|
|
||||||||
Up-Regulate Substance P Receptor Expression in Murine Peritoneal Macrophages1
Department of Biology, University of North Carolina, Charlotte, NC 28223
| Abstract |
|---|
|
|
|---|
can increase the
expression of NK-1 receptors on murine peritoneal macrophages.
Specifically, we show that IL-4 and IFN-
can elicit increases in the
level of mRNA encoding the NK-1 receptor by up to 12- and 13-fold,
respectively. Furthermore, these cytokines can significantly increase
the expression of the NK-1 receptor protein as measured by Western blot
and FACS analysis using specific Abs developed in our laboratory. In
addition, we have demonstrated the ability of both IL-4 and IFN-
to
enhance the ability of macrophages to bind substance P as measured by
radiolabeled binding assay. The observation that the level of
expression of this receptor protein can be enhanced by cytokines that
promote either cell-mediated (Th1) or humoral (Th2) immune responses
supports the idea that this receptor can be induced during either type
of immune response. As such, these results may point to a more
ubiquitous role for substance P in the generation of optimal immune
responses than previously appreciated. | Introduction |
|---|
|
|
|---|
Signaling through the substance P receptor can induce a respiratory
burst in macrophages, resulting in the production of reactive oxygen
intermediates (16, 17), and is known to be a potent
stimulus for the production of proinflammatory molecules by these
cells, such as IL-1, IL-6, TNF-
, and IL-12 (18, 19, 20, 21). In
addition, our laboratory has recently demonstrated a novel mechanism by
which substance P may augment inflammatory responses by dramatically
diminishing the production of the immunosuppressive cytokine, TGF-ß1,
from macrophages stimulated with LPS or IFN-
(22).
Furthermore, compelling evidence for the importance of substance P and
its receptor in inflammatory events in vivo comes from studies that
have identified increased substance P levels (23, 24, 25, 26, 27, 28) or
substance P receptor expression (29, 30, 31) at sites of
inflammation. More recently, studies have demonstrated greatly reduced
inflammatory responses in genetically manipulated mice devoid of
substance P/substance P receptor interactions (32, 33),
providing further evidence for this neuropeptide as a proinflammatory
mediator in vivo.
The mammalian tachykinins, substance P, neurokinin A, and neurokinin B, have high affinity for the neurokinin receptor subtypes, NK-1, NK-2, and NK-3, respectively (for review, see Ref. 34). These receptors are members of the superfamily of G protein-coupled receptors characterized by a seven-transmembrane domain motif. The ability of macrophages to express authentic substance P receptors (i.e., NK-1 receptors) has been inferred from radioreceptor binding assays (17, 30, 35), functional assays (16, 18, 21, 29, 36, 37, 38, 39), and, most recently, identification of NK-1 receptor mRNA expression (29, 40, 41, 42, 43). Despite the evidence for such receptor expression on macrophages, we know little about NK-1 expression at the protein level or what host factors might up-regulate expression of this receptor.
In the present study we have identified cytokines and bacterial products that can significantly up-regulate the expression of mRNA encoding the NK-1 substance P receptor in cultured murine macrophages. In addition, we have demonstrated the presence of the NK-1 receptor protein in these cells using specific Abs developed in our laboratory. Importantly, we have investigated the ability of those factors that up-regulate NK-1 receptor mRNA expression to modulate the level of expression of the NK-1 receptor protein in cultured murine macrophages. We demonstrate that NK-1 receptor expression on macrophages can be enhanced by cytokines that promote either cell-mediated (Th1) or humoral (Th2) immune responses. As such, these results may point to a more ubiquitous role for substance P in the generation of optimal immune responses than previously appreciated.
| Materials and Methods |
|---|
|
|
|---|
LPS was purchased from Sigma (St. Louis, MO.). Recombinant IL-4
and IFN-
were purchased from PharMingen (San Diego, CA). IL-5 was
purchased from R&D Systems (Minneapolis, MN). GR73632
-aminovaleryl
[Pro9,N-Me-Leu10]substance
P 711 (substance P agonist) was purchased from Peninsula Laboratories
(Belmont, CA).
Isolation of murine peritoneal macrophages and in vitro stimulation
Elicited peritoneal macrophages were isolated as previously described (44). Briefly, BALB/c mice (Charles Rivers Laboratories, Wilmington, MA), weighing 2024 g, were injected i.p. with 250 µl of IFA (Sigma). Three days later, the peritoneal cavities were lavaged with RPMI 1640 (seven times, 1.5 ml/animal; Cellgro, Washington, D.C.) containing 2% FCS (Atlanta Biologics, Norcross, GA) to remove the elicited peritoneal macrophages. After washing twice in RPMI 1640, adherent macrophages were cultured in RPMI 1640 containing 2% FCS and gentamicin. To insure that the isolated cells were macrophages, adherent cells were Giemsa stained for morphology and stained immunofluorescently for the presence of CD11b and the absence of surface Ig and CD3 as previously described (44).
To evaluate the effects of exposure to various agonists, 2 x
106 macrophages were cultured with varying
concentrations of LPS, murine IL-4, murine IL-5, murine IFN-
, or
substance P agonist as indicated. Cultures were maintained for 4, 8,
12, 24, or 48 h for isolation of poly(A)+
RNA, immunofluorescence, or total protein isolation as indicated. The
viability of cultured macrophages treated with these agents was
quantified according to the ability of these cells to exclude trypan
blue. In each treatment group, >95% of the cells excluded the
dye.
Cell lines
Chinese hamster ovary (CHO) cells and CHO cells stably transfected with the NK-1, NK-2, or NK-3 receptor (45) were cultured as previously described. The rat pancreatic acinar cell line, AR42J, and the human B lymphoblastoid cell line, IM9, were obtained from American Type Culture Collection (Manassas, VA) and maintained according to the instructions supplied by the vendor. These cell lines have previously been demonstrated to exclusively express authentic NK-1 receptors (46, 47).
Isolation of poly(A)+ RNA and semiquantitative RT-PCR
Total RNA was isolated from cultured macrophages using TRIzol reagent (Life Technologies, Gaithersburg, MD) as previously described (29, 22, 44). Poly(A)+ RNA was then isolated from total RNA using polystyrene latex-oligo(dT) beads (Oligotex-dT, Qiagen, Chatsworth, CA) as described previously (48). One hundred nanograms of poly(A)+ RNA was reverse transcribed in the presence of random hexamers using 200 U of RNase H- Moloney leukemia virus reverse transcriptase (Promega, Madison, WI) in the buffer supplied by the manufacturer, as previously described by our laboratory (20, 22, 29, 44, 48).
PCR was performed on the reverse-transcribed cDNA product to determine the expression of NK-1 receptors, essentially as previously described (20, 22, 29, 44, 48). Briefly, 10% of the total sample cDNA was combined with 2.5 U of Taq polymerase (Promega), 0.02 mM dNTPs, 0.5 µg of each primer, and PCR buffer containing 2.5 mM MgCl2 as provided by the manufacturer. Reactions were brought to 70°C before the addition of Taq polymerase. Samples were placed in a thermal cycler (Robocycler 40, Stratagene, La Jolla, CA) using 95°C denaturation, 60°C annealing, and 72°C extension temperatures, with the first 3 of 30 total cycles having extended denaturation and annealing times. Fifteen percent of each amplified sample was electrophoresed on ethidium bromide-stained agarose gels and visualized under UV illumination.
The positive and negative strand PCR primers used, respectively, were TGGACTCTGATCTCTTCCCCAACA and GGACCCAGATGACAAAGATGACCACTT to amplify mRNA encoding the substance P (NK-1) receptor (450-bp fragment), TGCTGGTGGCTGTAACAGGCAACG and TAGAAACATTGTGGGGAGGCGAGAGC to amplify mRNA encoding the neurokinin A/substance K (NK-2) receptor (376-bp fragment), and GCAGTCTTCGGAAACCTCATCGTT and GAAATGTTGCTTGGGACCTTCTGG to amplify mRNA encoding the neurokinin B (NK-3) receptor (441-bp fragment). PCR primers were derived from the published sequences of NK-1 (49), NK-2 (49), and NK-3 (50). These primers were designed by using Oligo 4.0 primer analysis software (National Biosciences, Plymouth, MA) based on their location in different exons of the genomic sequences for NK-1, NK-2, and NK-3 in addition to their lack of significant homology to sequences present in GenBank (MacVector Sequence analysis software, IBI, New Haven, CT).
The sensitivity and linearity of RT-PCR amplifications for each gene analyzed here were predetermined using limiting dilutions of RNA generated from in vitro transcription reactions as is routine in our laboratory (20, 22, 29, 44, 48, 51). These initial studies insured that the RT-PCR conditions used here were in the linear range of amplification for each mRNA species.
To insure that similar amounts of input RNA were reverse transcribed, poly(A)+ RNA was quantified by DNA dipsticks (Invitrogen, San Diego, CA). In addition, PCR amplification of the housekeeping gene, G3PDH, was performed on 5% of the total cDNA product from each sample to insure similar efficiencies of RT.
The identities of the PCR amplified fragments were verified by size comparison with DNA standards (Promega) and by direct DNA sequencing of representative fragments as previously described (22, 44, 48).
Densitometric analyses of the RT-PCR product bands were performed using National Institutes of Health Image software (obtained from the National Institutes of Health Web site: http://rsb.info.nih.gov/nih-image). Each gel image was imported into Image by Adobe Photoshop (Adobe Systems, San Jose, CA), a gel-plotting macro was used to outline the bands, and the intensity was calculated on the uncalibrated OD setting. Results are presented as either the mean fold increase over those levels found in untreated cells or as the mean value of arbitrary densitometric units corrected for background intensity ± SD.
Development and isolation of Abs to NK-1 receptors
Abs were raised against a synthetic peptide (KGSSRSNSKTMTESSSFYSNMLA) corresponding to the intracellular carboxyl-terminal aa 385407 of murine NK-1 receptors in chickens (Aves Labs, Tigard, OR). This peptide was conjugated to keyhole limpet hemocyanin (KLH)3 as previously described (52, 53), and the conjugate was used as an immunogen. The anti-peptide Abs were affinity purified on an ImmunoPure epoxy-activated agarose column (Pierce, Rockville, IL) to which the peptide had been coupled as previously described (54). Abs to an irrelevant peptide (KGKYDLRDLRPFTEYEFQISSK), which was also conjugated to KLH, were raised in chickens, purified in an identical manner, and used to test the specificity of the Ab against the NK-1 receptor.
Anti-NK-1 receptor C-terminal peptide ELISA
To demonstrate the specificity of the anti NK-1 receptor C-terminal peptide Ab, an anti-peptide ELISA was performed. The NK-1 receptor C-terminal peptide or the irrelevant peptides, FYKSKFYKSK and HQSKELLRLGS, were directly coated onto Maxisorp Immunoplates II microtiter plates (Nunc, Roskilde, Denmark) at 100 µg/well in a volume of 50 µl of 0.1 M NaHCO3 and incubated overnight at 4°C. The microtiter plates were then blocked with PBS with 1% BSA and 0.02% Tween-20 for 1 h at 4°C. Varying dilutions of the affinity-purified anti-NK-1 receptor C-terminal peptide were incubated in the peptide-coated wells for 1 h at 4°C. The wells were washed three times with PBS and 0.02% Tween-20 before addition of the detection Ab, HRP-conjugated donkey anti-chicken IgG Ab (Jackson ImmunoResearch Laboratories, West Grove, PA) at 0.8 µg/ml for 1 h at 4°C, followed by addition of the substrate, tetramethylbenzidine (Promega). Colorimetric reactions were stopped by addition of 0.5 M H2SO4, and absorbances at 450 nm were measured (model 550 microplate reader, Bio-Rad, Hercules, CA).
Western blot analysis for NK-1 receptors
Protein samples were obtained from macrophages, CHO cells, AR42J cells, IM9 cells, or crude spinal cord homogenates in a buffer containing 125 mM Tris base, 20% glycerol, 2% SDS, 1% bromophenol blue, and 2% 2-ME. Samples were electrophoresed on a 10% SDS-polyacrylamide gel and transferred to Immobilon-P Transfer Membranes (Millipore, Bedford, MA). Membranes were blocked for 18 h with 5% skimmed milk at 4°C. After reacting with the primary Ab directed against the NK-1 receptor C-terminal peptide (2 µg/ml) for 1 h at 24°C, blots were washed and incubated in the presence of a donkey anti-chicken IgY Ab conjugated to HRP (Jackson ImmunoResearch Laboratories; 0.8 µg/ml). Bound enzyme was detected with the enhanced chemiluminescence (ECL) system (Amersham Pharmacia Biotech, Arlington Heights, IL). Densitometric analyses of the Western blot bands were performed using National Institutes of Health Image. Each blot image was imported into Image by Adobe Photoshop, a gel-plotting macro was used to outline the bands, and the intensity was calculated on the uncalibrated OD setting. Results are presented as the mean values of arbitrary densitometric units corrected for background intensity ± SDs.
Immunofluorescence for NK-1 receptors
Immunofluorescence analyses (FACSCalibur, Becton Dickinson, San Jose, CA) were performed to determine the presence of NK-1 receptors on macrophages. Cultured macrophages were fixed and permeabilized using CytoFix/CytoPerm Plus according to the directions provided by the manufacturer (PharMingen) before addition of the primary chicken Ab (4 µg/ml) directed against either the NK-1 receptor C-terminal peptide or an irrelevant peptide for 1 h at 4°C. The secondary Ab used for detection of bound primary Ab was a fluorescein-conjugated rabbit anti-chicken IgY purchased from PharMingen (1.5 µg/ml), incubated for 1 h at 4°C. Results are presented as the mean percentage of positive populations ± SD.
Radiolabeled substance P binding assay
Stimulated or unstimulated cultured macrophages were incubated with a previously determined optimal concentration of [125I]Bolton-Hunter-labeled substance P (DuPont-NEN, Boston, MA; 0.5 µCi/ml) for 45 min at 4°C in Na+-azide containing PBS. Bound radiolabel was separated from free by washing twice with buffer. Cells were extracted using 1 M HCl and counted for radioactivity. Specifically bound counts were taken to be those susceptible to blockade by a 1000-fold excess of substance P agonist (Peninsula Laboratories).
Statistical analysis
The results of the present studies were tested statistically by Students paired t test or one-way ANOVA as appropriate, using commercially available software (GraphPad Prism, GraphPad Software, San Diego, CA). Results were determined to be statistically significant when p < 0.05 was obtained.
| Results |
|---|
|
|
|---|
To demonstrate our ability to selectively amplify and detect mRNA
encoding NK-1 (substance P) receptors, mRNA was isolated from cultured
CHO cells stably transfected with rat NK-1, NK-2, or NK-3 receptors
(45), and semiquantitative RT-PCR was performed to detect
the expression of NK-1, NK-2, or NK-3 mRNA. As shown in Fig. 1
, each tachykinin receptor species was
detected in the appropriately transfected cell line to the exclusion of
each other receptor type. NK-1 receptor mRNA was detected exclusively
in CHO cells transfected with rat NK-1 receptors and was not detected
in CHO cells transfected with either NK-2 or NK-3 receptors. In
addition, a positive control for each RT-PCR was performed using total
RNA isolated from mouse spinal cord (Fig. 1
). As expected
(55), mRNA encoding NK-1, NK-2, and NK-3 receptors were
all present in spinal cord samples. Taken in concert, these data
demonstrate our ability to specifically amplify genes encoding each of
the tachykinin receptors.
|
(30 pg/ml), or IL-4 (30 pg/ml) for 8 h demonstrated
elevated levels of mRNA encoding the NK-1 receptor (Fig. 2
-, and IL-4-treated
cells, respectively, as determined by densitometric analysis. Mean
arbitrary densitometric units, corrected for background levels, for
control, LPS-, IFN-
-, and IL-4-treated cells were 33 ± 6,
87 ± 12, 55 ± 8, and 127 ± 12, respectively
(n = 3). Values varied significantly from control
levels for LPS-, IFN-
-, and IL-4-treated cells
(p < 0.05). This finding is in contrast with
the lack of significant effect of these agents on the levels of mRNA
encoding NK-2 or NK-3 as determined by densitometric analysis (Fig. 2
-,
or IL-4-treated cells could not be ascribed to differences in input RNA
or differences in the efficiency of RT, as RT-PCR amplification of the
housekeeping gene, G3PDH, was similar in each sample (Fig. 2
|
and IL-4, stimuli associated with
divergent Th1 and Th2 arms of the immune system, represents a novel
observation. To further investigate the ability of IFN-
and IL-4 to
elevate the expression of mRNA encoding NK-1 receptors, we have studied
the effects of a range of concentrations of each agent on levels of
NK-1 receptor mRNA expression. Cells were cultured for 8 h in the
presence of medium alone or in the presence of 100, 30, or 10 pg/ml
recombinant murine IFN-
or IL-4. Following recovery of mRNA from
these cells, the expression of NK-1 receptor was analyzed using
semiquantitative RT-PCR. As shown in Fig. 3
and IL-4 in dose-dependent
fashions compared with those in untreated cells (0), with maximum
increases of 13- and 12-fold over unstimulated cells in IFN-
- and
IL-4-treated cells, respectively, as determined by densitometric
analysis. The increases in NK-1 receptor mRNA expression seen in
IFN-
- or IL-4-treated cells could not be ascribed to differences in
input RNA or in the efficiency of RT, as RT-PCR amplification of the
housekeeping gene, G3PDH, was similar in each sample (Fig. 3
|
and IL-4, stimuli
associated with cell-mediated (Th1) and humoral (Th2) immune responses,
respectively, elicit significant elevations in the expression of mRNA
encoding NK-1 (substance P) receptors. Development of anti-NK-1 receptor Abs
Investigations into whether the increases in NK-1 receptor mRNA
levels seen in macrophages following IFN-
or IL-4 treatment were
mirrored by alterations in translation of this receptor necessitated
the development of specific Abs directed against this protein. Abs were
raised in chickens against a synthetic peptide
(KGSSRSNSKTMTESSSFYSNMLA) corresponding to the intracellular
carboxyl-terminal aa 385407 of murine NK-1 receptors. This peptide
was selected due to the low degree of sequence homology with other
closely related tachykinin receptors. Thus, an Ab to this region should
selectively recognize the NK-1 receptor.
The peptide corresponding to the NK-1 receptor C-terminal was coupled
to KLH, and chickens were immunized. A peptide-specific Ab was obtained
by affinity purification. When examined by ELISA, the chicken
anti-NK-1 receptor C-terminal peptide Ab reacted with the NK-1
receptor C-terminal peptide and displayed minimal reactivity to control
peptides (Fig. 4
). Affinity-purified Abs
against an irrelevant peptide demonstrated no reactivity to the NK-1
receptor using this ELISA (results not shown).
|
|
|
Modulation of NK-1 receptor expression determined by Western blot analysis
We have used the chicken anti-NK-1 Ab to determine the
presence of NK-1 receptor on murine peritoneal macrophages by Western
blot analysis. Macrophages were isolated and cultured for 12 h
before protein isolation. Protein isolates were electrophoresed on
SDS-polyacrylamide gels and transferred to Immobilon-P transfer
membranes. After a protein-blocking step, blots were incubated with the
chicken anti-NK-1 receptor Ab (4 µg/ml) with or without excess
NK-1 C-terminal peptide (0.1 mg/ml) or with an chicken Ab directed
against an irrelevant peptide. After addition of a HRP-conjugated
donkey anti-chicken secondary Ab (0.8 µg/ml), bound enzyme was
detected with the ECL system. As shown in Fig. 7
, Western blot analysis of protein
isolates from cultured murine peritoneal macrophages probed with the
chicken anti-NK-1 receptor Abs revealed a single prominent band
that was identical in size to that seen in the IM9 and AR42J cell
lines. These data are consistent with the presence of NK-1 (substance
P) receptors in murine macrophages.
|
(100, 10, and 1 pg/ml), or LPS (500, 50, and 5 ng/ml) for
12 h before FACS analysis displayed significant increases in the
levels of NK-1 protein expression over those seen in untreated cells
(Fig. 7
for 12 h over unstimulated cells (88 ± 15,
78 ± 15, and 90 ± 15 vs 45 ± 16, respectively;
n = 3). Band intensities were significantly different
(p < 0.05) for cells treated with 100, 10, and
1 pg/ml LPS for 12 h over unstimulated cells (96 ± 9,
105 ± 7, and 86 ± 9 vs 47 ± 8, respectively;
n = 3). As such, these findings are in accord with the
increases in mRNA expression of the NK-1 receptor shown in Figs. 2
Taken in concert, these data suggest that NK-1 receptors are expressed
in resting cultured murine peritoneal macrophages, and that the level
of expression of this receptor can be increased following exposure to
the bacterial product LPS and by exposure to the endogenous factors
IFN-
and IL-4, stimuli associated with cell-mediated (Th1) and
humoral (Th2) immune responses, respectively. Although these agents can
up-regulate both the level of mRNA encoding the NK-1 receptor and the
level of expression of this protein, it is apparent that the increases
in the levels of mRNA are greater than those seen for the NK-1 receptor
protein. It is likely that this represents the presence of significant
post-translational regulation for this protein product.
When macrophages were cultured for 24 h before protein isolation
the levels of NK-1 protein expression in untreated cultures was
significantly increased over that seen at 12 h (Fig. 8
). In contrast to the elevated levels of
NK-1 receptor expression seen at 12 h, treatment with either LPS
or IFN-
failed to elicit increases in levels of NK-1 receptor
expression over the increased levels seen in untreated cells, and IL-5
again failed to elicit any significant increase (Fig. 8
). However, IL-4
treatment resulted in elevated NK-1 receptor expression in macrophage
isolates (Fig. 8
). Band intensities, measured as mean arbitrary
densitometric units corrected for background levels, were significantly
different (p < 0.05) for cells treated with
100, 10, or 1 pg/ml IL-4 for 24 h compared with those in
unstimulated cells (111 ± 19, 108 ± 19, and 101 ± 17
vs 44 ± 22, respectively; n = 3). In addition and
in contrast to results obtained at 12 h, substance P agonist
proved to be a significant stimulus for the expression of its own
receptor after exposure of cells to this agonist for 24 h (Fig. 8
). Band intensities were significantly different
(p < 0.05) for cells treated with 100 nM
substance P for 24 h over unstimulated cells (100 ± 16 vs
68 ± 16, respectively; n = 3).
|
Modulation of NK-1 receptor expression determined by FACS analysis
To further investigate the presence of NK-1 receptors in murine
peritoneal macrophages we have used immunofluorescent techniques to
measure the number of NK-1-positive cells using the anti-NK-1
receptor Ab and a fluorochrome-linked anti-chicken detection Ab.
Macrophages were obtained and cultured for 12 h before FACS
analysis. As shown in Fig. 9
, 29 ±
3% (n = 3) of untreated cells were positive when
probed using the anti-NK-1 receptor. To control for the specificity
of binding of this Ab, an irrelevant chicken IgY was employed. In
contrast to the results obtained using the anti-NK-1 receptor Ab,
cells failed to demonstrate a significant number of positively staining
cells (<1%; Fig. 9
).
|
(10
pg/ml), or LPS (50 ng/ml) for 12 h before FACS analysis displayed
significant increases in the numbers of positive cells over those seen
in untreated cells. Fig. 9
-, and LPS-treated
cells, respectively (n = 3). These levels represent
significant increases over unstimulated cells
(p < 0.05). In contrast, treatment of
macrophages with either IL-5 (10 pg/ml) or substance P agonist (10 nM)
failed to elicit significant increases in the population of cells
expressing NK-1 receptors (Fig. 9
Taken together, these data suggest that murine macrophages cultured for
12 h express NK-1 substance P receptors, and that IL-4, IFN-
,
and LPS promote the expression of these receptors on macrophages.
When macrophages were cultured for 24 h, the proportion of
NK-1-positive cells in untreated cultures markedly increased over that
seen at 12 h (Fig. 10
). On the
average, 62 ± 8% (n = 3) of untreated cells
proved to be positive for the NK-1 receptor at 24 h postisolation.
In contrast to the elevated population of positive cells seen at
12 h, treatment with either IFN-
or LPS failed to elicit
increases in the NK-1-positive population over the increased basal
levels in untreated cells (62 ± 6 and 60 ± 9%,
respectively; n = 3), and IL-5 again failed to elicit
any increase (64 ± 11; n = 3; Fig. 10
). However,
IL-4 treatment resulted in a higher percentage of NK-1
receptor-positive cells than unstimulated cultures, with 83 ± 8%
of cells being positive (p < 0.05;
n = 3; Fig. 10
). In contrast to results obtained at
12 h, substance P agonist proved to be a significant stimulus for
the expression of its own receptor, with 71 ± 13% of macrophages
expressing the NK-1 receptor after 24-h exposure to this agonist
(p < 0.05; n = 3; Fig. 10
).
|
Modulation of NK-1 receptor expression determined by radiolabeled substance P binding
The use of total cellular proteins for Western blots and the
permeabilization of cells before flow cytometry analyses do not
differentiate between cell surface and intracellular receptors. To
quantify expression of NK-1 receptors at the cell surface we have
measured binding of radiolabeled substance P to macrophages cultured in
the presence or the absence of IL-4 or IFN-
. As shown in Fig. 11
, macrophages cultured with either
IL-4 (1 and 10 pg/ml) or IFN-
(1 and 10 pg/ml) for 24 h showed
significantly (p < 0.05) higher specific
binding of radiolabeled substance P than that seen for unstimulated
cells. These data are consistent with the results obtained using
Western blot and FACS analysis, and suggest that the increased levels
of NK-1 receptor protein expression elicited by IL-4 and IFN-
translate into a functional difference in the ability of macrophages to
bind substance P.
|
| Discussion |
|---|
|
|
|---|
The presence of functional substance P receptors on macrophages has also been demonstrated using in vitro cultures of these cells (16, 18, 21, 29, 36, 37, 38, 39). These studies have demonstrated the NK-1 or NK-2 receptor-mediated nature of responses using specific antagonists to block activity and using concentrations of tachykinins at or near the dissociation constant for these receptors. Furthermore, the presence of functional substance P receptors on macrophages appears to be species conserved, as evidenced by the fact that both rodent and human cells respond to tachykinins.
More recently, molecular biology and protein chemistry techniques have been employed to demonstrate the expression of substance P receptors on macrophages or monocytes. RT-PCR and in situ hybridization have been used to identify NK-1 receptor mRNA expression in macrophages and monocytes (29, 40, 41, 42, 43). The translation of substance P receptor mRNA has been demonstrated using polyclonal Abs generated against cytoplasmic C-terminal peptide (42, 67, 68, 69) or an extension of the C-terminus segment (70). Taken together, these studies clearly demonstrate that leukocytes, and in particular macrophages, express authentic receptors for substance P.
Recent studies have confirmed the importance of substance P-mediated macrophage activation using in vivo models of infectious disease or inflammation. Our laboratory has demonstrated that antagonism of substance P/substance P receptor interactions limits a protective host response against oral inoculations of Salmonella (29). Blum and co-workers (71, 72) have demonstrated that substance P regulates macrophage expression of somatostatin (71), and that this neuropeptide is required for normal granulomatous responses in murine schistosomiasis (72). In addition, NK-1 and NK-2 antagonists have been shown to limit the reactivity of alveolar macrophages in a model of airway inflammation (73). Taken together, results from these diverse model systems point to a common role for substance P/substance P receptor interactions as an important determinant in optimal macrophage-mediated host responsiveness.
Costimulation of T lymphocytes by macrophages serves to define
cell-mediated and humoral immune responses and depends upon the
production of soluble factors and expression of cell surface molecules.
In the present work investigations were undertaken to determine
whether the level of substance P receptor expression by macrophages may
be modulated and thereby identify a novel potential component in the
positive amplification loops characteristic of cell-cell interactions
within the immune system. Surprisingly, both IL-4 and IFN-
were
found to up-regulate the levels of mRNA encoding the NK-1 receptor and
the expression of this protein in macrophages. We had not anticipated
that both IFN-
and IL-4 would have similar effects on NK-1 receptor
expression due to the widely differing effects these cytokines exert on
macrophage function and the propensity of these cytokines to support
different arms of the immune response. IFN-
supports the development
of Th1 cells and optimal cell-mediated immune responses (for review,
see Ref. 74). It is tempting to suggest a scenario in
which early release of substance P augments IL-12 secretion by
macrophages (29). Released IL-12 would, in turn, induce
IFN-
production by T lymphocytes that can increase the expression of
the NK-1 receptor on macrophages. Hence, the influence of substance P
on macrophages may then be enhanced and represent a positive feedback
loop between macrophages and T lymphocytes that augments the
cell-mediated immune response.
IL-4 supports the development of Th2 cells and optimal humoral immune responses (for review, see Ref. 74). Based on the present work, this cytokine also up-regulates NK-1 receptor expression by macrophages. At present, it is unclear how ligation of the substance P receptor on macrophages may further enhance Th2 lymphocyte activation. However, it is clear that substance P/substance P receptor interactions can modulate Ab responses (reviewed in Ref. 75). Speculatively, IL-4-induced substance P receptor expression could heighten the responsiveness of macrophages to this neuropeptide, providing additional Ag presentation or costimulation for T lymphocytes. The nature of the substance P-induced macrophage activation event, which would support humoral immune responses, is presently being investigated. Furthermore, it is clear that substance P might also have direct effects on T or B lymphocytes (reviewed in Ref. 75), which could also influence these regulatory circuits.
Inherent in the observation that IL-4 or IFN-
can up-regulate NK-1
receptor expression by macrophages is the possibility that substance P
can lend further support to either cell-mediated or humoral immune
responses. Thus, the nature of the infection or immunogen must be
considered when attempting to determine how substance P contributes to
an immune response. If the host responds to a particular challenge by
eliciting a cell-mediated immune response, our results suggest that
substance P/substance P receptor interactions may augment such a
pathway regardless of whether the host response is protective.
Alternatively, if the host responds by generating a humoral response,
substance P may again augment the response. Thus, the results presented
here do not support substance P/substance P receptor interactions on
macrophages as a Th1/Th2 switching mechanism, but, rather, as a means
of supporting the direction of an immune response dictated by other
factors. In vivo studies will be required to prove the dual nature of
substance P-mediated immune responses.
In the present study we have employed methods to investigate the
expression of both the levels of mRNA encoding tachykinin receptors and
the expression of the substance P receptor protein. It should be noted
that mRNA analysis of neurokinin receptor subtypes in macrophages in
the present study does not rule out the presence of NK-2 receptors on
macrophages. We have observed modest cytokine-induced increases in NK-2
receptor mRNA expression in some of the studies performed, and this can
be seen in Fig. 3
. However, it was clear that NK-1 receptor mRNA
expression increased significantly and rapidly in response to the
exogenous stimuli used here. As such, we focused our attention on the
level of expression of the NK-1 receptor protein in macrophages.
We describe here the generation of specific Abs directed against the
C-terminal of the NK-1 receptor, and we have used these Abs to
demonstrate the presence of authentic substance P receptors in cultured
murine macrophages using Western blot analysis and immunofluorescence
techniques. There are several important methodological points in the
present studies that should be noted. First, chickens were used as
hosts for producing the specific Abs for several reasons. Chicken IgY
Abs do not bind to mammalian Fc receptors (76), thereby
decreasing nonspecific interactions in our assays. In addition,
substance P receptor sequences are largely conserved among mammalian
species, and so the use of chicken Abs results in increased sensitivity
as well as decreased background in immunological assays due to the
phylogenetic differences between avian and mammalian species
(76). It is of note that the anti-substance P receptor
Ab reacts with murine (cell line AR42J) as well as human (IM-9 cells)
substance P receptors (Fig. 5
) as predicted by the high degree of
homology between these two species at this region of the receptor.
Second, it is clear that prolonged culture of normal unstimulated
macrophages results in a pronounced up-regulation of NK-1 receptor
expression (Figs. 9
and 10
). It is presently unclear how this induction
occurs, although it is possible that prolonged adherence to plastic
leads to activation of these cells. This finding should therefore be a
consideration in future studies investigating tachykinin receptor
expression in this cell type that involve lengthy periods in
culture.
In summary, the present study provides strong evidence for the
modulation of NK-1 receptor expression by macrophages in response to
IL-4 and IFN-
. These studies support the idea that this receptor can
be induced during immune responses and that both cell-mediated and
humoral responses could be affected. The influence of
lymphocyte-derived cytokines on macrophage expression of substance P
receptors also suggests that novel amplification loops might exist
between macrophages and other leukocytes. If true, such speculations
would place substance P/substance P receptor interactions as potential
contributors in the established pathways of immune activation that
involve costimulation of APC and T lymphocytes.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kenneth L. Bost, Department of Biology, 9201 University City Boulevard, University of North Carolina, Charlotte, NC 28223. ![]()
3 Abbreviations used in this paper: KLH, keyhole limpet hemocyanin; ECL, enhanced chemiluminescence. ![]()
Received for publication December 20, 1999. Accepted for publication April 21, 2000.
| References |
|---|
|
|
|---|
and interleukin-12 genes are preferentially expressed during early experimental African trypanosomiasis and suppressed by denervation of the spleen. Scand. J. Immunol. 50:485.[Medline]
release by human blood monocytes and macrophages. J. Neuroimmunol. 82:126.[Medline]
induced TGF-ß1 production by cultured murine macrophages. Cell. Immunol. 183:113.[Medline]
This article has been cited by other articles:
![]() |
N. J. Stevenson, M. R. Addley, E. J. Ryan, C. R. Boyd, H. P. Carroll, V. Paunovic, C. A. Bursill, H. C. Miller, K. M. Channon, A. E. McClurg, et al. CCL11 blocks IL-4 and GM-CSF signaling in hematopoietic cells and hinders dendritic cell differentiation via suppressor of cytokine signaling expression J. Leukoc. Biol., February 1, 2009; 85(2): 289 - 297. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Blum, T. Setiawan, L. Hang, K. Stoyanoff, and J. V. Weinstock Interleukin-12 (IL-12) and IL-23 Induction of Substance P Synthesis in Murine T Cells and Macrophages Is Subject to IL-10 and Transforming Growth Factor {beta} Regulation Infect. Immun., August 1, 2008; 76(8): 3651 - 3656. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sun, R. D. Ramnath, L. Zhi, R. Tamizhselvi, and M. Bhatia Substance P enhances NF-{kappa}B transactivation and chemokine response in murine macrophages via ERK1/2 and p38 MAPK signaling pathways Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1586 - C1596. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Rettew, Y. M. Huet-Hudson, and I. Marriott Testosterone Reduces Macrophage Expression in the Mouse of Toll-Like Receptor 4, a Trigger for Inflammation and Innate Immunity Biol Reprod, March 1, 2008; 78(3): 432 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. D. Hazlett, S. A. McClellan, R. P. Barrett, J. Liu, Y. Zhang, and S. Lighvani Spantide I Decreases Type I Cytokines, Enhances IL-10, and Reduces Corneal Perforation in Susceptible Mice after Pseudomonas aeruginosa Infection Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 797 - 807. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Lai, W. Z. Ho, L. E. Kilpatrick, X. Wang, F. Tuluc, H. M. Korchak, and S. D. Douglas Full-length and truncated neurokinin-1 receptor expression and function during monocyte/macrophage differentiation PNAS, May 16, 2006; 103(20): 7771 - 7776. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Metwali, A. M. Blum, D. E. Elliott, T. Setiawan, and J. V. Weinstock Cutting Edge: Hemokinin Has Substance P-Like Function and Expression in Inflammation J. Immunol., June 1, 2004; 172(11): 6528 - 6532. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rasley, I. Marriott, C. R. Halberstadt, K. L. Bost, and J. Anguita Substance P Augments Borrelia burgdorferi-Induced Prostaglandin E2 Production by Murine Microglia J. Immunol., May 1, 2004; 172(9): 5707 - 5713. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bang, M. Biburger, W. L. Neuhuber, and G. Tiegs Neurokinin-1 Receptor Antagonists Protect Mice from CD95- and Tumor Necrosis Factor-{alpha}-Mediated Apoptotic Liver Damage J. Pharmacol. Exp. Ther., March 1, 2004; 308(3): 1174 - 1180. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. V. Weinstock, A. Blum, A. Metwali, D. Elliott, N. Bunnett, and R. Arsenescu Substance P Regulates Th1-Type Colitis in IL-10 Knockout Mice J. Immunol., October 1, 2003; 171(7): 3762 - 3767. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Madrazo, S. L. Tranguch, and I. Marriott Signaling via Toll-Like Receptor 5 Can Initiate Inflammatory Mediator Production by Murine Osteoblasts Infect. Immun., September 1, 2003; 71(9): 5418 - 5421. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. P. M. van der Kleij, D. Ma, F. A. M. Redegeld, A. D. Kraneveld, F. P. Nijkamp, and J. Bienenstock Functional Expression of Neurokinin 1 Receptors on Mast Cells Induced by IL-4 and Stem Cell Factor J. Immunol., August 15, 2003; 171(4): 2074 - 2079. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bang, G. Sass, A. K. Kiemer, A. M. Vollmar, W. L. Neuhuber, and G. Tiegs Neurokinin-1 Receptor Antagonists CP-96,345 and L-733,060 Protect Mice from Cytokine-Mediated Liver Injury J. Pharmacol. Exp. Ther., April 1, 2003; 305(1): 31 - 39. [Abstract] [Full Text] |
||||
![]() |
S. F. Elsawa, W. Taylor, C. C. Petty, I. Marriott, J. V. Weinstock, and K. L. Bost Reduced CTL Response and Increased Viral Burden in Substance P Receptor-Deficient Mice Infected with Murine {gamma}-Herpesvirus 68 J. Immunol., March 1, 2003; 170(5): 2605 - 2612. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. McConnell, R. S. Yunus, S. A. Gross, K. L. Bost, M. G. Clemens, and F. M. Hughes Jr. Water Permeability of an Ovarian Antral Follicle Is Predominantly Transcellular and Mediated by Aquaporins Endocrinology, August 1, 2002; 143(8): 2905 - 2912. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Rameshwar, D. D. Joshi, P. Yadav, J. Qian, P. Gascon, V. T. Chang, D. Anjaria, J. S. Harrison, and X. Song Mimicry between neurokinin-1 and fibronectin may explain the transport and stability of increased substance P immunoreactivity in patients with bone marrow fibrosis Blood, May 15, 2001; 97(10): 3025 - 3031. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. BLUM, A. METWALI, C. CRAWFORD, J. LI, K. QADIR, D. E. ELLIOTT, and J. V. WEINSTOCK Interleukin 12 and antigen independently induce substance P receptor expression in T cells in murine schistosomiasis mansoni FASEB J, April 1, 2001; 15(6): 950 - 957. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |