundary sequence was, therefore, aligned with sequences of
the four TCC repeating cis-acting elements in the EGFR
promoter, the cis-acting element in CD58 promoter, and
corresponding region in the human IL-10 promoter (Fig. 6A). A CCTCCT sequence was
found in all aligned sequences and was followed by C + T-rich
sequences. This CCTCCT sequence is also found at the corresponding
region in the human IL-10 promoter (Fig. 6A). We
investigated whether this CCTCCT sequence could provide the core
sequence of the cis-acting element for IL-10 transcription
by changing the CCTCCT sequence to GAATTC (EcoRI site) in
two luciferase reporter plasmids D1 and D6 (Fig. 2A, D1, D6;
Fig. 6B, D1, CCT KO; D6, CCT KO). Promoter activity was then
assessed in EL-4 cells (Fig. 6C). This change produced a
large reduction of promoter activity with both D1 and D6 plasmids,
indicating that the CCTCCT sequence was required for IL-10 gene
expression. This loss of promoter activity was accompanied by the
disappearance of all three complexes (C1, C2, and C3) observed in the
gel mobility band shift assay using probe P4 (Fig. 5, M4). These
results suggest that the CCTCCT sequence is the core of this
cis-acting element, is required for binding of these NFs,
and can therefore be defined as the "CCTCCT motif."
|
, D1 CCT KO). Significant
reduction of this activity was observed by the 497-bp deletion from
-802 to -305 (Fig. 6, D1 CCT KO to D6 CCT KO). This was not observed
in nonstimulated cells, suggesting that PMA/ionomycin response elements
are located between positions -802 and -305. IL-10 gene expression is regulated by the transcription factors Sp1 and Sp3
Because we could not find any transcription factor recognition
sequences using the transcription factor database (20), we
could not implicate any particular NFs for binding to this CCTCCT
motif. However, previous reports have described the binding of the zinc
finger protein WT1 (a product of the Wilms tumor suppressor gene) to
TCC repeats in the EGFR promoter (23) and to a
cis-acting element (not a CCTCCT motif) in c-myb
promoter (24). Furthermore, the transcription factors Sp1
and Egr-1 also bind to this c-myb element (24).
We wondered whether the three complexes (C1, C2, and C3) involving the
CCTCCT motif in the IL-10 promoter were formed with any of these
transcription factors. To investigate this possibility, a super gel
mobility band shift assay was performed using Abs that bind to WT1, Sp
factors (Sp1, Sp2, Sp3, and Sp4) (25, 26, 27), and Egr factors
(Egr-1, Egr-2, and Egr-3) (28, 29, 30, 31). We were indeed able to
show binding of anti-Sp1 and anti-Sp3 Abs to these complexes.
Complex C1 disappeared with an anti-Sp1 Ab (Fig. 7, lanes 2 and 4),
revealing a further shifted complex (Fig. 7, lanes 2 and
4, Sp1+ Ab). Complexes C2 and C3 also disappeared with an
anti-Sp3 Ab (Fig. 7, lanes 3 and 4) with a
new shifted complex appearing (Fig. 7, lanes 3 and
4, Sp3+ Ab). Two complexes disappeared with the anti-Sp3
Ab, suggesting that this Ab binds to two different sized Sp3 as
described previously (32). However, only one further
shifted band was observed (Fig. 7, lane 3, Sp3 + Ab). It is
conceivable that a further shifted band is located, and thus not
detected, in the same position as complex C1. Indeed, a weak band was
observed at the same position as C1 (Fig. 7, lane 1) with
anti-Sp1 and -Sp3 Abs (Fig. 7, lane 4, Sp3 + Ab in
parentheses).
|
A) was
cotransfected with a Sp1 (pPacSp1) or Sp3 (pPacUSp3) expression plasmid
(Fig. 8). Luciferase activity generated
using D6 was up-regulated with pPacSp1 and pPacUSp3, suggesting that
IL-10 gene expression is positively regulated by both transcription
factors Sp1 and Sp3.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We speculate that the Sp1 and Sp3 are also the major positive regulators of human IL-10 transcription. The CCTCCT motif is conserved in the human IL-10 promoter region, and when replaced by a GAATTC sequence, promoter activity is substantially reduced (M. Tone et al., unpublished data).
Sp3 has in other circumstances been known to cause repression of Sp1-mediated transcriptional activation (32). However, this inhibitory activity was not observed for IL-10 transcription as shown in Drosophila SL2 cells transfected with both pPacSp1 and pPacUSp3 (data not shown). Inhibition of Sp1-mediated transcriptional activation has also been observed with WT1. WT1 is known to bind a TCCTCC motif in the EGFR promoter (23) and can down-regulate expression of that gene (38). Although we did not detect binding of WT1 to the IL-10 CCTCCT motif using the nuclear extract from EL-4 cells, we could not completely rule out a role for it as a negative regulator of IL-10 gene expression.
By use of a luciferase assay using promoter constructs D1 CCT KO and D6
CCT KO (Fig. 6), we have found that PMA/ionomycin response elements
might be located between positions -802 and -305. However, we could
not detect significant reduction of luciferase activity using a series
of deletion mutants (Fig. 2). Presumably, the weak activity of this
response element is hidden by the strong Sp1 and Sp3 activities. A
further set of luciferase reporter plasmids (e.g., plasmids constructed
using deletion mutants that do not contain the Sp1 and Sp3 recognition
sequence) will be required to identify these particular response
elements.
We have shown strong IL-10 promoter activity in nonstimulated EL-4
cells. The pattern of the gel mobility band shift assay using nuclear
extracts from nonstimulated EL-4 cells with probe P4 was also identical
with that using a nuclear extract from PMA/ionomycin-stimulated EL-4
cells (data not shown). However, the IL-10 mRNA level in nonstimulated
EL-4 cells was much lower than that in stimulated cells (Fig. 1). The
amount of IL-10 mRNA expressed in nonstimulated EL-4 cells seems to be
maintained at a low level through posttranscriptional mechanisms. Six
AUUUA mRNA destabilization sequences with A + U-rich sequences are
located in the 3'-untranslated region of IL-10 mRNA, and in the
accompanying paper (13), we show that they are responsible
for posttranscriptional regulation of IL-10 expression through these
RNA destabilizing signals. We do not rule out the possibility of other
transcriptional regulatory elements not included in the promoter
fragment (e.g., enhancers).
IL-10 seems to be a major homeostatic regulator of inflammation, immune responses, and involved in prevention of autoimmunity (39). Why then should one find that the transcriptional control of the IL-10 gene is so dependent on these ubiquitously and constitutively expressed transcription factors, Sp1 and Sp3? It may be that the immune system requires rapid availability of homeostatic regulators such as IL-10 and achieves this by ensuring that the gene is actively transcribing in a variety of cell types, but determines protein availability through posttranscriptional mechanisms.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Masahide Tone, Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford, OX1 3RE, U.K.
3 Abbreviations used in this paper: HPRT, hypoxanthine phosphoribosyltransferase; RACE, the rapid amplification of cDNA ends procedure; bmDC, bone marrow-derived dendritic cell; EGFR, epidermal growth factor receptor.
Received for publication December 21, 1999. Accepted for publication April 13, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-inducing factor) gene expression. J. Immunol. 159:6156.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  D. D. Sloan and K. R. Jerome Herpes Simplex Virus Remodels T-Cell Receptor Signaling, Resulting in p38-Dependent Selective Synthesis of Interleukin-10 J. Virol., November 15, 2007; 81(22): 12504 - 12514. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Csoka, Z. H. Nemeth, L. Virag, P. Gergely, S. J. Leibovich, P. Pacher, C.-X. Sun, M. R. Blackburn, E. S. Vizi, E. A. Deitch, et al. A2A adenosine receptors and C/EBP{beta} are crucially required for IL-10 production by macrophages exposed to Escherichia coli Blood, October 1, 2007; 110(7): 2685 - 2695. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Norkina, A. Dolganiuc, T. Shapiro, K. Kodys, P. Mandrekar, and G. Szabo Acute alcohol activates STAT3, AP-1, and Sp-1 transcription factors via the family of Src kinases to promote IL-10 production in human monocytes J. Leukoc. Biol., September 1, 2007; 82(3): 752 - 762. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Dong, C. Ivascu, H.-D. Chang, P. Wu, R. Angeli, L. Maggi, F. Eckhardt, L. Tykocinski, C. Haefliger, B. Mowes, et al. IL-10 Is Excluded from the Functional Cytokine Memory of Human CD4+ Memory T Lymphocytes J. Immunol., August 15, 2007; 179(4): 2389 - 2396. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Tone, Y. Kojima, K. Furuuchi, M. Brady, Y. Yashiro-Ohtani, M. L. Tykocinski, and M. Tone OX40 Gene Expression Is Up-Regulated by Chromatin Remodeling in Its Promoter Region Containing Sp1/Sp3, YY1, and NF-{kappa}B Binding Sites J. Immunol., August 1, 2007; 179(3): 1760 - 1767. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. J. Staples, T. Smallie, L. M. Williams, A. Foey, B. Burke, B. M. J. Foxwell, and L. Ziegler-Heitbrock IL-10 Induces IL-10 in Primary Human Monocyte-Derived Macrophages via the Transcription Factor Stat3 J. Immunol., April 15, 2007; 178(8): 4779 - 4785. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhang, P. Hei, L. Deng, and J. Lin Interleukin-10 gene promoter polymorphisms and their protein production in peritoneal fluid in patients with endometriosis Mol. Hum. Reprod., February 1, 2007; 13(2): 135 - 140. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. N. Kremer, A. Kumar, and K. E. Hedin Haplotype-Independent Costimulation of IL-10 Secretion by SDF-1/CXCL12 Proceeds via AP-1 Binding to the Human IL-10 Promoter J. Immunol., February 1, 2007; 178(3): 1581 - 1588. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Calado, T. Paixao, D. Holmberg, and M. Haury Stochastic Monoallelic Expression of IL-10 in T Cells J. Immunol., October 15, 2006; 177(8): 5358 - 5364. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Cao, X. Zhang, J. P. Edwards, and D. M. Mosser NF-{kappa}B1 (p50) Homodimers Differentially Regulate Pro- and Anti-inflammatory Cytokines in Macrophages J. Biol. Chem., September 8, 2006; 281(36): 26041 - 26050. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Beisner, M. B. Buck, P. Fritz, J. Dippon, M. Schwab, H. Brauch, G. Zugmaier, K. Pfizenmaier, and C. Knabbe A Novel Functional Polymorphism in the Transforming Growth Factor-{beta}2 Gene Promoter and Tumor Progression in Breast Cancer. Cancer Res., August 1, 2006; 66(15): 7554 - 7561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Shoemaker, M. Saraiva, and A. O'Garra GATA-3 Directly Remodels the IL-10 Locus Independently of IL-4 in CD4+ T Cells J. Immunol., March 15, 2006; 176(6): 3470 - 3479. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. H. Nemeth, C. S. Lutz, B. Csoka, E. A. Deitch, S. J. Leibovich, W. C. Gause, M. Tone, P. Pacher, E. S. Vizi, and G. Hasko Adenosine Augments IL-10 Production by Macrophages through an A2B Receptor-Mediated Posttranscriptional Mechanism J. Immunol., December 15, 2005; 175(12): 8260 - 8270. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A Suarez, P Lopez, L Mozo, and C Gutierrez Differential effect of IL10 and TNF{alpha} genotypes on determining susceptibility to discoid and systemic lupus erythematosus Ann Rheum Dis, November 1, 2005; 64(11): 1605 - 1610. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yamaoka, B. Min, Y.-J. Zhou, W. E. Paul, and J. J. O'Shea Jak3 negatively regulates dendritic-cell cytokine production and survival Blood, November 1, 2005; 106(9): 3227 - 3233. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Riemann, R. Endres, S. Liptay, K. Pfeffer, and R. M. Schmid The I{kappa}B Protein Bcl-3 Negatively Regulates Transcription of the IL-10 Gene in Macrophages J. Immunol., September 15, 2005; 175(6): 3560 - 3568. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Goffin, D. Demonte, C. Vanhulle, S. de Walque, Y. de Launoit, A. Burny, Y. Collette, and C. Van Lint Transcription factor binding sites in the pol gene intragenic regulatory region of HIV-1 are important for virus infectivity Nucleic Acids Res., August 1, 2005; 33(13): 4285 - 4310. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Saraiva{paragraph}, J. R. Christensen, A. V. Tsytsykova, A. E. Goldfeld, S. C. Ley, D. Kioussis, and A. O'Garra Identification of a Macrophage-Specific Chromatin Signature in the IL-10 Locus J. Immunol., July 15, 2005; 175(2): 1041 - 1046. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wilmanski, M. Siddiqi, E. A. Deitch, and Z. Spolarics Augmented IL-10 production and redox-dependent signaling pathways in glucose-6-phosphate dehydrogenase-deficient mouse peritoneal macrophages J. Leukoc. Biol., July 1, 2005; 78(1): 85 - 94. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Yao, W. Li, M. H. Kaplan, and C.-H. Chang Interleukin (IL)-4 inhibits IL-10 to promote IL-12 production by dendritic cells J. Exp. Med., June 20, 2005; 201(12): 1899 - 1903. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Cao, J. Liu, L. Song, and X. Ma The Protooncogene c-Maf Is an Essential Transcription Factor for IL-10 Gene Expression in Macrophages J. Immunol., March 15, 2005; 174(6): 3484 - 3492. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Grenningloh, B. Y. Kang, and I-C. Ho Ets-1, a functional cofactor of T-bet, is essential for Th1 inflammatory responses J. Exp. Med., February 22, 2005; 201(4): 615 - 626. [Abstract] [Full Text] [PDF]
|
|
|
|
