|
|
||||||||
,
,§
,
,§
*
Laboratory of Cellular and Molecular Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892;
National Creative Research Initiative Center for Genetic Reprograming,
Institute for Molecular Biology and Genetics, and
§
Department of Molecular Biology, Seoul National University, Seoul, Korea; and
¶
Department of Oral Pathology, College of Dentistry, Kangreung National University, Kangneung, Korea
| Abstract |
|---|
|
|
|---|
2 chain
of laminin 5, an epithelial cell-specific extracellular matrix protein,
was identified in a PCR-based subtracted cDNA library from mouse thymic
stromal cells. The mRNA existed in two alternative forms (5.1 and 2.4
kb). The full-length message was highly expressed in SCID thymus and in
a nurse cell line, but not in other thymic epithelial cell lines, while
the short form was more widely expressed. In situ
hybridization and immunohistochemical staining revealed laminin 5
expression mostly in the subcapsular region of the adult thymus.
Addition to fetal thymic organ cultures of a cell adhesion-blocking mAb
to the
3 chain of laminin 5 interrupted T cell
development. There was a 40% reduction in the total yield of
thymocytes, and the most profound decrease (7590%) was seen in the
CD25+CD44+ and
CD25+CD44-subsets of the
CD4-CD8- double negative fraction. Most of
the surviving double negative thymocytes expressed Sca-1, and there
were significant increases in the number of cells with CD69 expression
and in the fraction of annexin V-stained cells. None of these changes
were observed with a nonblocking anti-laminin
3
chain mAb. These results suggest that the interaction between double
negative thymoctyes and laminin 5 made by subcapsular epithelial cells
is required for the survival and differentiation of mouse
thymocytes. | Introduction |
|---|
|
|
|---|
Accumulating evidence suggests that the laminin family of ECM proteins
plays a key role in the local interactions between some thymocytes and
stromal cells. These proteins are secreted by endothelial and
epithelial cells, and they are found associated with basement membranes
and hemidesmosomes (6, 7). In the thymus, certain isotypes
of laminin have been localized to the subepithelial basement membrane
of the capsule (8, 9) and to the medulla
(10). These molecules are not found in the cortex, except
in the basal laminae of large blood vessels (8, 9, 11).
Laminins are recognized by integrin receptors, which are found on both
T cells and epithelial cells (8, 11, 12, 13, 14, 15, 16). Interestingly,
only a subset of immature (heat stable Aghigh) thymocytes
binds to laminin in vitro (15, 17), and this subset also
uniquely expresses the
6ß4 integrin receptor
(12). The binding in vitro is inhibited by Ab to both
3 and
6 integrins
(15, 17). DP thymocytes do not bind to laminin in vitro,
although they still express some
6-containing
integrins (12). Furthermore, cortical epithelial cells do
not express
3 and
6
integrins (11). These observations suggest that laminin
plays an important role in early thymocyte development, but possibly
not during later events such as positive selection. To date, however,
there have been no functional studies to test this hypothesis.
We previously created a PCR-based subtractive cDNA library from
isolated fetal thymic stromal cells to generate new molecular reagents
to study mouse thymic stromal cells (18). One of the gene
fragments we isolated, thymic stromal origin (TSO)-2D1, was chosen for
further study based on its selective expression in a thymic epithelial
cell line with the phenotype of a nurse cell. The sequence of TSO-2D1
showed strong homology to the human LamC2 gene of laminin 5,
formerly called B2t, (19), and near identity to the mouse
LamC2 (20), which encodes the
2 chain of
mouse laminin 5. Laminin 5 is a well-known epithelial cell-specific
protein, previously called by several different names: epiligrin,
kalinin, ladsin, and nicein, (6, 21, 22). It is comprised
of three polypeptide chains,
3,
ß3, and
2, which are
the products of different genes. The ß3 and
2 chains are unique components of laminin 5,
while the
3 chain is known to be used in two
other laminin isotypes (6 and 7) (6). The
2 chain is a homologue of the
1 chain (formerly called B2) from which the
N-terminal domain is missing and domains III, IV, and V are shortened
(20). In the skin, laminin 5 forms the anchoring filaments
that link epithelial cells to the basement membrane by bridging the
6ß4 or
3ß1 integrin receptors
on the cells to other forms of laminin (1, 6, 7) in the lamina
densa layer of the membrane (7). Mutations in the human
genes encoding each of the chains of laminin 5 can result in the
junctional form of epidermolysis bullosa, a recessively inherited
blistering skin disorder in which the epidermal layer separates from
the dermal layer (23, 24). Interestingly, laminin 5
behaves as a multifunctional protein in that it can act under certain
circumstances as a motility signal and at other times as an adhesive
component (2, 3, 25). Thus, its expression in epithelial
cells in the thymus raised the possibility that this protein
might play some specific role in T cell development.
In this report, we localize the expression of the LamC2 gene to the subcapsular region of the adult mouse thymus and show that a cell-adhesion blocking anti-laminin 5 mAb interferes with the development of T cells in fetal thymic organ culture (FTOC). The CD25+CD44+ and CD25+CD44- DN thymocytes were severely reduced in number, and this reduction was associated with increased expression of stem cell Ag I (Sca-I) and CD69 as well as increased binding to annnexin V on the remaining DN cells. These observations suggest that the thymocytes are dying early in their development and that interaction with laminin 5 is critical for their survival and differentiation.
| Materials and Methods |
|---|
|
|
|---|
Fetal thymii of 14.5 days gestation were obtained from timed matings of C57BL/6 (B6) mice (National Cancer Institute, Frederick, MD). The day of appearance of the vaginal plug was counted as day 0. C.B-17 mice bearing the SCID mutation were bred in our animal facility (National Institute of Allergy and Infectious Disease, Frederick, MD). SV40-transformed thymic epithelial cell lines from transgenic animals expressing the SV40 T Ag were the kind gift of Dr. Barbara Knowles (The Jackson Laboratory, Bar Harbor, ME). The five cell lines used were classified as follows: thymic subcapsular/nurse cell (427.1.86), cortico-reticular epithelial cell (1308.1.86), medullary dendritic cell (6.1.1), medullary epithelial cell (1307.6.1.7), and an unidentified medullary cell type (1307.1.11) (26). The characteristics of line 427.1.86 used to call it a nurse cell were the presence of tonofilaments, intermediate filaments, and desmosomal-like structures in electron micrographs, as well as low MHC class I expression and staining with a panel of thymic epithelial cell mAb, such as 3OH.12 and A2B5, specific for subcapsular cells. The fibroblast cell line, NIH 3T3, and the thymic lymphoma line, EL-4, were obtained from the American Type Culture Collection (Manassas, VA). Thymic stromal cells were prepared by trypsinizing the thymic rudiment of 2-deoxyguanosine-treated FTOC (27, 28) and plating the cells into petri dishes.
Antibodies
The 2.4.G2 mAb (29) was either prepared by growing
the hybridoma obtained from the American Type Culture Collection in a
Bioreactor, Cell-Pharm 100 (Unisyn Technologies, Hopkinton, MA) and
collecting the culture supernatant or prepared from ascites fluid after
injecting an aliquot of the hybridoma cells into BALB/c
nu/nu mice. Anti-human laminin 5 mouse mAb, blocking
(P3H9-2, IgG1) and nonblocking (P3E4, IgG1), were obtained from
Chemicon International (Temecular, CA). These monoclonals were
generated by immunizing mice with cultured human keratinocytes and
selecting for Ab reactive against affinity-purified laminin 5
(epiligrin) (21). They did not react with human
fibronectin, placental laminin, or collagen types I and III. Both Ab
were shown to react with the
3 chain of
laminin 5 by Western blotting (30), but only P3H9-2
blocked the adhesion of the HUT 78 T cell line to purified laminin 5
and to ECM formed by human foreskin keratinocytes
(21).
Isolation of the cDNA
A SCID thymus cDNA library (31) was constructed in a LambdaZapII vector (Stratagene, San Diego, CA) using mRNA isolated (mRNA purification Kit; Pharmacia, Washington, DC) from thymii of 4- to 6-wk-old C.B-17 SCID animals. The cDNA library was screened using a [32P]dATP-labeled 1.0-kb fragment isolated from the PCR-based subtractive library described previously (31).
In situ hybridization
Newborn and 4- to 6-wk-old thymus specimens from C57BL/6 mice were fixed in 4% paraformaldehyde solution and embedded in paraffin, and 5-µm sections were prepared (American Histolab, Gaithersburg, MD). After deparaffinization, the sections were treated with proteinase K (10 µg/ml) for 15 min at room temperature, and endogenous alkaline phosphatases were inactivated using 0.2 N HCl (32). For generation of the probes, LamC2-specific primers containing T3 and T7 initiation sequences were designed by examining a matrix comparison of the LamC1 and LamC2 nucleotide sequences to look for nonidentical regions. The forward primer, lmC2F1T3, extends from nucleotide 637 to nucleotide 660 and includes the T3 site: GCAATTAACCCTCACTAAAGGGCCGACTTCAGTGTCCACAAAATC. The backward primer, lmC2B5T7, extends from nucleotide 1217 to nucleotide 1194 and includes the T7 site: GTAATACGACTCACTATAGGGCAATTGTCCCTTGTACCCCAGCAGG. These primers only generate probes that have no homology to any other genes as determined by basic local alignment search tool (BLAST) search (33) and detect only the larger message of the LamC2 gene. RNA probes were generated using an in vitro transcription system (Boehringer Mannheim, Indianapolis, IN). T3 RNA polymerase was used to generate the sense probe and T7 RNA polymerase was used to generate the anti-sense probe. Hybridizations with the probes were performed using 50% formamide, 10 mM Tris-HCl, pH 7.6, 200 µg/ml tRNA, 1x Denhardts solution, 10% dextran sulfate, 600 mM NaCl, 0.25% SDS, and 1 mM EDTA at 50°C for 16 h in a humidified chamber. Slides were washed with 2x SSC containing 50% formamide at 55°C for 30 min and then rinsed at 37°C for 10 min in TNE (10 mM Tris-HCl, pH 8.0, 500 mM NaCl, 1 mM EDTA). Nonhybridized transcripts were digested with 20 µg/ml RNase A (Sigma, St. Louis, MO) in TNE at 37°C for 30 min. The slides were washed in TNE at 37°C for 10 min, then once with 2x SSC at 50°C for 20 min, and twice with 0.2x SSC at 50°C for 20 min.
Detection of in situ hybridization was conducted using the Genius Detection system (Boehringer Mannheim). Specifically, transcripts were detected with an anti-digoxigenin mAb conjugated to alkaline phosphatase in solution 1 (0.1 M Maleic acid and 0.15 M NaCl). The slides were washed several times with solution 3 (100 mM Tris-HCl, pH 9.5, 100 mM NaCl, 50 mM MgCl2) and then immersed in the color-development solution (0.3 mg/ml nitroblue tetrazolium and 0.15 mg/ml of 5-bromo-4-chloro-3-indolyl phosphate in 0.1 M NaHCO3) (Boehringer Mannheim). Color development was stopped by immersing the slides in solution 4 (10 mM Tris-HCl buffer, pH 8.0, 1 mM EDTA).
Immunohistochemical and immunocytochemical staining
Tissue sections of thymii from newborn mice and 4-wk-old mice (C57BL/6) were deparaffinized and hydrated. Endogenous peroxidases were then inactivated using 3% hydrogen peroxide for 10 min (34). The sections were blocked using normal goat serum, and three-layer immunolabeling was performed. The sections were incubated for 1 h with the primary Ab: two anti-human laminin 5 mAb, the P3H9-2 blocking mAb, or the P3E4 nonblocking mAb, followed by incubation with a biotinylated secondary anti-mouse IgG Ab and then streptavidin-peroxidase labeling. The immunolocalization was visualized by diaminobenzidine (HistoMark; Kirkegaard & Perry Laboratories, Gaithersburg, MD). For the negative control, the sections were not incubated with the primary Ab.
The 427.1.86 cell line was grown in a four-well chamber slide for 1 day (Nalge Nunc International, Naperville, IL), washed with PBS, and fixed with 3.7% paraformaldehyde in PBS for 2 h. The wells were then rinsed four times with PBS and incubated in a blocking solution (10% goat serum in PBS) for 20 min. Primary Ab diluted with the blocking solution was then added overnight at 4°C. After washing the cells three times, FITC-conjugated anti-mouse rat IgG1 (R2-40; PharMingen, San Diego, CA), diluted in the blocking solution, was added for 20 min at room temperature. The glass slides were then washed with PBS and mounted in 70% glycerol containing 1% p-phenylene diamine (Katayama Chemical, Osaka, Japan) in PBS. The slides were analyzed using a fluorescence microscope (Axioplan 2; Zeiss, Jena, Germany) using filter set 10. Microscopic images were taken using the ZVS-47DE CCD camera (Optronics Engineering, Goleta, CA) and processed with Adobe Photoshop 4.0.1 software (Adobe Systems, Mountain View, CA).
Northern blotting
Total RNAs from different cell lines and tissues of mice were prepared by using the Triozol reagent (Molecular Research Center, Cincinnati, OH) after homogenizing the samples with a hand-held polytron (Omni International, Waterbury, CT). Poly(A)+ RNA was prepared using oligo(dT) columns (Quik polyA; Pharmacia). Ten micrograms of total or 2 µg of poly(A)+ RNA from each sample was separated on an 1% agarose gel containing 0.7% formaldehyde and transferred onto a nylon membrane (Nytran maximum strength; Schleicher and Schuell, Keene, NH). The membrane was hybridized with a 32P-labeled probe in a hybridization solution (QuikHyb; Stratagene) for 2 h. The membrane was washed twice with 2x SSC-0.1% SDS and once with 0.1x SSC-0.1% SDS at 65°C for about 20 min each and then analyzed on a phosphorimager (Molecular Dynamics, Sunnyvale, CA).
RT-PCR
Ten micrograms of total RNA prepared from tissues or 500 CD45+ thymocytes (99% purity) (31) were reverse transcribed using Moloney murine leukemia virus (MMTV) reverse transcriptase (Stratagene) in a total volume of 50 µl. One microliter of each generated cDNA was then amplified for 40 cycles with ExTag (Takara Shuzo, Shiga, Japan). The gene-specific primers for MML5A3B (X84014) are nucleotides 70087030, TCAGCCCCAGAGAACAGGTTTAC, and nucleotides 74387417, CGAGTGCCATTGTCCATCACAC; the primers for LamB3 (MMU43298) are nucleotides 29652988, AGGCTCCCTAATGTGGACTCAGTG, and nucleotides 34693449, TGATGCTCAGGATTCGATTGC. The sequences of primers used for the GAPDH controls are GGTGAAGGTCGGTGTGAACGGA for the 5' primer and TGTTAGTGGGGTCTCGCTCCTG for the 3' primer. The PCR product of the LamA3 reaction was used as a probe for the Northern blotting.
Western blotting
SCID thymii and C57BL/6 kidneys were snap-frozen, ground under liquid nitrogen, and suspended in the lysis buffer (1% Triton X-100, 25 mM Tris-HCl, pH7.5, 250 mM NaCl) at 4°C for 1 h. Then the samples were centrifuged at 13,000 rpm at 4°C for 20 min, washed with the lysis buffer for 10 min, and centrifuged again. The pellet was resuspended in 10 mM EDTA, 50 mM Tris-HCl, pH 7.5, and the ECM proteins extracted by rotating overnight at 4°C. After centrifugation at 10,000 rpm for 20 min, the supernatant was saved. Protein concentrations were estimated by the bicinchoninic acid method (Pierce, Rockford, IL). Then, 50 µg of each protein sample were electrophoresed on a 6% polyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was blocked with 5% nonfat dried milk (v/v) in TBS-0.1% Tween 20 (v/v) (TBS-T) at room temperature for 2 h. The P3H9-2 and P3E4 mAbs were then added in 1% nonfat dried milk in TBS-T for 3 h. The membrane was washed with TBS-T three times for 10 min each. HRP-conjugated anti-mouse Ab (Amersham, Arlington Heights, IL) was then added at a 1/3,000 dilution for 2 h. After washing three times with TBS-T, the blot was developed using the enhanced chemiluminescent method (Amersham).
FTOC
Thymic lobes were collected at fetal day 14.5 and placed in
transwell plates (0.4-µm pore size; Costar, Cambridge, MA) in IMDM
containing 10% FBS with or without purified anti-laminin 5 Ab
preparations that did not contain any sodium azide. Any lobes of
obviously smaller size were assumed to be behind in their development
and excluded. The medium was changed every other day with fresh medium
containing the Ab, or every day with half of the medium and the Ab, for
a total of 58 days. The thymocytes from the culture were recovered by
scraping the tissue through nylon mesh. The recovered cells were
stained with either anti-CD24 (Ml/69) FITC, anti-CD44 (IM7) PE,
anti-CD69 (H1.2F3) FITC, anti-Sca-I (D7) biotin, and/or
anti-CD25 (7D4) biotin plus a streptavidin-allophycocyanin
conjugate (PharMingen), as well as anti-CD4 (H129.19) Red 613 and
anti-CD8 (53-6.7) Red 613 conjugates (Life Technology,
Gaithersburg, MD). Alternatively the cells were stained with
anti-CD4 (H129.19) Red 613, anti-CD8 (53-6.7) PE,
anti-TCR
(GL3) FITC, and anti-TCR
ß (H57.597)
biotin/streptavidin-allophycocyanin (PharMingen). The propidium iodide
(PI)-negative gated cells were analyzed on a FACScalibur using two
lasers and the CellQuest program (Becton Dickinson, San Jose, CA). For
three-color staining with annexin V, the thymocytes were recovered from
FTOC after 2 days of culture and stained with three different
combinations of mAb. The first used PE-conjugated anti-CD25 mAb
with biotinylated anti-CD44 mAb plus streptavidine-conjugated
Quantum Red (Sigma). The second reversed this and used PE-conjugated
anti-CD44 and biotinylated anti-CD25. The third involved
PE-conjugated anti-CD4 mAb and biotinylated anti-CD8 mAb. For
all three combinations, 1 µl of FITC-conjugated annexin V
(PharMingen) was added in 200 µl of buffer and incubated for 510
min at room temperature. Finally, PI (20 µg/ml final concentration)
was added just before flow cytometry analysis on a FACStar using a
single laser (Becton Dickinson). All analyses were done on PI-negative
cell populations except as indicated in Fig. 7
.
|
Paired or unpaired Students t tests were performed on the numbers or a log transformation of the numbers in the various sets of data. The results are presented as the arithmetic mean ± SEM. Statistical calculations and graphical analyses were conducted using JMP software, version 3.2 (SAS, Cary, NC) or PRISM, version for Macintosh computers (GraphPad Software, San Diego, CA).
| Results |
|---|
|
|
|---|
In the initial screening of a PCR-based, subtractive thymic
stromal cell cDNA library by Northern blot analysis (18),
expression of mRNA corresponding to clone TSO-2D1 was detected only in
a thymic epithelial cell line of the nurse cell type and not in other
cell lines (line 427.1.86 in Fig. 1
A). This cell line has been
shown to function in positive and negative selection of T cells when
injected intrathymically (35, 36, 37). Weak expression of
message was also detected in normal thymus, and a strong signal was
observed with RNA from SCID thymus. Expression of the message was also
detected in the kidney, but not in muscle or liver (data not
shown).
|
2 chain of laminin 5, which is known as an
epithelial cell-specific ECM protein (19, 20). Northern
blotting done with three separate nonoverlapping fragments of the
5.1-kb clone revealed two different forms of the message. Using the 5'
and central probes, EB and BB, only the thymic nurse cell line and the
SCID thymus showed a 5.1-kb mRNA (Fig. 1
We also tested the expression of the other components of laminin 5 in
the thymic epithelial cell lines and thymic tissues. As shown in Fig. 1
D, the thymic nurse cell line 427.1.86 showed clear
expression of both the 5.5-kb LamA3A and 8-kb LamA3B messages
(38), while other thymic epithelial and fibroblast cell
lines did not. SCID thymus appears to express only the 5.5-kb message.
LamA3 and LamB3 expression was also tested by RT-PCR (Fig. 1
E). As expected, all the thymic tissue preparations,
including thymocyte-depleted thymic rudiment (deGuo Thymus in Fig. 1
E), express LamA3 and LamB3 genes, while FACS-separated
thymocytes (99% purity) and liver did not show any significant level
of expression. The reason for more than a single band in the LamB3
RT-PCR needs to be investigated further.
Laminin 5 expression is confined to the subcapsular region of the thymus
To localize the expression of the LamC2 gene in the
thymus, in situ hybridization was performed on
paraformaldehyde-fixed sections of thymus from 4- to 6-wk-old mice. A
unique digoxigenin-tagged antisense probe from the middle of the cDNA
was designed such that it would not cross-hybridize with
LamC1 mRNA and would only detect the long form of the
message. This probe hybridized predominantly to the subcapsular region
of the thymus sections (Fig. 2
,
A and C). The control sense probe showed little
or no signal in this region (Fig. 2
, B and D).
Newborn thymus showed staining of both the subcapsular region and the
outer cortex (Fig. 2
, F and H). In higher
magnification (Fig. 2
E), it is clear that the message is
expressed not only in the area of the basement membrane, but also
extends into the subcapsular region. Overall, these results demonstrate
that the long form of the mRNA encoding the full
2 chain of laminin 5 is selectively expressed
in the region of the thymus where DN thymocytes develop.
|
3 chain (21, 30)
were tested to determine whether they would react with the mouse
protein. Initially, these Ab, P3E4 and P3H9-2, were used in a flow
cytometric analysis to stain the thymic nurse cell line 427.1.86.
Nonenzymatically detached 427.1.86 cells were uniformly stained at
similar levels of intensity with both of these mAb (data not shown).
Next, Western blotting was employed to examine their specificity for
mouse laminin 5 protein (Fig. 3
135145 kDa with both P3E4 and P3H9-2 mAb. This is around the
molecular size of the processed form of the
3
chain of human laminin 5 (39). Interestingly, in the
kidney the two mAb detected different sized smaller fragments of the
3 protein, indicating that they recognize
different epitopes on the same molecule. Neither of these mAb reacted
with purified mouse laminin 1 protein (Fig. 3
|
3 chain of laminin 5 and therefore they could
be used in our functional inhibition studies. The different staining
patterns observed might be relevant to their functional differences in
blocking cell adhesion (21) as well as their different
effects in thymic organ culture described below.
|
To determine whether anti-laminin 5 Ab had any effect on
thymic development, different concentrations of the two purified mAb
were added into the culture medium of FTOC starting at fetal day 14.5,
and the remaining thymocytes were analyzed 5 days later. As shown in
Fig. 5
, the nonblocking, diffusely
staining mAb P3E4 did not produce any effect on the total cell recovery
up to a concentration of 10 µg/ml. In contrast, the blocking,
cluster-staining mAb P3H9-2 gave a dose-dependent reduction in the cell
recovery. The maximum decrease was 50%, and this was achieved at a
concentration of 5 µg/ml. In 12 experiments in which the yields were
compared after 58 days between cultures treated with 10 µg/ml of
P3H9-2 and either 10 µg/ml of P3E4 or no Ab, the average yield in the
presence of the blocking Ab was 60 ± 4% of the control. The
total thymocyte recovery for the control groups was 8.5 ± 0.36
(x105) cells and for the P3H9-2-treated group
was 5.0 ± 0.55 (x105) cells. These two
means were significantly different (p <
0.0001) in an unpaired Students t test.
|
Cells bearing the TCR-
ß constitute the vast majority of
TCR+ cells in the thymus and so perhaps not
surprisingly their yield was also decreased. For five experiments, the
average yield was 54 ± 7% in the presence of the blocking mAb.
We also examined the yield of 
TCR+ cells,
which are a much smaller fraction (5%) of the total thymocytes. They
too showed a consistent pattern of inhibition in the presence of the
blocking mAb. In five experiments, the average yield was 66 ±
6%. Thus, the development of both major T cell lineages is
affected.
The P3H9-2 anti-laminin 5 mAb blocks
ß T cell lineage
development predominantly at the CD4-CD8- DN
stage
We next examined which subsets of CD4- and CD8-bearing cells were
most affected by the treatment. As shown in Fig. 6
A, the greatest reduction in
yield in cultures treated with the P3H9-2 blocking mAb occurred in the
CD4-CD8- DN thymocytes.
In this experiment, the yield was 25% of that from the untreated
control cultures: [(460,000 total thymocytes x 5.4% DN cells
for the P3H9-2 Ab) ÷ (820,000 total x 12.3% DN for no
Ab)] x 100. For four experiments, the average yield was 34 ±
7.5%. The values for the DP, CD4 SP, and CD8 SP cells were 61 ±
11%, 40 ± 3%, and 50 ± 5%, respectively. To determine
which subpopulations among the DN thymocytes were being affected, we
further analyzed this subset (DN gated) with Ab to CD44 and CD25 (Fig. 6
, BD). The most profoundly affected subpopulations were
the CD25+CD44+
(subpopulation C) and
CD25+CD44- (subpopulation
D) thymocytes (see the subset labeling scheme and ratios on the right
side of Fig. 6
). Compared with either untreated cultures or cultures
treated with the nonblocking P3E4 mAb, the yields of these two
subpopulations were only 818%. A quantitative analysis of six
experiments is shown in Fig. 6
, C and D. The
average yield of subpopulation C was 25 ± 7%, while the yield of
subpopulation D was 16 ± 4%. (Fig. 6
D). These
decreases are statistically significant (p <
0.001) using a paired t test done on a log transformation of
the data. In contrast, the earliest subpopulation,
CD25-CD44+ (subpopulation
A), was unaffected (95 ± 19%). Interestingly, the transitional
CD25loCD44+ subpopulation B
was significantly (p < 0.002) decreased to
52 ± 7%, suggesting that the loss begins at this stage. The
remaining DN subpopulation, the
CD44-CD25-cells, was also
only partially affected; the average yield was 46 ± 6%. Finally,
the same depletion was observed in the presence of the 2.4.G2 mAb at
concentrations that blocked low-affinity Fc receptor binding to our DN
fetal thymocyte preparations (data not shown).
|
/TCRß receptor (ß selection) and then move into the DP
subpopulation. The phenotype of the DN thymocytes affected by the anti-laminin 5 Ab suggests that the cells are dying as they start to differentiate
In the blocking mAb-treated cultures, the percentage of DN
thymocytes expressing Sca-I was greatly increased after 8 days in
culture (Fig. 7
A). Normally,
about 23% of the DN cells are Sca-Ihigh. In
addition, 23% express intermediate levels of Sca-I, and a significant
fraction (54%) are Sca-I-low or -negative cells. In contrast, the DN
population recovered from the mAb-treated cultures was mostly
Sca-Ihigh (71%), with 15% intermediates and
12% negative cells. The Sca-I marker is present on the bone marrow
precursors that enter the thymus, and it is subsequently lost as the
cells differentiate. Thus, the shift in the Sca-I profile observed with
the mAb treatment is consistent with the idea that many of the DN cells
recovered are still in an early stage of development. There is also the
possibility that the cells arrest in development at this stage and thus
fail to down-regulate the Sca-I molecule normally.
The percentage of DN thymocytes expressing the CD69 marker was also
increased in Ab-treated cultures (Fig. 7
B), and the majority
of these cells were c-Kit positive (data not shown). CD69 is an early
activation marker that is often associated with proliferation and/or
differentiation of T cells; however, it can also up-regulate before the
onset of cell death (40). To determine which fate the
CD69+ cells were undergoing in our cultures, we
examined their staining with PI at an earlier time point, after only 2
days in culture with the blocking or nonblocking anti-laminin 5
mAb. As shown in Fig. 7
C, most of the
CD69+ cells at this time were
PI+, and there were twice as many in the presence
of the P3H9-2 mAb as found in the presence of the nonblocking P3E4 mAb.
In addition, the CD69+cells were mostly
CD5low, suggesting that the cells were dying at
an early stage in their differentiation.
To determine whether the dying cells were undergoing apoptosis, we
looked at the profile of annexin V staining of different subpopulations
in the two mAb-treated groups after culturing for 2 days. As shown in
one experiment in Fig. 8
, cells in the
CD25+CD44- and
CD44+ compartments from the P3H9-2-treated
cultures showed slightly higher levels of annexin V-positive staining
in the gated PI-negative channel. In contrast, the
CD4+CD8+ DP cells appearing
at day 2 showed comparable levels of annexin V staining. For 10
independent determinations, the CD44+ compartment
from the P3H9-2-treated cultures showed 62% more annexin V-positive
cells than either P3E4 mAb or no Ab controls. For the
CD25+ subpopulation, the increase was 22%. Both
increases were statistically significant using a paired Students
t test, while a comparison of annexin V-positive DP cells
done for seven of these determinations were not significantly
different. These observations support the notion that blocking
thymocyte interactionss with laminin 5 leads to more apoptotic cell
death in DN thymocytes.
|
| Discussion |
|---|
|
|
|---|
3 and -ß3 Ab
to the basement membrane of the capsule (9) and recently
in the medulla with Ab against all three chains (10).
Expression of mRNA for the LamC2 gene has also been
identified in the human thymus by Northern blotting, but never
localized to a particular anatomic subregion (6, 7, 19).
In our studies, we localized expression of the full-length mouse
LamC2 message primarily to the subcapsular region of the
adult thymus by in situ hybridization (Fig. 2
3 mAb, which we demonstrated
cross-reacts with the mouse
3 protein, was
shown to stain mainly the subcapsular region of a 4-wk-old thymus. Both
the epithelial cells in the basement membrane and the neighboring
subcapsular epithelial cells were positive for expression. Staining in
newborn thymus extended deeper into the cortex, but we think this is
because the subcapsular region occupies a larger fraction of the thymus
at that stage of development. Thus, two components of laminin 5 in the
mouse thymus are confined in their expression to the region where DN
thymocytes interact with nurse cells to undergo the earliest steps in
thymocyte differentiation.
Laminin 5 is normally produced by the basal epithelial cells in the
skin. In the thymus, there are two types of epithelial cells that have
been described in the subcapsular region (41, 42). One
(E1) abuts against the basement membrane and is a likely source for the
laminin 5 in that structure. The other (E2) is the thymic nurse cell
that is located slightly further inside the thymus in the subcapsular
region. The relationship between these two cell types, if any, is
unclear. Our studies show that an SV40 T Ag-transformed epithelial cell
line with subcapsular nurse cell characteristics makes laminin 5;
however, we are not sure which normal epithelial cell it represents.
The cell line expresses two forms of the LamC2 gene, one
encoding the full-length message of 5.1 kb and the other a shortened
form of 2.4 kb (Fig. 1
). The full-sized message is only expressed in
the nurse cell line. In contrast, the short form is present in other
types of thymic epithelial cell lines including both medullary and
cortical epithelial cells (Fig. 1
). The short form may encode a
truncated version of the protein with an alternative function. A
shorter form of the human LamC2 cDNA has been described;
however, it is truncated at the 3' end of the message by an alternative
splicing mechanism, and the long form is more widely expressed than the
short form (19, 43). Whether the mouse also has a 3'
truncated version of the mRNA expressed in tissues other than thymus
remains to be determined.
A laminin 5 receptor,
6ß4 integrin, has been
identified in the subcapsular region of the human thymus
(13) and shown to be expressed on the surface of mouse DN
thymocytes (12). During fetal thymic development, the ß4
chain was detected on virtually all CD25+ cells,
and 2540% of ß4+ cells expressed CD44.
Another laminin 5 receptor,
3ß1 integrin, was also
found in the cortical epithelial area of human thymus
(13), and Abs to both the
3 and
6 integrin chains were shown to block mouse
immature thymocyte adhesion to laminin (15). Furthermore,
6ß4 integrin
expression is maximal at mouse fetal day 1415 when only DN thymocytes
and stromal cells are present in the organ (12). These
observations suggest that early developing thymocytes are equipped to
interact with laminin 5 for either anchoring and/or signaling
purposes.
To test whether laminin 5 might be important for thymocyte development,
we added anti-laminin 5 (
3) mAb to day
14.5 FTOC and determined their impact after 58 days. The two mAb we
chose had known differences in blocking function in a cell adhesion
assay to laminin 5, and we could visualize a difference in their
binding to the nurse cell line after it had adhered in culture,
presumably to the laminin 5 and other ECM proteins it made and
secreted. The nonblocking mAb showed a diffuse punctate staining
pattern, while the blocking mAb tended to stain in big clumps. These
differences presumably relate to recognition of different determinants
on the
3 chain by the two mAb as shown in our
Western blot of kidney ECM (Fig. 3
). The clumps are not an artifact
produced by Ab cross-linking, as they were seen even after fixation
with 6% paraformaldehyde. Instead, they could be equivalent to the
"desmosomal" structures observed by others in electron micrograph
sections of cultured 427.1.86 cells (26). Hemidesmosomes
in the skin play an important anchoring function and are known to
contain
6ß4 integrin
receptors interacting with laminin 5 (7). Hemidesmosomes
have also been observed in the thymus, but their function there is
unknown (7). It is thus possible that this nurse cell line
in culture sets up stable anchoring contacts (44, 45) in
culture involving laminin 5 and
6ß4 integrin
receptors. Preliminary data from our laboratory show that an Ab to the
6 integrin chain does indeed colocalize in the
clumps with the blocking anti-laminin 5
(
3) mAb. Why only the P3H9-2 mAb to
3 laminin shows this unusual reactivity is not
clear, but it could be the key to its functional blocking effects.
Finally, it should be noted that because the blocking experiments were
done with an anti-
3 mAb and not an
anti-
2 mAb, it is formally possible that
the target of the inhibition is laminin 6 or 7 instead of laminin 5,
because those molecules also possess the
3
chain.
The P3H9-2 mAb had an inhibitory effect on thymocyte development in
FTOC, whereas the nonblocking P3E4 mAb did not. Both
ß and 
T cell production were reduced by about 3545%. One reason this
inhibition might only appear to be partial is because at 14.5 days of
fetal development a significant fraction of thymocytes are already
beyond the point at which laminin 5 interactions are required for T
cell development. In our hands, thymocytes from fetal day 14 contain
over 60% CD25+ cells. Consistent with this idea
is the fact that the major effect of the Ab was on the DN subpopulation
within which the CD25+CD44+
and CD25+CD44- subsets
were the most profoundly decreased (7585%). Interestingly, the
earliest DN cells persisted in normal numbers, and, as a consequence of
the loss of the other subsets, Sca-I staining was proportionally
increased. However, the observed increase is greater than the expected
enrichment, suggesting that there also might be some sustained Sca-I
expression on surviving later subsets because of disruptive effects on
differentiation. Finally, DN cells expressing the activation marker
CD69 were also increased, and early on in culture this was clearly
associated with dying cells (Figs. 7
and 8
). The possibility that
blocking laminin 5 leads to an early thymocyte death mechanism is
consistent with the observation that there is no accumulation of the
CD44+CD25- precursors and
that there are higher numbers of annexin V-positive cells in the
CD44+ subsets.
The simplest model to explain our observations is one in which the T
cell precursors differentiate into
CD44+CD25- thymocytes and
begin to express
6ß4
integrin receptors, which then interact with laminin 5 secreted by the
thymic nurse cells. If the response to further differentiation signals
requires trophic signaling through this integrin receptor, then
blocking such signals with the P3H9-2 mAb could result in cell death.
Less likely is the possibility that the Ab signals the cells to die by
cross-linking laminin 5 bound to their surface integrin receptors. In
either case, the
CD44+CD25- cells would not
accumulate because their differentiation is not inhibited, only their
survival as they attempt to differentiate. In other model systems,
epithelial and endothelial cells have been shown to undergo apoptosis
when they are detached from an ECM (46, 47, 48). This process
has been termed anoikis (47, 48). Protection from death is
only mediated by certain integrins and is currently thought to involve
signaling through focal adhesion kinase with subsequent activation of
the phosphotidylinositol-3 kinase pathway (47). An
alternative model consistent with our data is that the bone marrow
thymocyte precursors require interaction with laminin 5 to successfully
complete their homing to the subcapsular region of the thymus. If they
dont receive this signal, they die. We favor the first model,
however, because previous studies have shown that
6ß4 integrin receptors
display their highest level of expression (and presumably function) on
CD25+ cells (12), a stage well into
thymocyte differentiation and one at which we see the greatest effect
on DN cell survival.
If somehow the cells pass through the critical laminin 5-dependent DN
stage of development without undergoing apoptosis, they might then
proceed normally with the rest of thymocyte differentiation, perhaps
including extra proliferation after ß selection. This would explain
why we observed only a moderate reduction in DP and SP cells even
though there was a severe reduction in DN cells. Such a phenotype is
also observed in the absence of IL-7 (49). In our data,
the CD44-CD25- DN subset
appears to be less affected and the DP subset is the least affected,
suggesting that some of the loss can be made up at the post-ß
selection expansion phase. However, there is some suggestion that the
yield of SP thymocytes is lower than what we would have expected based
on the yield of the DP cells (4050% for SP vs 60% for DP).
Interestingly, a recent publication (10) has described the
presence of laminin 5 in the medulla of the human thymus and shown that
soluble laminin 5 as well as an
anti-
6ß4 Ab could
partially inhibit anti-CD3-induced thymocyte proliferation. Thus,
laminin 5 might also play a role in the generation or survival of SP
thymocytes. Alternatively, because we did not detect any laminin 5 in
the medulla of the mouse thymus, the effect of the blocking P3H9-2 mAb
on SP cells could be a secondary consequence of the earlier deprivation
of laminin 5 signaling that manifests itself during positive or
negative selection, e.g., an effect leading to lower bcl-2 levels in
the surviving DP thymocytes that would make them more vulnerable to
failing selection.
In conclusion, our experiments suggest that laminin 5 is an important ECM protein secreted by subcapsular thymic epithelial cells. We propose that it functions during the DN stage of thymocyte development to provide a temporary anchorage site for these cells. This presumably is required for maintaining the cells in the right environment for the completion of this stage in their differentiation. We interpret the fact that this interaction appears to be required for DN thymocyte survival as a mechanism for maintaining fidelity in this process.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Moon Gyo Kim, National Creative Research Initiative Center for Genetic Reprograming, Institute for Molecular Biology and Genetics, Building 105 Room 319, Seoul National University, Shinlim-dong, Kwanak-Gu, Seoul, Korea. ![]()
3 Abbreviations used in this paper: ECM, extracellular matrix; DN, double negative; DP, double positive; SP, single positive; TSO, thymic stromal origin; FTOC, fetal thymic organ culture; Sca-1, stem cell Ag 1; PI, propidium iodide. ![]()
Received for publication June 17, 1999. Accepted for publication April 11, 2000.
| References |
|---|
|
|
|---|
6ß4 integrins. J. Cell Biol. 144:563.
3ß1 and
6ß1 integrins mediate laminin/merosin binding and function as costimulatory molecules for human thymocyte proliferation. J. Immunol. 154:500.[Abstract]
3ß1 integrin: purification, processing, regulation, and specific binding to laminin-5 and invasin in a mutually exclusive manner. Biochemistry 37:10945.[Medline]
2 (B2t) chain, a subunit of epithelial cell laminin. Eur. J. Biochem. 228:120.[Medline]
3ß1 positive T lymphocytes. J. Cell Biol. 121:1141.
2 chain gene (LAMC2) of kalinin/laminin 5 in the junctional forms of epidermolysis bullosa. Nat. Genet. 6:293.[Medline]
2-deficient human keratinocytes modifies cell morphology, motility, and adhesion. J. Biol. Chem. 271:18437.
3 chain: distinct expression pattern of the laminin
3A and
3B chain isoforms. J. Biol. Chem. 270:21820.
2 chain gene (LAMC2): alternative splicing with different tissue distribution of two transcripts. Genomics 32:54.[Medline]
3ß1 in focal adhesions and
6ß4/bullous pemphigoid antigen in a new stable anchoring contact (SAC) of keratinocytes: relation to hemidesmosomes. J. Cell Biol. 111:3141.
3ß1 in epithelial basement membranes. Cell 65:599.[Medline]
This article has been cited by other articles:
![]() |
G. Gorfu, I. Virtanen, M. Hukkanen, V.-P. Lehto, P. Rousselle, E. Kenne, L. Lindbom, R. Kramer, K. Tryggvason, and M. Patarroyo Laminin isoforms of lymph nodes and predominant role of {alpha}5-laminin(s) in adhesion and migration of blood lymphocytes J. Leukoc. Biol., September 1, 2008; 84(3): 701 - 712. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Gong, R. Zhang, J. Zhang, L. Xu, F. Zhang, W. Xu, Y. Wang, Y. Chu, and S. Xiong {alpha}-Dystroglycan is involved in positive selection of thymocytes by participating in immunological synapse formation FASEB J, May 1, 2008; 22(5): 1426 - 1439. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gilboa-Geffen, P. P. Lacoste, L. Soreq, G. Cizeron-Clairac, R. Le Panse, F. Truffault, I. Shaked, H. Soreq, and S. Berrih-Aknin The thymic theme of acetylcholinesterase splice variants in myasthenia gravis Blood, May 15, 2007; 109(10): 4383 - 4391. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Drumea-Mirancea, J. T. Wessels, C. A. Muller, M. Essl, J. A. Eble, E. Tolosa, M. Koch, D. P. Reinhardt, M. Sixt, L. Sorokin, et al. Characterization of a conduit system containing laminin-5 in the human thymus: a potential transport system for small molecules J. Cell Sci., April 1, 2006; 119(7): 1396 - 1405. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-S. Lee, T. Y. Kim, Y.-B. Kim, S.-Y. Lee, S.-G. Ko, H.-S. Jong, T.-Y. Kim, Y.-J. Bang, and J. W. Lee The Signaling Network of Transforming Growth Factor {beta}1, Protein Kinase C{delta}, and Integrin Underlies the Spreading and Invasiveness of Gastric Carcinoma Cells Mol. Cell. Biol., August 15, 2005; 25(16): 6921 - 6936. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Savino, D. A. Mendes-da-Cruz, S. Smaniotto, E. Silva-Monteiro, and D. M. S. Villa-Verde Molecular mechanisms governing thymocyte migration: combined role of chemokines and extracellular matrix J. Leukoc. Biol., June 1, 2004; 75(6): 951 - 961. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vivinus-Nebot, P. Rousselle, J.-P. Breittmayer, C. Cenciarini, S. Berrih-Aknin, S. Spong, P. Nokelainen, F. Cottrez, M. P. Marinkovich, and A. Bernard Mature Human Thymocytes Migrate on Laminin-5 with Activation of Metalloproteinase-14 and Cleavage of CD44 J. Immunol., February 1, 2004; 172(3): 1397 - 1406. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Utsuyama, J. Shiraishi, H. Takahashi, M. Kasai, and K. Hirokawa Glia maturation factor produced by thymic epithelial cells plays a role in T cell differentiation in the thymic microenvironment Int. Immunol., May 1, 2003; 15(5): 557 - 564. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Prockop, S. Palencia, C. M. Ryan, K. Gordon, D. Gray, and H. T. Petrie Stromal Cells Provide the Matrix for Migration of Early Lymphoid Progenitors Through the Thymic Cortex J. Immunol., October 15, 2002; 169(8): 4354 - 4361. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. P. Kaldjian, J. E. Gretz, A. O. Anderson, Y. Shi, and S. Shaw Spatial and molecular organization of lymph node T cell cortex: a labyrinthine cavity bounded by an epithelium-like monolayer of fibroblastic reticular cells anchored to basement membrane-like extracellular matrix Int. Immunol., October 1, 2001; 13(10): 1243 - 1253. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. T. Petrie, M. Tourigny, D. B. Burtrum, and F. Livak Precursor Thymocyte Proliferation and Differentiation Are Controlled by Signals Unrelated to the Pre-TCR J. Immunol., September 15, 2000; 165(6): 3094 - 3098. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shang, N. Koshikawa, S. Schenk, and V. Quaranta The LG3 Module of Laminin-5 Harbors a Binding Site for Integrin alpha 3beta 1 That Promotes Cell Adhesion, Spreading, and Migration J. Biol. Chem., August 24, 2001; 276(35): 33045 - 33053. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |