The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tone, M.
Right arrow Articles by Waldmann, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tone, M.
Right arrow Articles by Waldmann, H.
The Journal of Immunology, 2000, 165: 286-291.
Copyright © 2000 by The American Association of Immunologists

IL-10 Gene Expression Is Controlled by the Transcription Factors Sp1 and Sp31

Masahide Tone2, Mark J. Powell, Yukiko Tone, Sara A. J. Thompson and Herman Waldmann

Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-10 is an 18-kDa cytokine with a key role in homeostatic control of inflammatory and immune responses. We have investigated how transcription of the IL-10 gene is regulated, so as to be able to understand the circumstances of IL-10 expression in both health and disease. In the mouse, IL-10 gene expression is regulated by a TATA-type promoter with a critical cis-acting element containing GGA repeats located at -89 to -77. Its complementary sequence is similar to the cis-acting elements (TCC repeats) in the promoters of genes encoding epidermal growth factor receptor and CD58. All these elements comprise a common CCTCCT sequence with less conserved C + T-rich sequences. Eliminating this CCTCCT sequence results in a marked reduction in promoter activity, suggesting a necessary role in IL-10 gene expression. Despite its dissimilarity to the G + C-rich Sp1 consensus sequence (GC box), Sp1 and Sp3 transcription factors could be shown to bind to this motif. The requirement for Sp1 and Sp3 in transcription of IL-10 was confirmed using Drosophila SL2 cells, which lack endogenous Sp factors. These results suggest that the transcription of IL-10 is positively regulated by both Sp1 and Sp3.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-10 is an 18-kDa glycoprotein (1, 2), initially identified as a product of Th2 cells that has subsequently been shown to be produced by a wide range of cell types, including Th1 cells, Tr1 cells, B cells, monocytes, macrophages, keratinocytes, and many tumor cells (2, 3, 4, 5, 6, 7, 8). It behaves like a potent antiinflammatory and immunosuppressive molecule, inhibiting the production and release of IL-2 and IFN-{gamma} and a range of proinflammatory cytokines such as TNF-{alpha}, IL-1, IL-6, and IL-12 (2, 9). Despite its crucial role in immunoregulation, the factors regulating expression of IL-10 gene are poorly understood at both the transcriptional and posttranscriptional levels. Control at the posttranscriptional level has been implied from the identification of potential mRNA-destabilizing sequences (AUUUA with A + U-rich sequences) in 3'-untranslated regions of mouse and human IL-10 mRNA (10, 11, 12). In the accompanying paper (13), we show direct evidence for such posttranscriptional control. In this paper, however, we examine how IL-10 is controlled at the transcriptional level.

The mouse IL-10 gene was cloned, and its DNA sequence including the 5'-flanking region was determined (14). This gene comprises five exons distributed over 5.1 kb of DNA. A typical TATA box sequence is located 97 bp upstream of the first ATG within a corresponding region previously shown to have promoter activity for human IL-10 (15).

We have made the novel and surprising observation that, unlike most other cytokines, IL-10 gene expression is regulated by the constitutively and ubiquitously expressed Sp1 and Sp3 as key transcription factors. This may explain how the IL-10 gene can continue to be transcribed when other cytokine genes are inactive. This combination of constitutive expression and fine control at the posttranscriptional level may permit a rapid homeostatic response to inflammation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reverse transcriptase-PCR

IL-10 mRNA levels were determined by RT-PCR. First strand cDNA was prepared from 1 µg total RNA using an oligo(dT) primer. This reaction mixture (20 µl) was diluted with 80 or 180 µl water, and then 0, 5, 10, or 20 µl of the cDNA solution were utilized for PCR amplification using sense and antisense primers (IL-10; 25 cycles, hypoxanthine phosphoribosyltransferase (HPRT)3; 17 cycles). The primer sequences used were: IL-10 sense primer, CCAGTTTTACCTGGTAGAAGTGATG; IL-10 antisense primer, TGTCTAGGTCCTGGAGTCCAGCAGACTC; HPRT sense primer, ACAGCCCCAAAATGGTTAAGG; and HPRT antisense primer, TCTGGGGACGCAGCAACTGAC. The amplified cDNAs were detected by Southern blot hybridization using cDNA probes.

Mapping of transcription start sites

To determine transcription start sites, we performed the rapid amplification of cDNA ends procedure (RACE) as described previously (16). cDNA for 5'-RACE was prepared using an antisense primer (GGAGTCGGTTAGCAGTATGTTGTCC) and 10 µg total RNA. After adding a G-tail at 5'-end, IL-10 cDNA was amplified using a poly(C) primer and an antisense primer (CACCTGGCTGAAGGCAGTCCGCAGCTC). Amplified fragments were cloned, and the DNA sequences were determined.

Assessment of promoter activity using the luciferase assay

Luciferase reporter plasmids were constructed using deletion mutants of the 5'-flanking region of the IL-10 gene and pGL3-Basic Vector (Promega, Madison, WI). This 5'-flanking fragment was subcloned from a {lambda} IL-10 genomic clone, a kind gift from Dr. K. Moore (DNAX Research Institute, Palo Alto, CA). These deletion mutants (D1 to D11) were generated by the exonuclease III/mung bean nuclease procedure or by PCR. The structures of these deletion mutants are indicated in Fig. 2GoA. The resulting deletion mutants, KpnI/SacI fragments, were cloned upstream of the luciferase gene in pGL3-Basic Vector. The SacI site (3'-end of the deletion mutants) is located at +63 in the IL-10 gene.



View larger version (60K):
[in this window]
[in a new window]
 
FIGURE 2. Promoter activity of the IL-10 gene. A, Luciferase reporter plasmids were constructed using pGL3-Basic Vector (Promega) and 5'-flanking fragments of the IL-10 gene. The position of TATA box, the relative lengths and positions of the fragments (solid lines), and the position of the 5'-ends of these fragments (D1 to D11) are indicated. B, Luciferase activities generated using the reporter plasmids (D1 to D11) were compared with that using the negative control plasmid (no insert) pGL3-Basic vector (Basic) in EL-4, PMA/ionomycin-stimulated EL-4, RAW 264, and LPS-stimulated RAW 264 cells. Luciferase assays were repeated more than three times, and the activities were normalized using Renilla luciferase activity.

 
To construct plasmid D1 CCT KO and D6 CCT KO, the CCTCCT sequences (-85 to -80) in plasmid D1 and D6 were replaced by GAATTC (EcoRI site) by PCR.

EL-4 and RAW 264 cells (2 x 107) were transfected by electroporation using 10 µg of luciferase reporter plasmids with 0.1 µg pRL-SV40 or pRL-TK (Promega) as an internal control plasmid. If required, cells were stimulated with PMA (50 ng/ml)/ionomycin (1 µM) or LPS (20 µg/ml) 7 h postelectroporation. Cells were harvested 48 h postelectroporation, and promoter activities were analyzed by the Dual-luciferase Reporter Assay System (Promega). These assays were repeated more than three times, and the activities were normalized to Renilla luciferase activities.

Drosophila SL2 cells (2 x 106) were transfected using 0.5 µg of the luciferase reporter plasmid containing the IL-10 promoter (D6; -305 to +63) with pPac, pPacSp1, and pPacUSp3. Scheider SL2 cells were obtained from American Type Culture Collection (Manassas, VA). The expression plasmids were kind gifts from Dr. G. Suske (Philipps-Universitat, Marburg, Germany). Transfection was performed using Pfx-20 transfection reagent (Promega). Luciferase activities were analyzed 48 h posttransfection. These assays were repeated more than three times.

Gel mobility band shift assays

A nuclear extract from EL-4 cells was prepared using methods described by Dignam et al. (17). Gel mobility band shift assay was performed as described previously (18). To perform super gel mobility band shift assay, the reaction mixture was incubated with anti-Sp1 (Santa Cruz, PEP2) and/or anti-Sp3 (Santa Cruz D-20) Abs.

DNase I footprinting

A DNase I footprinting assay was performed according to the method described by Dynan and Tjian (19). A DNA fragment of the promoter region was amplified by PCR using a 32P-labeled primer (CTGAAGGCTCAGTGGGGCCTTCC) and an unlabeled primer (CCAGTTCTTTAGCGCTTACAATGC). The PCR product was isolated and incubated with 0–50 µg of a nuclear extract in 20 mM HEPES (pH 7.9), 2 mM MgCl2, 50 mM NaCl, 1 mM DTT, 20% glycerol, and 4 µg poly[d(I-C)]-poly[d(I-C)]. The mixtures were treated with DNase I at 25°C for 1 min. Purified DNAs from these mixtures were analyzed by sequencing gel with sequence ladders generated using the same labeled primer.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
cis-Acting elements for IL-10 gene expression

IL-10 production has been demonstrated in diverse cell types (2, 3, 4, 5, 6, 7, 8). We have analyzed IL-10 mRNA levels by RT-PCR using RNAs from a fibroblast cell line, L929, a T cell line, EL-4, a macrophage cell line, RAW 264, and a B cell line, A20, as well as bone marrow-derived dendritic cells (bmDC). IL-10 mRNA was detected in all these cell types, albeit at different levels (Fig. 1Go). High level expression of IL-10 mRNA was observed in PMA/ionomycin-stimulated EL-4, A20, PMA-stimulated A20, and LPS-stimulated bmDC (Fig. 1Go). We have investigated IL-10 transcription in two of these populations, namely, EL4 (lymphoid) and RAW 264 (nonlymphoid) cells.



View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 1. Expression of IL-10 mRNA in different type cells. IL-10 mRNA levels in indicated cell lines and cells were analyzed by RT-PCR. cDNAs were prepared using RNAs from indicated cells. A 20-µl sample of the cDNA solution was diluted with 180 µl of water. For PCR amplification, 0 µl (lane 0), 5 µl (lane 1), 10 µl (lane 2), and 20 µl (lane 3) of the diluted cDNA solution were used. To detect low levels of IL-10 mRNA, 20 µl of the cDNA reaction mixture were diluted with 80 µl water and then 0 µl (lane 0), 5 µl (lane 4), 10 µl (lane 5), and 20 µl (lane 6) of this diluted cDNA solution were used for PCR amplification. Amplified cDNA fragments were detected by Southern blot hybridization using IL-10 and HPRT cDNA probes.

 
A transcription start site for the IL-10 gene was determined by 5'-RACE using RNA from PMA/ionomycin-stimulated EL-4, PMA-stimulated A20 cells, and LPS-stimulated bmDC. A total of 26 of 42 5'-RACE clones contained the same 5'-end (EL-4, 7 of 11; A20, 11 of 20; bmDC, 8 of 11), and this position was mapped 30 bp downstream of a typical TATA box sequence (i.e., 67 bp upstream of the first ATG), suggesting that IL-10 transcription might be regulated by a TATA-type promoter. The major transcription start site is then defined as position +1. The other 5'-ends of 12 of 42 clones (EL-4, 3 of 11; A20, 6 of 11; bmDC, 3 of 11) and 4 of 42 clones (EL-4, 1 of 11; A20, 3 of 20) were mapped at +2 and +3, respectively.

Promoter activity of the 5'-flanking region was analyzed by luciferase reporter assays using a series of deletion mutants in stimulated and nonstimulated EL-4 and RAW 264 cells. The structures of the luciferase reporter plasmids are shown in Fig. 2GoA. Luciferase activities generated in these cells using the reporter plasmids were compared with that using a negative control plasmid (no insert, pGL3-Basic Vector) (Fig. 2GoB). The negative control plasmid exhibited high background luciferase activity in PMA/ionomycin-stimulated EL-4 cells (often >4-fold above that in nonstimulated cells). This meant that the calculated relative luciferase activities in these cells was low, thus precluding useful comparison between stimulated and nonstimulated cells. IL-10 promoter activity was observed in all tested cells. Surprisingly, no significant reduction of promoter activity was observed by the 673-bp deletion from -802 to -129 (Fig. 2GoB, D1 to D9). In all tested cells, a large reduction of promoter activity was caused by the 55-bp deletion from -129 to -74 (Fig. 2GoB, D9 to D10), suggesting that critical cis-acting elements for IL-10 promoter activity are located in this region. To analyze binding of NFs to this region and its surrounding sequence, a gel mobility band shift assay was performed using a nuclear extract from EL-4 cells. Five oligonucleotide probes, P1 (-140 to -116), P2 (-125 to -101), P3 (-110 to -86), P4 (-95 to -71), and P5 (-80 to -56) were synthesized and annealed. Positions of these probes in the promoter region are shown in Fig. 3GoA. Three slowly migrating complexes were detected with probe P4 (Fig. 3GoB, C1–C3). To confirm DNA-dependent complex formation, a competition assay was performed. NF binding to the 32P-labeled probe P4 was inhibited with a 100-fold excess of unlabeled P4 but not with P3 and P5 (Fig. 3GoC), indicating that this interaction is DNA sequence specific.



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 3. Binding of NFs to the IL-10 promoter. Binding of NFs to the IL-10 promoter region between -140 and -56 were analyzed by a gel mobility band shift assay using oligonucleotide probes (P1 to P5). A, Position of the probes are indicated above and below the nucleotide sequence of the IL-10 promoter (14 ). The 5'-ends of D9 and D10 deletion mutants are indicated by arrows. B, A gel mobility band shift assay was performed using 32P-labeled probes (P1–P5) and a nuclear extract from EL-4 cells. Three slowly migrated complexes (C1–C3) are indicated. C, Binding of the NFs to 32P-labeled P4 was competed with 100-fold excess of unlabeled P4, P3, and P5. Competitors are indicated at the top.

 
NF binding to the IL-10 promoter (-177 to -31) was also analyzed by DNase I footprinting using the nuclear extract from EL-4 cells. Protection from DNase I by binding of NFs was detected at position -92 to -71 (Fig. 4Go). This region overlapped with the NF-binding region detected by the gel mobility band shift assay using probe P4 (-95 to -71). To determine a more accurate location for the cis-acting element, seven mutant oligonucleotide probes (M1 to M7) were designed, synthesized, and annealed. The DNA sequence of the mutant probes are shown in Fig. 5GoB. The complexes C1, C2, and C3 were detected with wild-type probe P4 and mutant probes M1 and M7 but not with probes M2 to M6 (Fig. 5GoA), indicating that 13-bp sequence AGGGAGGAGGAGC is required for NF binding (Fig. 5GoB, CONSENSUS).



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 4. Analysis of NF binding by a DNase I footprinting. The 5'-flanking region was amplified using 32P-labeled and unlabeled primers to label one end. The fragment was incubated with 0 µg (lane 0), 12.5 µg (lane 1), 25 µg (lane 2), and 50 µg (lane 3) of nuclear extracts from EL-4 cells and was partially digested with DNase I. The DNA was purified and analyzed by sequence gel with a sequence ladder generated using the same 32P-labeled primer. The DNA sequence of the protected region is indicated next to the gel in boldface.

 


View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 5. Analysis of NF binding using mutant probes. A, A gel mobility band shift assay was performed using probe P4 (Wt) and mutant probes (M1–M7) and a nuclear extract from EL-4 cells. B, DNA sequences of the probes used in A are shown. Mutated sequences are indicated by boldface. The consensus sequence suggested in A is indicated at the bottom.

 
IL-10 gene expression is regulated by a CCTCCT motif

We could find no potential NF recognition sequence in this 13-bp region using the transcription factor database (20). However, transcription of the human epidermal growth factor receptor (EGFR) (21) and CD58 (22) genes is known to be regulated by cis-acting elements containing TCC repeats. We noticed the presence of TCC repeats in the complementary sequence (GCTCCTCCTCCCT) of the 13-bp region. This 13-bp sequence (antisense) plus the boundary sequence was, therefore, aligned with sequences of the four TCC repeating cis-acting elements in the EGFR promoter, the cis-acting element in CD58 promoter, and corresponding region in the human IL-10 promoter (Fig. 6GoA). A CCTCCT sequence was found in all aligned sequences and was followed by C + T-rich sequences. This CCTCCT sequence is also found at the corresponding region in the human IL-10 promoter (Fig. 6GoA). We investigated whether this CCTCCT sequence could provide the core sequence of the cis-acting element for IL-10 transcription by changing the CCTCCT sequence to GAATTC (EcoRI site) in two luciferase reporter plasmids D1 and D6 (Fig. 2GoA, D1, D6; Fig. 6GoB, D1, CCT KO; D6, CCT KO). Promoter activity was then assessed in EL-4 cells (Fig. 6GoC). This change produced a large reduction of promoter activity with both D1 and D6 plasmids, indicating that the CCTCCT sequence was required for IL-10 gene expression. This loss of promoter activity was accompanied by the disappearance of all three complexes (C1, C2, and C3) observed in the gel mobility band shift assay using probe P4 (Fig. 5Go, M4). These results suggest that the CCTCCT sequence is the core of this cis-acting element, is required for binding of these NFs, and can therefore be defined as the "CCTCCT motif."



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 6. IL-10 gene expression is regulated by CCTCCT motif. A, The antisense sequence from position -76 to position -96 in the mouse (M) IL-10 promoter was aligned with TCC repeats identified in promoters of human (H) CD58 (22 ) and EGFR (21 ) genes and a corresponding sequence in the human IL-10 promoter (14 ). A common CCTCCT sequence is found in all sequences and indicated by boldface. B, CCTCCT sequences in luciferase reporter plasmids D1 and D6 (Fig. 2GoA) are mutated to GAATTC (EcoRI) (D1 CCT KO, D6 CCT KO). C, Luciferase activities generated using indicated plasmids were compared with that using the negative control plasmid pGL3-Basic Vector (Basic) in EL-4 and PMA/ionomycin-stimulated EL-4 cells. Luciferase assays were repeated more than three times, and the activities were normalized using Renilla luciferase activity.

 
In PMA/ionomycin-stimulated EL-4 cells, weak promoter activity was still detected using plasmid D1 CCT KO (Fig. 6Go, D1 CCT KO). Significant reduction of this activity was observed by the 497-bp deletion from -802 to -305 (Fig. 6Go, D1 CCT KO to D6 CCT KO). This was not observed in nonstimulated cells, suggesting that PMA/ionomycin response elements are located between positions -802 and -305.

IL-10 gene expression is regulated by the transcription factors Sp1 and Sp3

Because we could not find any transcription factor recognition sequences using the transcription factor database (20), we could not implicate any particular NFs for binding to this CCTCCT motif. However, previous reports have described the binding of the zinc finger protein WT1 (a product of the Wilms tumor suppressor gene) to TCC repeats in the EGFR promoter (23) and to a cis-acting element (not a CCTCCT motif) in c-myb promoter (24). Furthermore, the transcription factors Sp1 and Egr-1 also bind to this c-myb element (24). We wondered whether the three complexes (C1, C2, and C3) involving the CCTCCT motif in the IL-10 promoter were formed with any of these transcription factors. To investigate this possibility, a super gel mobility band shift assay was performed using Abs that bind to WT1, Sp factors (Sp1, Sp2, Sp3, and Sp4) (25, 26, 27), and Egr factors (Egr-1, Egr-2, and Egr-3) (28, 29, 30, 31). We were indeed able to show binding of anti-Sp1 and anti-Sp3 Abs to these complexes. Complex C1 disappeared with an anti-Sp1 Ab (Fig. 7Go, lanes 2 and 4), revealing a further shifted complex (Fig. 7Go, lanes 2 and 4, Sp1+ Ab). Complexes C2 and C3 also disappeared with an anti-Sp3 Ab (Fig. 7Go, lanes 3 and 4) with a new shifted complex appearing (Fig. 7Go, lanes 3 and 4, Sp3+ Ab). Two complexes disappeared with the anti-Sp3 Ab, suggesting that this Ab binds to two different sized Sp3 as described previously (32). However, only one further shifted band was observed (Fig. 7Go, lane 3, Sp3 + Ab). It is conceivable that a further shifted band is located, and thus not detected, in the same position as complex C1. Indeed, a weak band was observed at the same position as C1 (Fig. 7Go, lane 1) with anti-Sp1 and -Sp3 Abs (Fig. 7Go, lane 4, Sp3 + Ab in parentheses).



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 7. Transcription factors Sp1 and Sp3 bind to CCTCCT motif. Binding of Sp1 and Sp3 to probe P4 was analyzed by a super gel mobility band shift assay using anti-Sp1 and anti-Sp3 Abs. A nuclear extract from EL-4 cells was incubated with indicated (+) Abs and then mixed with 32P-labeled probe P4. Complex formation was analyzed by a gel mobility band shift assay. Complexes (C1–C3) with Sp1 or Sp3 are indicated. Further shifted bands with anti-Sp1 and anti-Sp3 Abs are indicated. A possible further shifted band with the anti-Sp3 Ab was indicated in parentheses.

 
We have therefore demonstrated that Sp1 and Sp3 bind to the CCTCCT motif in the IL-10 promoter. To confirm that IL-10 gene expression is regulated by Sp1 and Sp3, a luciferase reporter assay was performed using Drosophila SL2 cells which lack endogenous Sp factors. The IL-10 luciferase reporter plasmid D6 (Fig. 2GoA) was cotransfected with a Sp1 (pPacSp1) or Sp3 (pPacUSp3) expression plasmid (Fig. 8Go). Luciferase activity generated using D6 was up-regulated with pPacSp1 and pPacUSp3, suggesting that IL-10 gene expression is positively regulated by both transcription factors Sp1 and Sp3.



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 8. Effect of Sp1 and Sp3 on the IL-10 promoter in Drosophila SL2 cells. SL2 cells were transfected using 0.5 µg IL-10 reporter plasmid D6 (Fig. 2GoA) with indicated amount of pPacSp1, pPacUSp3, or pPac (no insert). Luciferase activities generated using D6 in SL2 cells cotransfected with pPacSp1 or pPacUSp3 (0.1–2 µg) were compared with that in SL2 cells cotransfected with pPac (2 µg). Total amount of the expression plasmids (pPacSp1 and pPacUSp3) was maintained to 2 µg with pPac. The amounts of these expression plasmids are indicated at the bottom. These assays were repeated more than three times.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have determined a transcription start site for IL-10 gene expression. A typical TATA box, TATAAAA is located at -30 to -24, indicating that transcription of IL-10 is regulated by a TATA-type promoter as are many other cytokine genes, although not all (e.g., IL-7 (33), IL-12 p35 (34, 35), and IL-18 (36) genes). We have also demonstrated that IL-10 gene expression is regulated by transcription factors Sp1 and Sp3, which are known to be constitutively expressed and to bind to the G + C-rich consensus sequence (GC box). These transcription factors, therefore, can regulate constitutive expression of many housekeeping genes controlled by G + C-rich promoters. Ubiquitous IL-10 expression might be regulated in a manner similar to that of other housekeeping genes. However, the binding sequence of these transcription factors in IL-10 promoter is not the GC box but a cis-acting element containing CCTCCT sequence as a core. One previous report shows Sp1 binding to the CTCCTCCT sequence in the WT1 promoter (37) which contains the CCTCCT core. It seems, therefore, that Sp1 and Sp3 recognize this "CCTCCT motif" as a second consensus sequence.

We speculate that the Sp1 and Sp3 are also the major positive regulators of human IL-10 transcription. The CCTCCT motif is conserved in the human IL-10 promoter region, and when replaced by a GAATTC sequence, promoter activity is substantially reduced (M. Tone et al., unpublished data).

Sp3 has in other circumstances been known to cause repression of Sp1-mediated transcriptional activation (32). However, this inhibitory activity was not observed for IL-10 transcription as shown in Drosophila SL2 cells transfected with both pPacSp1 and pPacUSp3 (data not shown). Inhibition of Sp1-mediated transcriptional activation has also been observed with WT1. WT1 is known to bind a TCCTCC motif in the EGFR promoter (23) and can down-regulate expression of that gene (38). Although we did not detect binding of WT1 to the IL-10 CCTCCT motif using the nuclear extract from EL-4 cells, we could not completely rule out a role for it as a negative regulator of IL-10 gene expression.

By use of a luciferase assay using promoter constructs D1 CCT KO and D6 CCT KO (Fig. 6Go), we have found that PMA/ionomycin response elements might be located between positions -802 and -305. However, we could not detect significant reduction of luciferase activity using a series of deletion mutants (Fig. 2Go). Presumably, the weak activity of this response element is hidden by the strong Sp1 and Sp3 activities. A further set of luciferase reporter plasmids (e.g., plasmids constructed using deletion mutants that do not contain the Sp1 and Sp3 recognition sequence) will be required to identify these particular response elements.

We have shown strong IL-10 promoter activity in nonstimulated EL-4 cells. The pattern of the gel mobility band shift assay using nuclear extracts from nonstimulated EL-4 cells with probe P4 was also identical with that using a nuclear extract from PMA/ionomycin-stimulated EL-4 cells (data not shown). However, the IL-10 mRNA level in nonstimulated EL-4 cells was much lower than that in stimulated cells (Fig. 1Go). The amount of IL-10 mRNA expressed in nonstimulated EL-4 cells seems to be maintained at a low level through posttranscriptional mechanisms. Six AUUUA mRNA destabilization sequences with A + U-rich sequences are located in the 3'-untranslated region of IL-10 mRNA, and in the accompanying paper (13), we show that they are responsible for posttranscriptional regulation of IL-10 expression through these RNA destabilizing signals. We do not rule out the possibility of other transcriptional regulatory elements not included in the promoter fragment (e.g., enhancers).

IL-10 seems to be a major homeostatic regulator of inflammation, immune responses, and involved in prevention of autoimmunity (39). Why then should one find that the transcriptional control of the IL-10 gene is so dependent on these ubiquitously and constitutively expressed transcription factors, Sp1 and Sp3? It may be that the immune system requires rapid availability of homeostatic regulators such as IL-10 and achieves this by ensuring that the gene is actively transcribing in a variety of cell types, but determines protein availability through posttranscriptional mechanisms.


    Acknowledgments
 
Since submission of our manuscript, Brightbill et al. (40 ) have published on transcriptional control of IL-10 gene expression. They too have established a role for Sp1 in the transcriptional control of the IL-10 gene, but only in stimulated RAW 264 cells. Our conclusions differ insofar as we detect promoter activity in both stimulated and nonstimulated RAW 264 cells, perhaps as a result of the use of luciferase vectors in our study (41 ). In the accompanying paper (13 ), we explain the effects of stimulation on IL-10 expression, as a consequence of posttranscriptional control.


    Footnotes
 
1 This work was supported by the Medical Research Council and The Wellcome Trust. Back

2 Address correspondence and reprint requests to Dr. Masahide Tone, Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford, OX1 3RE, U.K. Back

3 Abbreviations used in this paper: HPRT, hypoxanthine phosphoribosyltransferase; RACE, the rapid amplification of cDNA ends procedure; bmDC, bone marrow-derived dendritic cell; EGFR, epidermal growth factor receptor. Back

Received for publication December 21, 1999. Accepted for publication April 13, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fiorentino, D. F., M. W. Bond, T. R. Mosmann. 1989. Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. J. Exp. Med. 170:2081.[Abstract/Free Full Text]
  2. Moore, K. W., A. O’Garra, R. de Waal-Malefyt, P. Vieira, T. R. Mosmann. 1993. Interleukin-10. Annu. Rev. Immunol. 11:165.[Medline]
  3. Del Prete, G., M. De Carli, F. Almerigogna, M. G. Giudizi, R. Biagiotti, S. Romagnani. 1993. Human IL-10 is produced by both type 1 helper (Th1) and type 2 (Th2) T cell clones and inhibits their antigen-specific proliferation and cytokine production. J. Immunol. 150:353.[Abstract]
  4. O’Garra, A., R. Chang, N. Go, R. Hastings, G. Haughton, M. Howard. 1992. Ly-1 B (B-1) cells are the main source of B cell-derived interleukin 10. Eur. J. Immunol. 22:711.[Medline]
  5. de Waal-Malefyt, R., J. Abrams, B. Bennett, C. G. Figdor, J. E. de Vries. 1991. Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J. Exp. Med. 174:1209.[Abstract/Free Full Text]
  6. Enk, A. H., S. I. Katz. 1992. Identification and induction of keratinocyte-derived IL-10. J. Immunol. 149:92.[Abstract]
  7. Gastl, G. A., J. S. Abrams, D. M. Nanus, R. Oosterkamp, J. Silver, F. Liu, M. Chen, A. P. Albino, N. H. Bander. 1993. Interleukin-10 production by human carcinoma cell lines and its relationship to interleukin-6 expression. Int. J. Cancer 55:96.[Medline]
  8. Groux, H., A. O’Garra, M. Bigler, M. Rouleau, S. Antonenko, J. E. de Vries, M. G. Roncarolo. 1997. A CD4+ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis. Nature 389:737.[Medline]
  9. D’Andrea, A., M. Aste-Amezaga, N. M. Valiante, X. Ma, M. Kubin, G. Trinchieri. 1993. Interleukin 10 (IL-10) inhibits human lymphocyte interferon gamma-production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells. J. Exp. Med. 178:1041.[Abstract/Free Full Text]
  10. Moore, K. W., P. Vieira, D. F. Fiorentino, M. L. Trounstine, T. A. Khan, T. R. Mosmann. 1990. Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein-Barr virus gene BCRFI. Science 248:1230.[Abstract/Free Full Text]
  11. Vieira, P., R. de Waal-Malefyt, M. N. Dang, K. E. Johnson, R. Kastelein, D. F. Fiorentino, J. E. de Vries, M. G. Roncarolo, T. R. Mosmann, K. W. Moore. 1991. Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: homology to Epstein-Barr virus open reading frame BCRFI. Proc. Natl. Acad. Sci. USA 88:1172.[Abstract/Free Full Text]
  12. Chen, C.-Y. A., A.-B. Shyu. 1995. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem. Sci. 20:465.[Medline]
  13. Powell, M. J., S. A. J. Thompson, Y. Tone, H. Waldmann, M. Tone. 2000. Posttranscriptional regulation of IL-10 gene expression through sequences in the 3'-untranslated region. J. Immunol. 165:292.-296. [Abstract/Free Full Text]
  14. Kim, J. M., C. I. Brannan, N. G. Copeland, N. A. Jenkins, T. A. Khan, K. W. Moore. 1992. Structure of the mouse IL-10 gene and chromosomal localization of the mouse and human genes. J. Immunol. 148:3618.[Abstract]
  15. Kube, D., C. Platzer, A. von Knethen, H. Straub, H. Bohlen, M. Hafner, H. Tesch. 1995. Isolation of the human interleukin 10 promoter: characterization of the promoter activity in Burkitt’s lymphoma cell lines. Cytokine 7:1.[Medline]
  16. Frohman, M. A., M. K. Dush, G. R. Martin. 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85:8998.[Abstract/Free Full Text]
  17. Dignam, J. D., R. M. Lebovitz, R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475.[Abstract/Free Full Text]
  18. Tone, M., L. E. Diamond, L. A. Walsh, Y. Tone, S. A. J. Thompson, E. M. Shanahan, J. S. Logan, H. Waldmann. 1999. High level transcription of the complement regulatory protein CD59 requires an enhancer located in intron 1. J. Biol. Chem. 274:710.[Abstract/Free Full Text]
  19. Dynan, W. S., R. Tjian. 1983. The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell 35:79.[Medline]
  20. Ghosh, D.. 1993. Status of the transcription factors database (TFD). Nucleic Acids Res. 21:3117.[Abstract/Free Full Text]
  21. Johnson, A. C., Y. Jinno, G. T. Merlino. 1988. Modulation of epidermal growth factor receptor proto-oncogene transcription by a promoter site sensitive to S1 nuclease. Mol. Cell. Biol. 8:4174.[Abstract/Free Full Text]
  22. Ewulonu, U. K., L. Ravi, M. E. Medof. 1991. Characterization of the decay-accelerating factor gene promoter region. Proc. Natl. Acad. Sci. USA 88:4675.[Abstract/Free Full Text]
  23. Wang, Z.-Y., Q.-Q. Qiu, K. T. Enger, T. F. Deuel. 1993. A second transcriptionally active DNA-binding site for the Wilms tumor gene product, WT1. Proc. Natl. Acad. Sci. USA 90:8896.[Abstract/Free Full Text]
  24. McCann, S., J. Sullivan, J. Guerra, M. Arcinas, L. M. Boxer. 1995. Repression of the c-myb gene by WT1 protein in T and B cell lines. J. Biol. Chem. 270:23785.[Abstract/Free Full Text]
  25. Kadonaga, J. T., K. R. Carner, F. R. Masiarz, R. Tjian. 1987. Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain. Cell 51:1079.[Medline]
  26. Kingsley, C., A. Winoto. 1992. Cloning of GT box-binding proteins: a novel Sp1 multigene family regulating T-cell receptor gene expression. Mol. Cell. Biol. 12:4251.[Abstract/Free Full Text]
  27. Hagen, G., S. Müller, M. Beato, G. Suske. 1992. Cloning by recognition site screening of two novel GT box binding proteins: a family of Sp1 related genes. Nucleic Acids Res. 20:5519.[Abstract/Free Full Text]
  28. Sukhatme, V. P., X. Cao, L. C. Chang, C.-H. Tsai-Morris, D. Stamenkovich, P. C. P. Ferreira, D. R. Cohen, S. A. Edwards, T. B. Shows, T. Curran, et al 1988. A zinc finger-encoding gene coregulated with c-fos during growth and differentiation, and after cellular depolarization. Cell 53:37.[Medline]
  29. Milbrandt, J.. 1987. A nerve growth factor-induced gene encodes a possible transcriptional regulatory factor. Science 238:797.[Abstract/Free Full Text]
  30. Joseph, L. J., M. M. Le Beau, G. A. Jamieson, S. Acharya, T. B. Shows, J. D. Rowley, V. P. Sukhatme. 1988. Molecular cloning, sequencing, and mapping of EGR2, a human early growth response gene encoding a protein with "zinc-binding finger" structure. Proc. Natl. Acad. Sci. USA 85:7164.[Abstract/Free Full Text]
  31. Patwardhan, S., A. Gashler, M. G. Siegel, L. C. Chang, L. J. Joseph, T. B. Shows, M. M. Le Beau, V. P. Sukhatme. 1991. EGR3, a novel member of the Egr family of genes encoding immediate-early transcription factors. Oncogene 6:917.[Medline]
  32. Hagen, G., S. Müller, M. Beato, G. Suske. 1994. Sp1-mediated transcriptional activation is repressed by Sp3. EMBO J. 13:3843.[Medline]
  33. Lupton, S. D., S. Gimpel, R. Jerzy, L. L. Brunton, K. A. Hjerrild, D. Cosman, R. G. Goodwin. 1990. Characterization of the human and murine IL-7 genes. J. Immunol. 144:3592.[Abstract]
  34. Tone, Y., S. A. J. Thompson, J. M. Babik, K. F. Nolan, M. Tone, C. Raven, H. Waldmann. 1996. Structure and chromosomal location of the mouse interleukin-12 p35 and p40 subunit genes. Eur. J. Immunol. 26:1222.[Medline]
  35. Babik, J.M., E. Adams, Y. Tone, P.J. Fairchild, M. Tone, H. Waldmann. 1999. Expression of murine IL-12 is regulated by translational control of the p35 subunit. J. Immunol. 162:4069.[Abstract/Free Full Text]
  36. Tone, M., S. A. J. Thompson, Y. Tone, P. J. Fairchild, H. Waldmann. 1997. Regulation of IL-18 (IFN-{gamma}-inducing factor) gene expression. J. Immunol. 159:6156.[Abstract]
  37. Cohen, H. T., S. A. Bossone, G. Zhu, G. A. McDonald, V. P. Sukhatme. 1997. Sp1 is a critical regulator of the Wilms’ tumor-1 gene. J. Biol. Chem. 272:2901.[Abstract/Free Full Text]
  38. Englert, C., X. Hou, S. Maheswaran, P. Bennett, C. Ngwu, G. G. Re, A. J. Garvin, M. R. Rosner, D. A. Haber. 1995. WT1 suppresses synthesis of the epidermal growth factor receptor and induces apoptosis. EMBO J. 14:4662.[Medline]
  39. Segal, B. M., B. K. Dwyer, E. M. Shevach. 1998. An interleukin (IL)-10/IL-12 immunoregulatory circuit controls susceptibility to autoimmune disease. J. Exp. Med. 187:537.[Abstract/Free Full Text]
  40. Brightbill, H. D., S. E. Plevy, R. L. Modlin, S. T. Smale. 2000. A prominent role for Sp1 during lipopolysaccharide-mediated induction of the IL-10 promoter in macrophages. J. Immunol. 164:1949.
  41. Plevy, S. E., J. H. Gemberling, S. Hsu, A. J. Domer, S. T. Smale. 1997. Multiple control elements mediate activation of the murine and human interleukin 12 p40 promoters: evidence of functional synergy between C/EBP and Rel proteins. Mol. Cell. Biol. 17:4572.[Abstract]



This article has been cited by other articles:


Home page
J. Immunol.Home page
Y. Alvarez, C. Municio, S. Alonso, M. Sanchez Crespo, and N. Fernandez
The Induction of IL-10 by Zymosan in Dendritic Cells Depends on CREB Activation by the Coactivators CREB-Binding Protein and TORC2 and Autocrine PGE2
J. Immunol., July 15, 2009; 183(2): 1471 - 1479.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Sharma, M. Kumar, J. Aich, M. Hariharan, S. K. Brahmachari, A. Agrawal, and B. Ghosh
Posttranscriptional regulation of interleukin-10 expression by hsa-miR-106a
PNAS, April 7, 2009; 106(14): 5761 - 5766.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. L. Maynard, R. D. Hatton, W. S. Helms, J. R. Oliver, C. B. Stephensen, and C. T. Weaver
Contrasting roles for all-trans retinoic acid in TGF-{beta}-mediated induction of Foxp3 and Il10 genes in developing regulatory T cells
J. Exp. Med., February 16, 2009; 206(2): 343 - 357.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. D. Sloan and K. R. Jerome
Herpes Simplex Virus Remodels T-Cell Receptor Signaling, Resulting in p38-Dependent Selective Synthesis of Interleukin-10
J. Virol., November 15, 2007; 81(22): 12504 - 12514.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Csoka, Z. H. Nemeth, L. Virag, P. Gergely, S. J. Leibovich, P. Pacher, C.-X. Sun, M. R. Blackburn, E. S. Vizi, E. A. Deitch, et al.
A2A adenosine receptors and C/EBP{beta} are crucially required for IL-10 production by macrophages exposed to Escherichia coli
Blood, October 1, 2007; 110(7): 2685 - 2695.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
O. Norkina, A. Dolganiuc, T. Shapiro, K. Kodys, P. Mandrekar, and G. Szabo
Acute alcohol activates STAT3, AP-1, and Sp-1 transcription factors via the family of Src kinases to promote IL-10 production in human monocytes
J. Leukoc. Biol., September 1, 2007; 82(3): 752 - 762.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Dong, C. Ivascu, H.-D. Chang, P. Wu, R. Angeli, L. Maggi, F. Eckhardt, L. Tykocinski, C. Haefliger, B. Mowes, et al.
IL-10 Is Excluded from the Functional Cytokine Memory of Human CD4+ Memory T Lymphocytes
J. Immunol., August 15, 2007; 179(4): 2389 - 2396.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Tone, Y. Kojima, K. Furuuchi, M. Brady, Y. Yashiro-Ohtani, M. L. Tykocinski, and M. Tone
OX40 Gene Expression Is Up-Regulated by Chromatin Remodeling in Its Promoter Region Containing Sp1/Sp3, YY1, and NF-{kappa}B Binding Sites
J. Immunol., August 1, 2007; 179(3): 1760 - 1767.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. J. Staples, T. Smallie, L. M. Williams, A. Foey, B. Burke, B. M. J. Foxwell, and L. Ziegler-Heitbrock
IL-10 Induces IL-10 in Primary Human Monocyte-Derived Macrophages via the Transcription Factor Stat3
J. Immunol., April 15, 2007; 178(8): 4779 - 4785.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
X. Zhang, P. Hei, L. Deng, and J. Lin
Interleukin-10 gene promoter polymorphisms and their protein production in peritoneal fluid in patients with endometriosis
Mol. Hum. Reprod., February 1, 2007; 13(2): 135 - 140.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. N. Kremer, A. Kumar, and K. E. Hedin
Haplotype-Independent Costimulation of IL-10 Secretion by SDF-1/CXCL12 Proceeds via AP-1 Binding to the Human IL-10 Promoter
J. Immunol., February 1, 2007; 178(3): 1581 - 1588.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. P. Calado, T. Paixao, D. Holmberg, and M. Haury
Stochastic Monoallelic Expression of IL-10 in T Cells
J. Immunol., October 15, 2006; 177(8): 5358 - 5364.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Cao, X. Zhang, J. P. Edwards, and D. M. Mosser
NF-{kappa}B1 (p50) Homodimers Differentially Regulate Pro- and Anti-inflammatory Cytokines in Macrophages
J. Biol. Chem., September 8, 2006; 281(36): 26041 - 26050.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Beisner, M. B. Buck, P. Fritz, J. Dippon, M. Schwab, H. Brauch, G. Zugmaier, K. Pfizenmaier, and C. Knabbe
A Novel Functional Polymorphism in the Transforming Growth Factor-{beta}2 Gene Promoter and Tumor Progression in Breast Cancer.
Cancer Res., August 1, 2006; 66(15): 7554 - 7561.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Shoemaker, M. Saraiva, and A. O'Garra
GATA-3 Directly Remodels the IL-10 Locus Independently of IL-4 in CD4+ T Cells
J. Immunol., March 15, 2006; 176(6): 3470 - 3479.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Z. H. Nemeth, C. S. Lutz, B. Csoka, E. A. Deitch, S. J. Leibovich, W. C. Gause, M. Tone, P. Pacher, E. S. Vizi, and G. Hasko
Adenosine Augments IL-10 Production by Macrophages through an A2B Receptor-Mediated Posttranscriptional Mechanism
J. Immunol., December 15, 2005; 175(12): 8260 - 8270.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
A Suarez, P Lopez, L Mozo, and C Gutierrez
Differential effect of IL10 and TNF{alpha} genotypes on determining susceptibility to discoid and systemic lupus erythematosus
Ann Rheum Dis, November 1, 2005; 64(11): 1605 - 1610.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Yamaoka, B. Min, Y.-J. Zhou, W. E. Paul, and J. J. O'Shea
Jak3 negatively regulates dendritic-cell cytokine production and survival
Blood, November 1, 2005; 106(9): 3227 - 3233.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Riemann, R. Endres, S. Liptay, K. Pfeffer, and R. M. Schmid
The I{kappa}B Protein Bcl-3 Negatively Regulates Transcription of the IL-10 Gene in Macrophages
J. Immunol., September 15, 2005; 175(6): 3560 - 3568.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
V. Goffin, D. Demonte, C. Vanhulle, S. de Walque, Y. de Launoit, A. Burny, Y. Collette, and C. Van Lint
Transcription factor binding sites in the pol gene intragenic regulatory region of HIV-1 are important for virus infectivity
Nucleic Acids Res., August 1, 2005; 33(13): 4285 - 4310.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Saraiva{paragraph}, J. R. Christensen, A. V. Tsytsykova, A. E. Goldfeld, S. C. Ley, D. Kioussis, and A. O'Garra
Identification of a Macrophage-Specific Chromatin Signature in the IL-10 Locus
J. Immunol., July 15, 2005; 175(2): 1041 - 1046.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. Wilmanski, M. Siddiqi, E. A. Deitch, and Z. Spolarics
Augmented IL-10 production and redox-dependent signaling pathways in glucose-6-phosphate dehydrogenase-deficient mouse peritoneal macrophages
J. Leukoc. Biol., July 1, 2005; 78(1): 85 - 94.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
Y. Yao, W. Li, M. H. Kaplan, and C.-H. Chang
Interleukin (IL)-4 inhibits IL-10 to promote IL-12 production by dendritic cells
J. Exp. Med., June 20, 2005; 201(12): 1899 - 1903.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Cao, J. Liu, L. Song, and X. Ma
The Protooncogene c-Maf Is an Essential Transcription Factor for IL-10 Gene Expression in Macrophages
J. Immunol., March 15, 2005; 174(6): 3484 - 3492.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
R. Grenningloh, B. Y. Kang, and I-C. Ho
Ets-1, a functional cofactor of T-bet, is essential for Th1 inflammatory responses
J. Exp. Med., February 22, 2005; 201(4): 615 - 626.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Z.-Y. Wang, H. Sato, S. Kusam, S. Sehra, L. M. Toney, and A. L. Dent
Regulation of IL-10 Gene Expression in Th2 Cells by Jun Proteins
J. Immunol., February 15, 2005; 174(4): 2098 - 2105.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. S. K. Yee, Y. Yao, Q. Xu, B. McCarthy, D. Sun-Lin, M. Tone, H. Waldmann, and C.-H. Chang
Enhanced Production of IL-10 by Dendritic Cells Deficient in CIITA
J. Immunol., February 1, 2005; 174(3): 1222 - 1229.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
C. Atayar, S. Poppema, T. Blokzijl, G. Harms, M. Boot, and A. van den Berg
Expression of the T-Cell Transcription Factors, GATA-3 and T-bet, in the Neoplastic Cells of Hodgkin Lymphomas
Am. J. Pathol., January 1, 2005; 166(1): 127 - 134.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. Kane, L. Cervi, J. Sun, A. S. McKee, K. S. Masek, S. Shapira, C. A. Hunter, and E. J. Pearce
Helminth Antigens Modulate TLR-Initiated Dendritic Cell Activation
J. Immunol., December 15, 2004; 173(12): 7454 - 7461.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wessells, M. Baer, H. A. Young, E. Claudio, K. Brown, U. Siebenlist, and P. F. Johnson
BCL-3 and NF-{kappa}B p50 Attenuate Lipopolysaccharide-induced Inflammatory Responses in Macrophages
J. Biol. Chem., November 26, 2004; 279(48): 49995 - 50003.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. W. Steinke, E. Barekzi, J. Hagman, and L. Borish
Functional Analysis of -571 IL-10 Promoter Polymorphism Reveals a Repressor Element Controlled by Sp1
J. Immunol., September 1, 2004; 173(5): 3215 - 3222.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. L. W. Chang, N. Baumgarth, D. Yu, and P. A. Barry
Human Cytomegalovirus-Encoded Interleukin-10 Homolog Inhibits Maturation of Dendritic Cells and Alters Their Functionality
J. Virol., August 15, 2004; 78(16): 8720 - 8731.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Rothwell, J. R. Young, R. Zoorob, C. A. Whittaker, P. Hesketh, A. Archer, A. L. Smith, and P. Kaiser
Cloning and Characterization of Chicken IL-10 and Its Role in the Immune Response to Eimeria maxima
J. Immunol., August 15, 2004; 173(4): 2675 - 2682.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. Y. Lee, H. L. Elmer, K. R. Ross, and T. J. Kelley
Isoprenoid-Mediated Control of SMAD3 Expression in a Cultured Model of Cystic Fibrosis Epithelial Cells
Am. J. Respir. Cell Mol. Biol., August 1, 2004; 31(2): 234 - 240.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S.-Y. Pai, M. L. Truitt, and I-C. Ho
GATA-3 deficiency abrogates the development and maintenance of T helper type 2 cells
PNAS, February 17, 2004; 101(7): 1993 - 1998.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Tone, Y. Tone, E. Adams, S. F. Yates, M. R. Frewin, S. P. Cobbold, and H. Waldmann
From The Cover: Mouse glucocorticoid-induced tumor necrosis factor receptor ligand is costimulatory for T cells
PNAS, December 9, 2003; 100(25): 15059 - 15064.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y.-W. Liu, H.-P. Tseng, L.-C. Chen, B.-K. Chen, and W.-C. Chang
Functional Cooperation of Simian Virus 40 Promoter Factor 1 and CCAAT/Enhancer-Binding Protein {beta} and {delta} in Lipopolysaccharide-Induced Gene Activation of IL-10 in Mouse Macrophages
J. Immunol., July 15, 2003; 171(2): 821 - 828.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. Adib-Conquy, P. Moine, K. Asehnoune, A. Edouard, T. Espevik, K. Miyake, C. Werts, and J.-M. Cavaillon
Toll-like Receptor-mediated Tumor Necrosis Factor and Interleukin-10 Production Differ during Systemic Inflammation
Am. J. Respir. Crit. Care Med., July 15, 2003; 168(2): 158 - 164.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Johannessen, P. A. Olsen, R. Sorensen, B. Johansen, O. M. Seternes, and U. Moens
A role of the TATA box and the general co-activator hTAFII130/135 in promoter-specific trans-activation by simian virus 40 small t antigen
J. Gen. Virol., July 1, 2003; 84(7): 1887 - 1897.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Ziegler-Heitbrock, M. Lotzerich, A. Schaefer, T. Werner, M. Frankenberger, and E. Benkhart
IFN-{alpha} Induces the Human IL-10 Gene by Recruiting Both IFN Regulatory Factor 1 and Stat3
J. Immunol., July 1, 2003; 171(1): 285 - 290.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Mahalingam and B. A. Lidbury
Suppression of lipopolysaccharide-induced antiviral transcription factor (STAT-1 and NF-kappa B) complexes by antibody-dependent enhancement of macrophage infection by Ross River virus
PNAS, October 15, 2002; 99(21): 13819 - 13824.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. K. Rao, S. Maiti, H. N. Ananthaswamy, and M. F. Wilkinson
A Highly Active Homeobox Gene Promoter Regulated by Ets and Sp1 Family Members in Normal Granulosa Cells and Diverse Tumor Cell Types
J. Biol. Chem., July 12, 2002; 277(29): 26036 - 26045.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. J. O'Sullivan and R. Thomas
CD40 Ligation Conditions Dendritic Cell Antigen-Presenting Function Through Sustained Activation of NF-{kappa}B
J. Immunol., June 1, 2002; 168(11): 5491 - 5498.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Tone, Y. Tone, J. M. Babik, C.-Y. Lin, and H. Waldmann
The Role of Sp1 and NF-kappa B in Regulating CD40 Gene Expression
J. Biol. Chem., March 8, 2002; 277(11): 8890 - 8897.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Tavor, P. T. Vuong, D. J. Park, A. F. Gombart, A. H. Cohen, and H. P. Koeffler
Macrophage functional maturation and cytokine production are impaired in C/EBPepsilon -deficient mice
Blood, March 1, 2002; 99(5): 1794 - 1801.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. J. Powell, S. A. J. Thompson, Y. Tone, H. Waldmann, and M. Tone
Posttranscriptional Regulation of IL-10 Gene Expression Through Sequences in the 3'-Untranslated Region
J. Immunol., July 1, 2000; 165(1): 292 - 296.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tone, M.
Right arrow Articles by Waldmann, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tone, M.
Right arrow Articles by Waldmann, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS