The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marriott, I.
Right arrow Articles by Bost, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marriott, I.
Right arrow Articles by Bost, K. L.
The Journal of Immunology, 2000, 165: 182-191.
Copyright © 2000 by The American Association of Immunologists

IL-4 and IFN-{gamma} Up-Regulate Substance P Receptor Expression in Murine Peritoneal Macrophages1

Ian Marriott and Kenneth L. Bost2

Department of Biology, University of North Carolina, Charlotte, NC 28223


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
While the ability of macrophages to express authentic substance P receptors (i.e., NK-1 receptors) has been inferred from radioreceptor binding assays and functional assays and, most recently, by identification of NK-1 receptor mRNA expression, we know little about NK-1 expression at the protein level or what host factors might up-regulate expression of this receptor. In the present study we demonstrate that the cytokines IL-4 and IFN-{gamma} can increase the expression of NK-1 receptors on murine peritoneal macrophages. Specifically, we show that IL-4 and IFN-{gamma} can elicit increases in the level of mRNA encoding the NK-1 receptor by up to 12- and 13-fold, respectively. Furthermore, these cytokines can significantly increase the expression of the NK-1 receptor protein as measured by Western blot and FACS analysis using specific Abs developed in our laboratory. In addition, we have demonstrated the ability of both IL-4 and IFN-{gamma} to enhance the ability of macrophages to bind substance P as measured by radiolabeled binding assay. The observation that the level of expression of this receptor protein can be enhanced by cytokines that promote either cell-mediated (Th1) or humoral (Th2) immune responses supports the idea that this receptor can be induced during either type of immune response. As such, these results may point to a more ubiquitous role for substance P in the generation of optimal immune responses than previously appreciated.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In recent years evidence has accumulated supporting the idea that neuronal input might have profound effects on the initiation of immune responses. This contention has been fueled by the realization that there is significant peptidergic innervation at sites susceptible to pathogenic invasion (i.e., skin, gut, and mucosa), and at sites where many immunogens are initially processed (1, 2, 3, 4). When neuronal input to these sites is depleted or antagonized, significant alterations in immune responses or function have been described (5, 6, 7, 8, 9, 10, 11, 12). It has been suggested that neuronally derived peptides directly interacting with cells of the immune system might underlie this effect. In support of such a possibility, studies have shown that neurons are in close proximity or have direct contact with leukocytes such as macrophages within lymphoid organs (13, 14, 15). These studies and others have established a basis for molecular and cellular investigations into the interaction between the nervous and immune systems. The present study focuses on the differential expression of substance P receptors in macrophages as a mechanism underlying augmentation of macrophage-mediated immune responses.

Signaling through the substance P receptor can induce a respiratory burst in macrophages, resulting in the production of reactive oxygen intermediates (16, 17), and is known to be a potent stimulus for the production of proinflammatory molecules by these cells, such as IL-1, IL-6, TNF-{alpha}, and IL-12 (18, 19, 20, 21). In addition, our laboratory has recently demonstrated a novel mechanism by which substance P may augment inflammatory responses by dramatically diminishing the production of the immunosuppressive cytokine, TGF-ß1, from macrophages stimulated with LPS or IFN-{gamma} (22). Furthermore, compelling evidence for the importance of substance P and its receptor in inflammatory events in vivo comes from studies that have identified increased substance P levels (23, 24, 25, 26, 27, 28) or substance P receptor expression (29, 30, 31) at sites of inflammation. More recently, studies have demonstrated greatly reduced inflammatory responses in genetically manipulated mice devoid of substance P/substance P receptor interactions (32, 33), providing further evidence for this neuropeptide as a proinflammatory mediator in vivo.

The mammalian tachykinins, substance P, neurokinin A, and neurokinin B, have high affinity for the neurokinin receptor subtypes, NK-1, NK-2, and NK-3, respectively (for review, see Ref. 34). These receptors are members of the superfamily of G protein-coupled receptors characterized by a seven-transmembrane domain motif. The ability of macrophages to express authentic substance P receptors (i.e., NK-1 receptors) has been inferred from radioreceptor binding assays (17, 30, 35), functional assays (16, 18, 21, 29, 36, 37, 38, 39), and, most recently, identification of NK-1 receptor mRNA expression (29, 40, 41, 42, 43). Despite the evidence for such receptor expression on macrophages, we know little about NK-1 expression at the protein level or what host factors might up-regulate expression of this receptor.

In the present study we have identified cytokines and bacterial products that can significantly up-regulate the expression of mRNA encoding the NK-1 substance P receptor in cultured murine macrophages. In addition, we have demonstrated the presence of the NK-1 receptor protein in these cells using specific Abs developed in our laboratory. Importantly, we have investigated the ability of those factors that up-regulate NK-1 receptor mRNA expression to modulate the level of expression of the NK-1 receptor protein in cultured murine macrophages. We demonstrate that NK-1 receptor expression on macrophages can be enhanced by cytokines that promote either cell-mediated (Th1) or humoral (Th2) immune responses. As such, these results may point to a more ubiquitous role for substance P in the generation of optimal immune responses than previously appreciated.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents and solutions

LPS was purchased from Sigma (St. Louis, MO.). Recombinant IL-4 and IFN-{gamma} were purchased from PharMingen (San Diego, CA). IL-5 was purchased from R&D Systems (Minneapolis, MN). GR73632 {delta}-aminovaleryl [Pro9,N-Me-Leu10]substance P 7–11 (substance P agonist) was purchased from Peninsula Laboratories (Belmont, CA).

Isolation of murine peritoneal macrophages and in vitro stimulation

Elicited peritoneal macrophages were isolated as previously described (44). Briefly, BALB/c mice (Charles Rivers Laboratories, Wilmington, MA), weighing 20–24 g, were injected i.p. with 250 µl of IFA (Sigma). Three days later, the peritoneal cavities were lavaged with RPMI 1640 (seven times, 1.5 ml/animal; Cellgro, Washington, D.C.) containing 2% FCS (Atlanta Biologics, Norcross, GA) to remove the elicited peritoneal macrophages. After washing twice in RPMI 1640, adherent macrophages were cultured in RPMI 1640 containing 2% FCS and gentamicin. To insure that the isolated cells were macrophages, adherent cells were Giemsa stained for morphology and stained immunofluorescently for the presence of CD11b and the absence of surface Ig and CD3 as previously described (44).

To evaluate the effects of exposure to various agonists, 2 x 106 macrophages were cultured with varying concentrations of LPS, murine IL-4, murine IL-5, murine IFN-{gamma}, or substance P agonist as indicated. Cultures were maintained for 4, 8, 12, 24, or 48 h for isolation of poly(A)+ RNA, immunofluorescence, or total protein isolation as indicated. The viability of cultured macrophages treated with these agents was quantified according to the ability of these cells to exclude trypan blue. In each treatment group, >95% of the cells excluded the dye.

Cell lines

Chinese hamster ovary (CHO) cells and CHO cells stably transfected with the NK-1, NK-2, or NK-3 receptor (45) were cultured as previously described. The rat pancreatic acinar cell line, AR42J, and the human B lymphoblastoid cell line, IM9, were obtained from American Type Culture Collection (Manassas, VA) and maintained according to the instructions supplied by the vendor. These cell lines have previously been demonstrated to exclusively express authentic NK-1 receptors (46, 47).

Isolation of poly(A)+ RNA and semiquantitative RT-PCR

Total RNA was isolated from cultured macrophages using TRIzol reagent (Life Technologies, Gaithersburg, MD) as previously described (29, 22, 44). Poly(A)+ RNA was then isolated from total RNA using polystyrene latex-oligo(dT) beads (Oligotex-dT, Qiagen, Chatsworth, CA) as described previously (48). One hundred nanograms of poly(A)+ RNA was reverse transcribed in the presence of random hexamers using 200 U of RNase H- Moloney leukemia virus reverse transcriptase (Promega, Madison, WI) in the buffer supplied by the manufacturer, as previously described by our laboratory (20, 22, 29, 44, 48).

PCR was performed on the reverse-transcribed cDNA product to determine the expression of NK-1 receptors, essentially as previously described (20, 22, 29, 44, 48). Briefly, 10% of the total sample cDNA was combined with 2.5 U of Taq polymerase (Promega), 0.02 mM dNTPs, 0.5 µg of each primer, and PCR buffer containing 2.5 mM MgCl2 as provided by the manufacturer. Reactions were brought to 70°C before the addition of Taq polymerase. Samples were placed in a thermal cycler (Robocycler 40, Stratagene, La Jolla, CA) using 95°C denaturation, 60°C annealing, and 72°C extension temperatures, with the first 3 of 30 total cycles having extended denaturation and annealing times. Fifteen percent of each amplified sample was electrophoresed on ethidium bromide-stained agarose gels and visualized under UV illumination.

The positive and negative strand PCR primers used, respectively, were TGGACTCTGATCTCTTCCCCAACA and GGACCCAGATGACAAAGATGACCACTT to amplify mRNA encoding the substance P (NK-1) receptor (450-bp fragment), TGCTGGTGGCTGTAACAGGCAACG and TAGAAACATTGTGGGGAGGCGAGAGC to amplify mRNA encoding the neurokinin A/substance K (NK-2) receptor (376-bp fragment), and GCAGTCTTCGGAAACCTCATCGTT and GAAATGTTGCTTGGGACCTTCTGG to amplify mRNA encoding the neurokinin B (NK-3) receptor (441-bp fragment). PCR primers were derived from the published sequences of NK-1 (49), NK-2 (49), and NK-3 (50). These primers were designed by using Oligo 4.0 primer analysis software (National Biosciences, Plymouth, MA) based on their location in different exons of the genomic sequences for NK-1, NK-2, and NK-3 in addition to their lack of significant homology to sequences present in GenBank (MacVector Sequence analysis software, IBI, New Haven, CT).

The sensitivity and linearity of RT-PCR amplifications for each gene analyzed here were predetermined using limiting dilutions of RNA generated from in vitro transcription reactions as is routine in our laboratory (20, 22, 29, 44, 48, 51). These initial studies insured that the RT-PCR conditions used here were in the linear range of amplification for each mRNA species.

To insure that similar amounts of input RNA were reverse transcribed, poly(A)+ RNA was quantified by DNA dipsticks (Invitrogen, San Diego, CA). In addition, PCR amplification of the housekeeping gene, G3PDH, was performed on 5% of the total cDNA product from each sample to insure similar efficiencies of RT.

The identities of the PCR amplified fragments were verified by size comparison with DNA standards (Promega) and by direct DNA sequencing of representative fragments as previously described (22, 44, 48).

Densitometric analyses of the RT-PCR product bands were performed using National Institutes of Health Image software (obtained from the National Institutes of Health Web site: http://rsb.info.nih.gov/nih-image). Each gel image was imported into Image by Adobe Photoshop (Adobe Systems, San Jose, CA), a gel-plotting macro was used to outline the bands, and the intensity was calculated on the uncalibrated OD setting. Results are presented as either the mean fold increase over those levels found in untreated cells or as the mean value of arbitrary densitometric units corrected for background intensity ± SD.

Development and isolation of Abs to NK-1 receptors

Abs were raised against a synthetic peptide (KGSSRSNSKTMTESSSFYSNMLA) corresponding to the intracellular carboxyl-terminal aa 385–407 of murine NK-1 receptors in chickens (Aves Labs, Tigard, OR). This peptide was conjugated to keyhole limpet hemocyanin (KLH)3 as previously described (52, 53), and the conjugate was used as an immunogen. The anti-peptide Abs were affinity purified on an ImmunoPure epoxy-activated agarose column (Pierce, Rockville, IL) to which the peptide had been coupled as previously described (54). Abs to an irrelevant peptide (KGKYDLRDLRPFTEYEFQISSK), which was also conjugated to KLH, were raised in chickens, purified in an identical manner, and used to test the specificity of the Ab against the NK-1 receptor.

Anti-NK-1 receptor C-terminal peptide ELISA

To demonstrate the specificity of the anti NK-1 receptor C-terminal peptide Ab, an anti-peptide ELISA was performed. The NK-1 receptor C-terminal peptide or the irrelevant peptides, FYKSKFYKSK and HQSKELLRLGS, were directly coated onto Maxisorp Immunoplates II microtiter plates (Nunc, Roskilde, Denmark) at 100 µg/well in a volume of 50 µl of 0.1 M NaHCO3 and incubated overnight at 4°C. The microtiter plates were then blocked with PBS with 1% BSA and 0.02% Tween-20 for 1 h at 4°C. Varying dilutions of the affinity-purified anti-NK-1 receptor C-terminal peptide were incubated in the peptide-coated wells for 1 h at 4°C. The wells were washed three times with PBS and 0.02% Tween-20 before addition of the detection Ab, HRP-conjugated donkey anti-chicken IgG Ab (Jackson ImmunoResearch Laboratories, West Grove, PA) at 0.8 µg/ml for 1 h at 4°C, followed by addition of the substrate, tetramethylbenzidine (Promega). Colorimetric reactions were stopped by addition of 0.5 M H2SO4, and absorbances at 450 nm were measured (model 550 microplate reader, Bio-Rad, Hercules, CA).

Western blot analysis for NK-1 receptors

Protein samples were obtained from macrophages, CHO cells, AR42J cells, IM9 cells, or crude spinal cord homogenates in a buffer containing 125 mM Tris base, 20% glycerol, 2% SDS, 1% bromophenol blue, and 2% 2-ME. Samples were electrophoresed on a 10% SDS-polyacrylamide gel and transferred to Immobilon-P Transfer Membranes (Millipore, Bedford, MA). Membranes were blocked for 18 h with 5% skimmed milk at 4°C. After reacting with the primary Ab directed against the NK-1 receptor C-terminal peptide (2 µg/ml) for 1 h at 24°C, blots were washed and incubated in the presence of a donkey anti-chicken IgY Ab conjugated to HRP (Jackson ImmunoResearch Laboratories; 0.8 µg/ml). Bound enzyme was detected with the enhanced chemiluminescence (ECL) system (Amersham Pharmacia Biotech, Arlington Heights, IL). Densitometric analyses of the Western blot bands were performed using National Institutes of Health Image. Each blot image was imported into Image by Adobe Photoshop, a gel-plotting macro was used to outline the bands, and the intensity was calculated on the uncalibrated OD setting. Results are presented as the mean values of arbitrary densitometric units corrected for background intensity ± SDs.

Immunofluorescence for NK-1 receptors

Immunofluorescence analyses (FACSCalibur, Becton Dickinson, San Jose, CA) were performed to determine the presence of NK-1 receptors on macrophages. Cultured macrophages were fixed and permeabilized using CytoFix/CytoPerm Plus according to the directions provided by the manufacturer (PharMingen) before addition of the primary chicken Ab (4 µg/ml) directed against either the NK-1 receptor C-terminal peptide or an irrelevant peptide for 1 h at 4°C. The secondary Ab used for detection of bound primary Ab was a fluorescein-conjugated rabbit anti-chicken IgY purchased from PharMingen (1.5 µg/ml), incubated for 1 h at 4°C. Results are presented as the mean percentage of positive populations ± SD.

Radiolabeled substance P binding assay

Stimulated or unstimulated cultured macrophages were incubated with a previously determined optimal concentration of [125I]Bolton-Hunter-labeled substance P (DuPont-NEN, Boston, MA; 0.5 µCi/ml) for 45 min at 4°C in Na+-azide containing PBS. Bound radiolabel was separated from free by washing twice with buffer. Cells were extracted using 1 M HCl and counted for radioactivity. Specifically bound counts were taken to be those susceptible to blockade by a 1000-fold excess of substance P agonist (Peninsula Laboratories).

Statistical analysis

The results of the present studies were tested statistically by Student’s paired t test or one-way ANOVA as appropriate, using commercially available software (GraphPad Prism, GraphPad Software, San Diego, CA). Results were determined to be statistically significant when p < 0.05 was obtained.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Modulation of mRNA encoding NK-1 receptor expression in murine macrophages

To demonstrate our ability to selectively amplify and detect mRNA encoding NK-1 (substance P) receptors, mRNA was isolated from cultured CHO cells stably transfected with rat NK-1, NK-2, or NK-3 receptors (45), and semiquantitative RT-PCR was performed to detect the expression of NK-1, NK-2, or NK-3 mRNA. As shown in Fig. 1Go, each tachykinin receptor species was detected in the appropriately transfected cell line to the exclusion of each other receptor type. NK-1 receptor mRNA was detected exclusively in CHO cells transfected with rat NK-1 receptors and was not detected in CHO cells transfected with either NK-2 or NK-3 receptors. In addition, a positive control for each RT-PCR was performed using total RNA isolated from mouse spinal cord (Fig. 1Go). As expected (55), mRNA encoding NK-1, NK-2, and NK-3 receptors were all present in spinal cord samples. Taken in concert, these data demonstrate our ability to specifically amplify genes encoding each of the tachykinin receptors.



View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 1. Selective amplification and detection of mRNA encoding NK-1, NK-2, and NK-3 receptors. mRNA was isolated from cultured CHO cells stably transfected with rat NK-1, NK-2, or NK-3 receptors, and semiquantitative RT-PCR was performed to detect the expression of NK-1, NK-2, or NK-3 mRNA. Results are presented as amplified products electrophoresed on ethidium bromide-stained agarose. A positive control for each RT-PCR was also performed using crude spinal cord isolates (SC). These studies were performed three times with similar results.

 
Experiments were undertaken to determine whether murine peritoneal macrophages express mRNA encoding tachykinin receptors. As shown in Fig. 2Go, mRNA encoding NK-1, NK-2, and NK-3 receptors was detected in resting cultures of murine macrophages. Importantly, macrophages cultured in the presence of LPS (500 ng/ml), IFN-{gamma} (30 pg/ml), or IL-4 (30 pg/ml) for 8 h demonstrated elevated levels of mRNA encoding the NK-1 receptor (Fig. 2Go). Levels of mRNA encoding the NK-1 receptor demonstrated 3-, 2-, and 4-fold increases over unstimulated cells in LPS-, IFN-{gamma}-, and IL-4-treated cells, respectively, as determined by densitometric analysis. Mean arbitrary densitometric units, corrected for background levels, for control, LPS-, IFN-{gamma}-, and IL-4-treated cells were 33 ± 6, 87 ± 12, 55 ± 8, and 127 ± 12, respectively (n = 3). Values varied significantly from control levels for LPS-, IFN-{gamma}-, and IL-4-treated cells (p < 0.05). This finding is in contrast with the lack of significant effect of these agents on the levels of mRNA encoding NK-2 or NK-3 as determined by densitometric analysis (Fig. 2Go). The increases in NK-1 receptor mRNA expression seen in LPS-, IFN-{gamma}-, or IL-4-treated cells could not be ascribed to differences in input RNA or differences in the efficiency of RT, as RT-PCR amplification of the housekeeping gene, G3PDH, was similar in each sample (Fig. 2Go).



View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 2. Up-regulation of mRNA encoding NK-1 receptors in macrophages by LPS, IFN-{gamma}, or IL-4. Macrophages were exposed to LPS (500 ng/ml), IFN-{gamma} (30 pg/ml), or IL-4 (30 pg/ml) for 8 h before RNA isolation, and semiquantitative RT-PCR was performed for mRNA encoding NK-1, NK-2, or NK-3 receptors. In addition, PCR amplification of the housekeeping gene, G3PDH, was performed to ensure that similar amounts of input RNA and similar efficiencies of RT were being compared. These studies were performed three times with similar results.

 
Although increases in the expression of NK-1 receptor mRNA seen in LPS-treated macrophages have been reported previously (43, 56), the ability of IFN-{gamma} and IL-4, stimuli associated with divergent Th1 and Th2 arms of the immune system, represents a novel observation. To further investigate the ability of IFN-{gamma} and IL-4 to elevate the expression of mRNA encoding NK-1 receptors, we have studied the effects of a range of concentrations of each agent on levels of NK-1 receptor mRNA expression. Cells were cultured for 8 h in the presence of medium alone or in the presence of 100, 30, or 10 pg/ml recombinant murine IFN-{gamma} or IL-4. Following recovery of mRNA from these cells, the expression of NK-1 receptor was analyzed using semiquantitative RT-PCR. As shown in Fig. 3Go, the levels of mRNA encoding NK-1 receptors were up-regulated by IFN-{gamma} and IL-4 in dose-dependent fashions compared with those in untreated cells (0), with maximum increases of 13- and 12-fold over unstimulated cells in IFN-{gamma}- and IL-4-treated cells, respectively, as determined by densitometric analysis. The increases in NK-1 receptor mRNA expression seen in IFN-{gamma}- or IL-4-treated cells could not be ascribed to differences in input RNA or in the efficiency of RT, as RT-PCR amplification of the housekeeping gene, G3PDH, was similar in each sample (Fig. 3Go).



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 3. Dose-dependent up-regulation of mRNA encoding NK-1 receptors in macrophages by IFN-{gamma} or IL-4. Macrophages were exposed to 100, 30, or 10 pg/ml IFN-{gamma} or 100, 30, or 10 pg/ml IL-4 for 8 h before RNA isolation, and semiquantitative RT-PCR was performed for mRNA encoding NK-1 receptors. In addition, PCR amplification of the housekeeping gene, G3PDH, was performed to ensure that similar amounts of input RNA and similar efficiencies of RT were being compared. These studies were performed three times with similar results.

 
Taken in concert, these data demonstrate that IFN-{gamma} and IL-4, stimuli associated with cell-mediated (Th1) and humoral (Th2) immune responses, respectively, elicit significant elevations in the expression of mRNA encoding NK-1 (substance P) receptors.

Development of anti-NK-1 receptor Abs

Investigations into whether the increases in NK-1 receptor mRNA levels seen in macrophages following IFN-{gamma} or IL-4 treatment were mirrored by alterations in translation of this receptor necessitated the development of specific Abs directed against this protein. Abs were raised in chickens against a synthetic peptide (KGSSRSNSKTMTESSSFYSNMLA) corresponding to the intracellular carboxyl-terminal aa 385–407 of murine NK-1 receptors. This peptide was selected due to the low degree of sequence homology with other closely related tachykinin receptors. Thus, an Ab to this region should selectively recognize the NK-1 receptor.

The peptide corresponding to the NK-1 receptor C-terminal was coupled to KLH, and chickens were immunized. A peptide-specific Ab was obtained by affinity purification. When examined by ELISA, the chicken anti-NK-1 receptor C-terminal peptide Ab reacted with the NK-1 receptor C-terminal peptide and displayed minimal reactivity to control peptides (Fig. 4Go). Affinity-purified Abs against an irrelevant peptide demonstrated no reactivity to the NK-1 receptor using this ELISA (results not shown).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 4. Anti-peptide reactivity by an Ab induced to a linear peptide sequence derived from the carboxyl terminal of the mouse NK-1 receptor. The Ab was generated in chickens immunized with this peptide conjugated to KLH. Varying dilutions of this Ab were analyzed for specific reactivity on peptide-coated wells by ELISA. The anti-NK-1 receptor C-terminal peptide Ab demonstrated a markedly higher degree of reactivity to the NK-1 receptor C-terminal peptide (SPR; •) than to the irrelevant peptides A and B ({circ} and {triangleup}). These studies were performed three times with similar results.

 
To test the specificity of the chicken anti-NK-1 receptor Ab, Western blot analysis was performed on protein isolates from the rat pancreatic acinar cell line, AR42J, and the human B lymphoblastoid cell line, IM9. These cell lines have previously been demonstrated to exclusively express authentic NK-1 receptors (46, 47). As shown in Fig. 5Go, the anti-NK-1 receptor Ab recognizes a protein derived from IM9 cells and AR42J cells with a Mr of 42 and a protein with a Mr of 46 from crude spinal cord isolates. Such observations are in agreement with previous reports of the Mr for this receptor (57) and are indistinguishable from the Mr of the murine substance P receptor calculated from its cDNA sequence (49). In addition, the Ab recognized human NK-1 receptors as expected due to the high degree of homology in this region of the protein between mouse and human species. Importantly, the presence of excess NK-1 C-terminal peptide was able to eliminate the detected band (Fig. 5Go). Furthermore, affinity-purified Abs raised in chickens against an irrelevant peptide failed to detect a protein at the Mr seen using the anti-NK-1 receptor Ab.



View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 5. The chicken anti-NK-1 receptor Ab recognizes a protein derived from IM9 cells, AR42J cells, or crude spinal cord isolates with a Mr between 42 and 46 by Western blot analysis. Protein isolates were electrophoresed on SDS-polyacrylamide gels and transferred to Immobilon-P transfer membranes. After a protein-blocking step, blots were incubated with the chicken anti-NK-1 receptor Ab (4 µg/ml) with (SPR + PEP) or without (SPR) the NK-1 C-terminal peptide (0.1 mg/ml) or with an chicken Ab directed against an irrelevant peptide (IRR). After addition of an HRP-conjugated donkey anti-chicken secondary Ab (0.8 µg/ml), bound enzyme was detected with the ECL system. These studies were performed three times with similar results.

 
To further demonstrate the specificity of the anti-NK-1 receptor Ab for the NK-1 receptor, FACS analysis was performed on AR42J and IM9 cells. Cultured IM9 and AR42J cells were permeabilized, fixed, and probed for the presence of NK-1 receptor expression using the chicken anti-NK-1 Ab (4 µg/ml). Positive cells were detected using an FITC-conjugated Ab directed against the anti-NK-1 Ab (1.5 µg/ml). Approximately 75% of both IM9 and AR42J cells were positive using the chicken anti-NK-1 receptor Ab compared with a control chicken Ab directed against an irrelevant Ab (Fig. 6Go). These results are in sharp contrast to the results obtained in normal CHO cells, which are deficient for NK-1 receptors (Fig. 6Go), where virtually no positive cells were detected using the chicken anti-NK-1 receptor Ab compared with a control chicken Ab directed against an irrelevant peptide. In addition, no significant population of positive cells was detected using the chicken anti-NK-1 receptor Ab in CHO cells transfected with either NK-2 or NK-3 receptors (0.5 ± 0.6 and 0.8 ± 0.2%, respectively; n = 3).



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 6. The chicken anti-NK-1 receptor Ab recognizes a protein in IM9 cells or AR42J cells by FACS analysis. Cultured IM9 and AR42J cells were permeabilized, fixed, and probed for the presence of NK-1 receptor expression using the chicken anti-NK-1 Ab (4 µg/ml). Positive cells were detected using an FITC-conjugated Ab directed against the anti-NK-1 Ab (1.5 µg/ml). Normal CHO cells were used as a negative control for the presence of the NK-1 receptor. This experiment was performed three times with similar results.

 
Taken in concert, these data demonstrate that the polyclonal chicken Abs directed against the intracellular carboxyl-terminal aa 385–407 of murine NK-1 receptors can be used to specifically detect the presence of NK-1 receptors by Western blot or FACS analysis.

Modulation of NK-1 receptor expression determined by Western blot analysis

We have used the chicken anti-NK-1 Ab to determine the presence of NK-1 receptor on murine peritoneal macrophages by Western blot analysis. Macrophages were isolated and cultured for 12 h before protein isolation. Protein isolates were electrophoresed on SDS-polyacrylamide gels and transferred to Immobilon-P transfer membranes. After a protein-blocking step, blots were incubated with the chicken anti-NK-1 receptor Ab (4 µg/ml) with or without excess NK-1 C-terminal peptide (0.1 mg/ml) or with an chicken Ab directed against an irrelevant peptide. After addition of a HRP-conjugated donkey anti-chicken secondary Ab (0.8 µg/ml), bound enzyme was detected with the ECL system. As shown in Fig. 7Go, Western blot analysis of protein isolates from cultured murine peritoneal macrophages probed with the chicken anti-NK-1 receptor Abs revealed a single prominent band that was identical in size to that seen in the IM9 and AR42J cell lines. These data are consistent with the presence of NK-1 (substance P) receptors in murine macrophages.



View larger version (65K):
[in this window]
[in a new window]
 
FIGURE 7. Modulation of NK-1 receptor expression in murine macrophages cultured for 12 h and determined by Western blot analysis. Protein isolates from macrophages cultured for 12 h in the absence (0) or the presence of IL-5 (1, 10, and 100 pg/ml), IL-4 (1, 10, and 100 pg/ml), IFN-{gamma} (1, 10, and 100 pg/ml), LPS (5, 50, and 500 ng/ml), or substance P (1, 10, and 100 nM) were electrophoresed on SDS-polyacrylamide gels and transferred to Immobilon-P transfer membranes. After a protein-blocking step, blots were incubated with the chicken anti-NK-1 receptor Ab (4 µg/ml). After addition of a HRP-conjugated donkey anti-chicken secondary Ab (0.8 µg/ml), bound enzyme was detected with the ECL system. Arrowheads indicate the band corresponding to the NK-1 receptor. These studies were performed three times with similar results.

 
Importantly, macrophages exposed to IL-4 (100, 10, and 1 pg/ml), IFN-{gamma} (100, 10, and 1 pg/ml), or LPS (500, 50, and 5 ng/ml) for 12 h before FACS analysis displayed significant increases in the levels of NK-1 protein expression over those seen in untreated cells (Fig. 7Go). Band intensities, measured as mean arbitrary densitometric units corrected for background levels, were significantly different (p < 0.05) for cells treated with 100 and 10 pg/ml IL-4 for 12 h over those in unstimulated cells (96 ± 5 and 93 ± 6 vs 51 ± 4 respectively; n = 3). Band intensities were significantly different (p < 0.05) for cells treated with 100, 10, and 1 pg/ml IFN-{gamma} for 12 h over unstimulated cells (88 ± 15, 78 ± 15, and 90 ± 15 vs 45 ± 16, respectively; n = 3). Band intensities were significantly different (p < 0.05) for cells treated with 100, 10, and 1 pg/ml LPS for 12 h over unstimulated cells (96 ± 9, 105 ± 7, and 86 ± 9 vs 47 ± 8, respectively; n = 3). As such, these findings are in accord with the increases in mRNA expression of the NK-1 receptor shown in Figs. 2Go and 3Go. In contrast, treatment of macrophages with neither IL-5 (100, 10, and 1 pg/ml) nor substance P agonist (100, 10, and 1 nM) elicited significant increases in the population of cells expressing NK-1 receptors in this time frame (Fig. 7Go).

Taken in concert, these data suggest that NK-1 receptors are expressed in resting cultured murine peritoneal macrophages, and that the level of expression of this receptor can be increased following exposure to the bacterial product LPS and by exposure to the endogenous factors IFN-{gamma} and IL-4, stimuli associated with cell-mediated (Th1) and humoral (Th2) immune responses, respectively. Although these agents can up-regulate both the level of mRNA encoding the NK-1 receptor and the level of expression of this protein, it is apparent that the increases in the levels of mRNA are greater than those seen for the NK-1 receptor protein. It is likely that this represents the presence of significant post-translational regulation for this protein product.

When macrophages were cultured for 24 h before protein isolation the levels of NK-1 protein expression in untreated cultures was significantly increased over that seen at 12 h (Fig. 8Go). In contrast to the elevated levels of NK-1 receptor expression seen at 12 h, treatment with either LPS or IFN-{gamma} failed to elicit increases in levels of NK-1 receptor expression over the increased levels seen in untreated cells, and IL-5 again failed to elicit any significant increase (Fig. 8Go). However, IL-4 treatment resulted in elevated NK-1 receptor expression in macrophage isolates (Fig. 8Go). Band intensities, measured as mean arbitrary densitometric units corrected for background levels, were significantly different (p < 0.05) for cells treated with 100, 10, or 1 pg/ml IL-4 for 24 h compared with those in unstimulated cells (111 ± 19, 108 ± 19, and 101 ± 17 vs 44 ± 22, respectively; n = 3). In addition and in contrast to results obtained at 12 h, substance P agonist proved to be a significant stimulus for the expression of its own receptor after exposure of cells to this agonist for 24 h (Fig. 8Go). Band intensities were significantly different (p < 0.05) for cells treated with 100 nM substance P for 24 h over unstimulated cells (100 ± 16 vs 68 ± 16, respectively; n = 3).



View larger version (77K):
[in this window]
[in a new window]
 
FIGURE 8. Modulation of NK-1 receptor expression in murine macrophages cultured for 24 h and determined by Western blot analysis. Protein isolates from macrophages cultured for 24 h in the absence (0) or the presence of IL-5 (1, 10, and 100 pg/ml), IL-4 (1, 10, and 100 pg/ml), IFN-{gamma} (1, 10, and 100 pg/ml), LPS (5, 50, and 500 ng/ml), or substance P (1, 10, and 100 nM) were electrophoresed on SDS-polyacrylamide gels and transferred to Immobilon-P transfer membranes. After a protein-blocking step, blots were incubated with the chicken anti-NK-1 receptor Ab (4 µg/ml). After addition of a HRP-conjugated donkey anti-chicken secondary Ab (0.8 µg/ml), bound enzyme was detected with the ECL system. Arrowheads indicate the band corresponding to the NK-1 receptor. These studies were performed three times with similar results.

 
Taken in concert, these data suggest that extended culture of murine macrophages leads to the induction of NK-1 substance P receptor expression in this cell type. Despite the elevated level of NK-1 receptor protein expression in cells cultured for 24 h, IL-4 proved to be a potent stimulus for NK-1 receptor expression. In addition, prolonged treatment with substance P can itself elicit increases in the level of NK-1 (substance P) receptor expression.

Modulation of NK-1 receptor expression determined by FACS analysis

To further investigate the presence of NK-1 receptors in murine peritoneal macrophages we have used immunofluorescent techniques to measure the number of NK-1-positive cells using the anti-NK-1 receptor Ab and a fluorochrome-linked anti-chicken detection Ab. Macrophages were obtained and cultured for 12 h before FACS analysis. As shown in Fig. 9Go, 29 ± 3% (n = 3) of untreated cells were positive when probed using the anti-NK-1 receptor. To control for the specificity of binding of this Ab, an irrelevant chicken IgY was employed. In contrast to the results obtained using the anti-NK-1 receptor Ab, cells failed to demonstrate a significant number of positively staining cells (<1%; Fig. 9Go).



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 9. Modulation of NK-1 receptor expression in murine macrophages cultured for 12 h and determined by FACS analysis. Immunofluorescence analysis were performed to determine the population of NK-1 receptor-positive macrophages cultured for 12 h in the absence (resting) or the presence of IL-5 (10 pg/ml), IL-4 (10 pg/ml), IFN-{gamma} (10 pg/ml), LPS (50 ng/ml), or substance P (10 nM). Macrophages were then permeabilized, fixed, and probed for the presence of NK-1 receptor expression using the chicken anti-NK-1 Ab. Positive cells were detected using an FITC-conjugated Ab directed against the anti-NK-1 Ab. This experiment was performed three times with similar results.

 
Importantly, macrophages exposed to IL-4 (10 pg/ml), IFN-{gamma} (10 pg/ml), or LPS (50 ng/ml) for 12 h before FACS analysis displayed significant increases in the numbers of positive cells over those seen in untreated cells. Fig. 9Go shows a representative experiment. On the average, 48 ± 5, 39 ± 4, and 42 ± 4% of macrophages were positive for NK-1 receptors in IL-4-, IFN-{gamma}-, and LPS-treated cells, respectively (n = 3). These levels represent significant increases over unstimulated cells (p < 0.05). In contrast, treatment of macrophages with either IL-5 (10 pg/ml) or substance P agonist (10 nM) failed to elicit significant increases in the population of cells expressing NK-1 receptors (Fig. 9Go). Indeed, the number of positive cells following IL-5 treatment was significantly lower than that in untreated cells (16 ± 3 vs 29 ± 3%; p < 0.05).

Taken together, these data suggest that murine macrophages cultured for 12 h express NK-1 substance P receptors, and that IL-4, IFN-{gamma}, and LPS promote the expression of these receptors on macrophages.

When macrophages were cultured for 24 h, the proportion of NK-1-positive cells in untreated cultures markedly increased over that seen at 12 h (Fig. 10Go). On the average, 62 ± 8% (n = 3) of untreated cells proved to be positive for the NK-1 receptor at 24 h postisolation. In contrast to the elevated population of positive cells seen at 12 h, treatment with either IFN-{gamma} or LPS failed to elicit increases in the NK-1-positive population over the increased basal levels in untreated cells (62 ± 6 and 60 ± 9%, respectively; n = 3), and IL-5 again failed to elicit any increase (64 ± 11; n = 3; Fig. 10Go). However, IL-4 treatment resulted in a higher percentage of NK-1 receptor-positive cells than unstimulated cultures, with 83 ± 8% of cells being positive (p < 0.05; n = 3; Fig. 10Go). In contrast to results obtained at 12 h, substance P agonist proved to be a significant stimulus for the expression of its own receptor, with 71 ± 13% of macrophages expressing the NK-1 receptor after 24-h exposure to this agonist (p < 0.05; n = 3; Fig. 10Go).



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 10. Modulation of NK-1 receptor expression in murine macrophages cultured for 24 h and determined by FACS analysis. Immunofluorescence analysis were performed to determine the population of NK-1 receptor-positive macrophages cultured for 24 h in the absence (resting) or the presence of IL-5 (10 pg/ml), IL-4 (10 pg/ml), IFN-{gamma} (10 pg/ml), LPS (50 ng/ml), or substance P (10 nM). Macrophages were then permeabilized, fixed, and probed for the presence of NK-1 receptor expression using the chicken anti-NK-1 Ab. Positive cells were detected using an FITC-conjugated Ab directed against the anti-NK-1 Ab. This experiment was performed three times with similar results.

 
Taken in concert, these data suggest that extended culture of murine macrophages leads to the induction of NK-1 substance P receptor expression in this cell type. Despite the elevated expression of NK-1 receptors in cells cultured for 24 h, IL-4 again proved to be a potent stimulus for NK-1 receptor expression. In addition, treatment with substance P can itself elicit increases in the number of cells expressing NK-1 substance P receptors.

Modulation of NK-1 receptor expression determined by radiolabeled substance P binding

The use of total cellular proteins for Western blots and the permeabilization of cells before flow cytometry analyses do not differentiate between cell surface and intracellular receptors. To quantify expression of NK-1 receptors at the cell surface we have measured binding of radiolabeled substance P to macrophages cultured in the presence or the absence of IL-4 or IFN-{gamma}. As shown in Fig. 11Go, macrophages cultured with either IL-4 (1 and 10 pg/ml) or IFN-{gamma} (1 and 10 pg/ml) for 24 h showed significantly (p < 0.05) higher specific binding of radiolabeled substance P than that seen for unstimulated cells. These data are consistent with the results obtained using Western blot and FACS analysis, and suggest that the increased levels of NK-1 receptor protein expression elicited by IL-4 and IFN-{gamma} translate into a functional difference in the ability of macrophages to bind substance P.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 11. [125I]Substance P binding to macrophages. Macrophages (1 x 107/well) were cultured with or without IL-4 (1 and 10 pg/ml) or IFN-{gamma} (1 and 10 pg/ml) for 24 h. Cells were then incubated with radiolabeled substance P (0.5 µCi/ml) for 45 min at 4°C in PBS containing Na+ azide. Specific counts per minute were defined as those blockable with a 1000-fold excess of unlabeled substance P agonist. Results are shown as the mean of three experiments ± SEM.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous reports have suggested that macrophages express tachykinin receptors, although it has been difficult to quantify expression at the protein level and to quantify increases following macrophage activation. Radioreceptor assays have been used to demonstrate specific binding sites for substance P on guinea pig (17), mouse (29), and human (30, 35) macrophages. These receptor binding sites were identified as NK-1 receptors by the use of specific competitors and the high affinity nature of the interaction. However, the technical difficulties inherent to binding studies are well recognized (58), and internalization of the receptor following ligand binding may also complicate such investigations. Indeed, rapid agonist-induced endocytosis of the substance P receptor has been reported both in vitro and in vivo (59, 60, 61), although it should be noted that such internalization presumably does not affect radioreceptor assays performed at 4°C and in the presence of sodium azide. The interpretation of results from radioreceptor assays is further complicated by reports that substance P can bind to numerous nonneurokinin receptors (62, 63, 64, 65, 66), albeit with reduced affinity, leading to the possibility of false positives in binding assays.

The presence of functional substance P receptors on macrophages has also been demonstrated using in vitro cultures of these cells (16, 18, 21, 29, 36, 37, 38, 39). These studies have demonstrated the NK-1 or NK-2 receptor-mediated nature of responses using specific antagonists to block activity and using concentrations of tachykinins at or near the dissociation constant for these receptors. Furthermore, the presence of functional substance P receptors on macrophages appears to be species conserved, as evidenced by the fact that both rodent and human cells respond to tachykinins.

More recently, molecular biology and protein chemistry techniques have been employed to demonstrate the expression of substance P receptors on macrophages or monocytes. RT-PCR and in situ hybridization have been used to identify NK-1 receptor mRNA expression in macrophages and monocytes (29, 40, 41, 42, 43). The translation of substance P receptor mRNA has been demonstrated using polyclonal Abs generated against cytoplasmic C-terminal peptide (42, 67, 68, 69) or an extension of the C-terminus segment (70). Taken together, these studies clearly demonstrate that leukocytes, and in particular macrophages, express authentic receptors for substance P.

Recent studies have confirmed the importance of substance P-mediated macrophage activation using in vivo models of infectious disease or inflammation. Our laboratory has demonstrated that antagonism of substance P/substance P receptor interactions limits a protective host response against oral inoculations of Salmonella (29). Blum and co-workers (71, 72) have demonstrated that substance P regulates macrophage expression of somatostatin (71), and that this neuropeptide is required for normal granulomatous responses in murine schistosomiasis (72). In addition, NK-1 and NK-2 antagonists have been shown to limit the reactivity of alveolar macrophages in a model of airway inflammation (73). Taken together, results from these diverse model systems point to a common role for substance P/substance P receptor interactions as an important determinant in optimal macrophage-mediated host responsiveness.

Costimulation of T lymphocytes by macrophages serves to define cell-mediated and humoral immune responses and depends upon the production of soluble factors and expression of cell surface molecules. In the present work investigations were undertaken to determine whether the level of substance P receptor expression by macrophages may be modulated and thereby identify a novel potential component in the positive amplification loops characteristic of cell-cell interactions within the immune system. Surprisingly, both IL-4 and IFN-{gamma} were found to up-regulate the levels of mRNA encoding the NK-1 receptor and the expression of this protein in macrophages. We had not anticipated that both IFN-{gamma} and IL-4 would have similar effects on NK-1 receptor expression due to the widely differing effects these cytokines exert on macrophage function and the propensity of these cytokines to support different arms of the immune response. IFN-{gamma} supports the development of Th1 cells and optimal cell-mediated immune responses (for review, see Ref. 74). It is tempting to suggest a scenario in which early release of substance P augments IL-12 secretion by macrophages (29). Released IL-12 would, in turn, induce IFN-{gamma} production by T lymphocytes that can increase the expression of the NK-1 receptor on macrophages. Hence, the influence of substance P on macrophages may then be enhanced and represent a positive feedback loop between macrophages and T lymphocytes that augments the cell-mediated immune response.

IL-4 supports the development of Th2 cells and optimal humoral immune responses (for review, see Ref. 74). Based on the present work, this cytokine also up-regulates NK-1 receptor expression by macrophages. At present, it is unclear how ligation of the substance P receptor on macrophages may further enhance Th2 lymphocyte activation. However, it is clear that substance P/substance P receptor interactions can modulate Ab responses (reviewed in Ref. 75). Speculatively, IL-4-induced substance P receptor expression could heighten the responsiveness of macrophages to this neuropeptide, providing additional Ag presentation or costimulation for T lymphocytes. The nature of the substance P-induced macrophage activation event, which would support humoral immune responses, is presently being investigated. Furthermore, it is clear that substance P might also have direct effects on T or B lymphocytes (reviewed in Ref. 75), which could also influence these regulatory circuits.

Inherent in the observation that IL-4 or IFN-{gamma} can up-regulate NK-1 receptor expression by macrophages is the possibility that substance P can lend further support to either cell-mediated or humoral immune responses. Thus, the nature of the infection or immunogen must be considered when attempting to determine how substance P contributes to an immune response. If the host responds to a particular challenge by eliciting a cell-mediated immune response, our results suggest that substance P/substance P receptor interactions may augment such a pathway regardless of whether the host response is protective. Alternatively, if the host responds by generating a humoral response, substance P may again augment the response. Thus, the results presented here do not support substance P/substance P receptor interactions on macrophages as a Th1/Th2 switching mechanism, but, rather, as a means of supporting the direction of an immune response dictated by other factors. In vivo studies will be required to prove the dual nature of substance P-mediated immune responses.

In the present study we have employed methods to investigate the expression of both the levels of mRNA encoding tachykinin receptors and the expression of the substance P receptor protein. It should be noted that mRNA analysis of neurokinin receptor subtypes in macrophages in the present study does not rule out the presence of NK-2 receptors on macrophages. We have observed modest cytokine-induced increases in NK-2 receptor mRNA expression in some of the studies performed, and this can be seen in Fig. 3Go. However, it was clear that NK-1 receptor mRNA expression increased significantly and rapidly in response to the exogenous stimuli used here. As such, we focused our attention on the level of expression of the NK-1 receptor protein in macrophages.

We describe here the generation of specific Abs directed against the C-terminal of the NK-1 receptor, and we have used these Abs to demonstrate the presence of authentic substance P receptors in cultured murine macrophages using Western blot analysis and immunofluorescence techniques. There are several important methodological points in the present studies that should be noted. First, chickens were used as hosts for producing the specific Abs for several reasons. Chicken IgY Abs do not bind to mammalian Fc receptors (76), thereby decreasing nonspecific interactions in our assays. In addition, substance P receptor sequences are largely conserved among mammalian species, and so the use of chicken Abs results in increased sensitivity as well as decreased background in immunological assays due to the phylogenetic differences between avian and mammalian species (76). It is of note that the anti-substance P receptor Ab reacts with murine (cell line AR42J) as well as human (IM-9 cells) substance P receptors (Fig. 5Go) as predicted by the high degree of homology between these two species at this region of the receptor. Second, it is clear that prolonged culture of normal unstimulated macrophages results in a pronounced up-regulation of NK-1 receptor expression (Figs. 9Go and 10Go). It is presently unclear how this induction occurs, although it is possible that prolonged adherence to plastic leads to activation of these cells. This finding should therefore be a consideration in future studies investigating tachykinin receptor expression in this cell type that involve lengthy periods in culture.

In summary, the present study provides strong evidence for the modulation of NK-1 receptor expression by macrophages in response to IL-4 and IFN-{gamma}. These studies support the idea that this receptor can be induced during immune responses and that both cell-mediated and humoral responses could be affected. The influence of lymphocyte-derived cytokines on macrophage expression of substance P receptors also suggests that novel amplification loops might exist between macrophages and other leukocytes. If true, such speculations would place substance P/substance P receptor interactions as potential contributors in the established pathways of immune activation that involve costimulation of APC and T lymphocytes.


    Footnotes
 
1 This work is supported by Grant AI32976 (to K.B.) from the National Institute of Allergy and Infectious Diseases. Back

2 Address correspondence and reprint requests to Dr. Kenneth L. Bost, Department of Biology, 9201 University City Boulevard, University of North Carolina, Charlotte, NC 28223. Back

3 Abbreviations used in this paper: KLH, keyhole limpet hemocyanin; ECL, enhanced chemiluminescence. Back

Received for publication December 20, 1999. Accepted for publication April 21, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ottaway, C. A.. 1991. Neuroimmunomodulation in the intestinal mucosa. Gastroenterol. Clin. North Am. 20:511.[Medline]
  2. Bellinger, D. L., D. Lorton, S. Y. Felten, D. L. Felten. 1992. Innervation of lymphoid organs and implications in development, aging, and autoimmunity. Int. J. Immunopharmacol. 14:329.[Medline]
  3. Stead, R. H.. 1992. Innervation of mucosal immune cells in the gastrointestinal tract. Regul. Immunol. 4:91.
  4. Madden, K. S., D. L. Felten. 1995. Experimental basis for neural-immune interactions. Physiol. Rev. 75:77.[Free Full Text]
  5. Helme, R. D., A. Eglezos, A. G. W. Dandie, P. V. Andrews, R. L. Boyd. 1987. The effect of substance P on the regional lymph node antibody response to antigenic stimulation in capsaicin-pretreated rats. J. Immunol. 139:3470.[Abstract]
  6. Girolomoni, G., R. E. Tigalaar. 1990. Capsaicin-sensitive primary sensory neurons are potent modulators of murine delayed-type hypersensitivity reactions. J. Immunol. 145:1105.[Abstract]
  7. Nilsson, G., K. Alving, S. Ahlstedt. 1991. Effects on immune responses in rats after neuromanipulation with capsaicin. Int. J. Immunopharmacol. 13:21.[Medline]
  8. Felten, D. L., S. Y. Felten, D. L. Bellinger, D. Lorton. 1992. Noradrenergic and peptidergic innervation of secondary lymphoid organs: role in experimental rheumatoid arthritis. Eur. J. Clin. Invest. 1:37.
  9. Kruszewska, B., S. Y. Felten, J. A. Moynihan. 1995. Alterations in cytokine and antibody production following chemical sympathectomy in two strains of mice. J. Immunol. 155:4613.[Abstract]
  10. Kubera, M., B. Pawlicki, A. Skowron-Cendrzak, J. Shani. 1997. Effect of sciatic denervation on cell-mediated immunity. Int. J. Immunopharmacol. 19:25.[Medline]
  11. Kohm, A. P., V. M. Sanders. 1999. Suppression of antigen-specific Th2 cell-dependent IgM and IgG1 production following norepinephrine depletion in vivo. J. Immunol. 162:5299.[Abstract/Free Full Text]
  12. Lui, Y., E. Ragaa, Z. Li, L. Nuortio, A. Mustafa, M. Bakhiet. 1999. Interferon-{gamma} and interleukin-12 genes are preferentially expressed during early experimental African trypanosomiasis and suppressed by denervation of the spleen. Scand. J. Immunol. 50:485.[Medline]
  13. Felten, D. L., K. D. Ackerman, S. J. Wiegand, and S. Y. Felten. 1987. Noradrenergic sympathetic innervation of the spleen. I. Nerve fibers associate with lymphocytes and macrophages in specific compartments of the splenic white pulp. J. Neurosci. Res. 18:28, 118.
  14. Lorton, D., D. L. Bellinger, S. Y. Felten, D. L. Felten. 1991. Substance P innervation of spleen in rats: nerve fibers associate with lymphocytes and macrophages in specific compartments of the spleen. Brain Behav. Immun. 5:29.[Medline]
  15. Muller, S., E. Weihe. 1991. Interrelation of peptidergic innervation with mast cells and ED1-positive cells in rat thymus. Brain Behav. Immun. 5:55.[Medline]
  16. Hartung, H. P., K. V. Toyka. 1983. Activation of macrophages by substance P: induction of oxidative burst and thromboxane release. Eur. J. Pharmacol. 89:301.[Medline]
  17. Hartung, H. P., K. Wolters, K. V. Toyka. 1986. Substance P: binding properties and studies on cellular responses in guinea pig macrophages. J. Immunol. 136:3856.[Abstract]
  18. Lotz, M., J. H. Vaughn, D. A. Carson. 1988. Effect of neuropeptides on production of inflammatory cytokines by human monocytes. Science 241:1218.[Abstract/Free Full Text]
  19. Laurenzi, M. A., M. A. A. Persson, C. J. Dalsgaard, A. Haegerstrand. 1990. The neuropeptide substance P stimulates production of interleukin 1 in human blood monocytes: activated cells are preferentially influenced by the neuropeptide. Scand. J. Immunol. 31:529.[Medline]
  20. Kincy-Cain, T., K. L. Bost. 1997. Substance P-induced IL-12 production by murine macrophages. J. Immunol. 158:2334.[Abstract]
  21. Ho, W. Z., G. Stavropoulos, J. P. Lai, B. F. Hu, V. Magafa, S. Anagnostides, S. D. Douglas. 1998. Substance P C-terminal octapeptide analogues augment tumor necrosis factor-{alpha} release by human blood monocytes and macrophages. J. Neuroimmunol. 82:126.[Medline]
  22. Marriott, I., K. L. Bost. 1998. Substance P diminishes lipopolysaccharide and interferon-{gamma} induced TGF-ß1 production by cultured murine macrophages. Cell. Immunol. 183:113.[Medline]
  23. Levine, J. D., R. Clark, M. Devor, M. Helms, M. A. Moskowitz. 1984. Intraneuronal substance P contributes to the severity of experimental arthritis. Science 226:547.[Abstract/Free Full Text]
  24. Koch, T. R., J. A. Carney, and V. L. W. Go. 1987. Distribution and quantitation of gut neuropeptides in normal intestine and inflammatory bowel diseases. Dig. Dis. Sci. 32, 369.
  25. Tissot, M., P. Pradelles, J. P. Giroud. 1988. Substance-P-like levels in inflammatory exudates. Inflammation 12:25.[Medline]
  26. Schiogolev, S. A., E. J. Goetzl, W. J. Urba, D. L. Longo. 1989. Appearance of neuropeptides in ascitic fluid after peritoneal therapy with interleukin-2 and lymphokine-activated killer cells for intraabdominal malignancy. J. Clin. Immunol. 9:169.[Medline]
  27. O’Byrne, E. M., V. Blancuzzi, D. E. Wilson, M. Wong, A. Y. Jeng. 1990. Elevated substance P and accelerated cartilage degradation in rabbit knees injected with interleukin-1 and tumor necrosis factor. Arthritis Rheum. 33:1023.[Medline]
  28. Bost, K. L.. 1995. Inducible preprotachykinin mRNA expression in mucosal lymphoid organs following oral immunization with Salmonella. J. Neuroimmunol. 62:59.[Medline]
  29. Kincy-Cain, T., K. L. Bost. 1996. Increased susceptibility of mice to Salmonella infection following in vivo treatment with the substance P antagonist, Spantide II. J. Immunol. 157:255.[Abstract]
  30. Mantyh, P. W., M. Catton, J. E. Maggio, S. R. Vigna. 1991. Alterations in receptors for sensory neuropeptides in human inflammatory bowel disease. Adv. Exp. Med. Biol. 298:253.[Medline]
  31. Mantyh, C. R., J. E. Maggio, P. W. Mantyh, S. R. Vigna, T. N. Pappas. 1996. Increased substance P receptor expression by blood vessels and lymphoid aggregates in Clostridium difficile-induced pseudomembranous colitis. Dig. Dis. Sci. 41:614.[Medline]
  32. Bozic, C. R., B. Lu, U. E. Hopken, C. Gerard, N. P. Gerard. 1996. Neurogenic amplification of immune complex inflammation. Science 273:1722.[Abstract/Free Full Text]
  33. Cao, Y. Q., P. W. Mantyh, E. J. Carlson, A. M. Gillespie, C. J. Epstein, A. I. Basbaum. 1998. Primary afferent tachykinin are required to experience moderate to intense pain. Nature 392:390.[Medline]
  34. Gerard, N. P., L. Bao, H. Ziao-Ping, C. Gerard. 1993. Molecular aspects of the tachykinin receptors. Regul. Pept. 43:21.[Medline]
  35. Lucey, D. R., J. M. Novak, V. R. Polonis, Y. Liu, S. Gartner. 1994. Characterization of substance P binding to human monocytes/macrophages. Clin. Diag. Lab. Immunol. 1:330.[Abstract/Free Full Text]
  36. Brunelleschi, S., L. Vanni, F. Ledda, A. Giotti, C. A. Maggi, R. Fantozzi. 1990. Tachykinins activate guinea-pig alveolar macrophages: involvement of NK2 and NK1 receptors. Br. J. Pharmacol. 100:417.[Medline]
  37. Mantyh, C. R., S. R. Vigna, J. E. Maggio, P. W. Mantyh, R. R. Bollinger, T. N. Pappas. 1994. Substance P binding sites on intestinal lymphoid aggregates and blood vessels in inflammatory bowel disease correspond to authentic NK-1 receptors. Neurosci. Lett. 178:255.[Medline]
  38. Murris-Espin, M., E. Pinelli, B. Pipy, P. Leophonte, A. Didier. 1995. Substance P and alveolar macrophages: effects on oxidative metabolism and eicosanoid production. Allergy 50:334.[Medline]
  39. Zhu, G. F., C. Chancellor-Freeland, A. S. Berman, R. Kage, S. E. Leeman, D. I. Beller, P. H. Black. 1996. Endogenous substance P mediates cold water stress-induced increase in interleukin-6 secretion from peritoneal macrophages. J. Neurosci. 16:3745.[Abstract/Free Full Text]
  40. Bai, T. H., D. Zhou, T. Weir, B. Walker, H. Hegele, S. Hayashi, K. McKay, G. P. Bondy, T. Fong. 1995. Substance P (NK1)- and neurokinin A (NK2)-receptor gene expression in inflammatory airway diseases. Am. J. Physiol. 269:L309.[Abstract/Free Full Text]
  41. Ho, W. Z., J. P. Lai, X. H. Zhu, M. Uvaydova, S. D. Douglas. 1997. Human monocytes and macrophages express substance P and neurokinin-1 receptor. J. Immunol. 159:5654.[Abstract]
  42. Goode, T., J. O’ Connell, C. Sternini, P. Anton, H. Wong, G. C. O’Sullivan, J. K. Collins, F. Shanahan. 1998. Substance P (neurokinin-1) receptor is a marker of human mucosal but not peripheral mononuclear cells: molecular quantitation and localization. J. Immunol. 161:2232.[Abstract/Free Full Text]
  43. Germanpre, P. R., G. R. Bullock, B. N. Lambrecht, V. Van De Velde, W. H. Luyten, G. F. Joos, R. A. Pauwels. 1999. Presence of substance P and neurokinin 1 receptors in human sputum macrophages and U-937 cells. Eur. Respir. J. 14:776.[Abstract/Free Full Text]
  44. Bost, K. L., M. J. Mason. 1995. Thapsigargin and cyclopiazonic acid initiate rapid and dramatic increases of IL-6 mRNA expression and IL-6 secretion in murine peritoneal macrophages. J. Immunol. 155:285.[Abstract]
  45. Cascieri, M. A., R.-R. C. Huang, T. M. Fong, A. H. Chueng, S. Sadowski, E. Ber, C. D. Strader. 1992. Determination of the amino acid residues in substance P conferring selectivity and specificity for the rat neurokinin receptors. Mol. Pharmacol. 41:1096.[Abstract]
  46. Payan, D. G., J. P. McGillis, M. L. Organist. 1986. Binding characteristics and affinity labeling of protein constituents of the human IM9 lymphoblast receptor for substance P. J. Biol. Chem. 261:14321.[Abstract/Free Full Text]
  47. Fukuhara, S., M. Shimizu, H. Matsushima, H. Mukai, E. Munekata. 1998. Signaling pathways via NK1 receptors and their desensitization in an AR42J cell line. Peptides. 19:1349.[Medline]
  48. Bost, K. L., J. C. Clements. 1995. In vivo induction of interleukin-12 mRNA expression after oral immunization with Salmonella dublin or the B subunit of Escherichia coli heat-labile enterotoxin. Infect. Immun. 63:1076.[Abstract]
  49. Sundelin, J. B., D. M. Provvedini, C. R. Wahlestedt, H. Laurell, J. S. Pohl, P. A. Peterson. 1992. Molecular cloning of the murine substance K and substance P receptor genes. Eur. J. Biochem. 203:625.[Medline]
  50. Shigemoto, R., Y. Yokota, K. Tsuchida, S. Nakanishi. 1990. Cloning and expression of rat neuromedin K receptor cDNA. J. Biol. Chem. 265:623.[Abstract/Free Full Text]
  51. Chong, C., K. L. Bost, J. D. Clements. 1996. Differential production of interleukin-12 mRNA by murine macrophages in response to viable or killed Salmonella spp. Infect. Immun. 64:1154.[Abstract]
  52. Pascual, D. W., K. L. Bost. 1989. Anti-peptide antibodies recognize anti-substance P antibodies in an idiotype fashion. Pept. Res. 2:207.[Medline]
  53. Pascual, D. W., K. L. Bost. 1990. 5'-3' and 3'-5' translation of the same RNA results in hydropathically similar peptides that are antigentically similar. Immunol. Invest. 19:421.[Medline]
  54. Sundberg, L., J. Porath. 1974. Preparation of adsorbents for bispecific affinity chromatography. I. Attachment of group-containing ligands to insoluble polymers by means of bifunctional oxiranes. J. Chromatogr. 90:87.[Medline]
  55. Sivam, S. P., J. E. Krause. 1992. Tachykinin systems in the spinal cord and basal ganglia: influence of neonatal capsaicin treatment or dopaminergic intervention on levels of peptides, substance P-encoding mRNAs, and substance P receptor mRNA. J. Neurochem. 59:2278.[Medline]
  56. Bost, K. L., S. A. Breeding, D. W. Pascual. 1992. Modulation of the mRNAs encoding substance P and its receptor in rat macrophages by LPS. Regul. Immunol. 4:105.
  57. Li, Y.-M., M. Marnerakis, E. R. Stimson, J. E. Maggio. 1995. Mapping peptide-binding domains of the substance P (NK-1) receptor from P388D1 cells with photolabile agonists. J. Biol. Chem. 270:1213.[Abstract/Free Full Text]
  58. Roberts, A. I., J. Taunk, E. C. Ebert. 1992. Human lymphocytes lack substance P receptors. Cell. Immunol. 141:457.[Medline]
  59. Grady, E. F., A. M. Garland, P. D. Gamp, M. Lovett, D. G. Payan, N. W. Bunnett. 1995. Delineation of the endocytic pathway of substance P and its seven-transmembrane domain NK1 receptor. Mol. Biol. Cell. 6:509.[Abstract]
  60. Garland, A. M., E. F. Grady, D. G. Payan, S. R. Vigna, N. Bunnett. 1994. Agonist-induced internalization of the substance P (NK1) receptor expressed in epithelial cells. Biochem. J. 303:177.
  61. Mantyh, P. W., C. J. Allen, J. R. Ghilardi, S. D. Rogers, C. R. Mantyh, H. Liu, A. I. Basbaum, S. R. Vigna, J. E. Maggio. 1995. Rapid endocytosis of a G-protein-coupled receptor: substance P-evoked internalization of its receptor in the rat striatum in vivo. Proc. Natl. Acad. Sci. USA 92:2622.[Abstract/Free Full Text]
  62. Marasco, W. A., H. J. Showell, E. L. Becker. 1981. Substance P binds to the formylpeptide chemotaxis receptor on the rabbit neutrophil. Biochem. Biophys. Res. Commun. 99:1065.[Medline]
  63. Jensen, R. T., D. H. Coy. 1991. Progress in the development of potent bombesin receptor antagonists. Trends Pharmacol. Sci. 12:13.[Medline]
  64. Joslin, G., J. E. Krause, A. D. Hershey, S. P. Adams, R. J. Fallon, D. H. Perlmutter. 1991. Amyloid-ß peptide, substance P, and bombesin bind to the serpin-enzyme complex receptor. J. Biol. Chem. 266:21187.
  65. Jeurissen, F., A. Kavelaars, M. Korstjens, D. Broeke, R. A. Franklin, E. W. Gelfand, C. J. Heijnen. 1994. Monocytes express a non-neurokinin substance P receptor that is functionally coupled to MAP kinase. J. Immunol. 152:2987.[Abstract]
  66. Kavelaars, A., D. Broeke, F. Jeurissen, J. Kardux, A. Meijer, R. Franklin, E. W. Gelfand, C. J. Heijnen. 1994. Activation of human monocytes via a non-neurokinin substance P receptor that is coupled to Gi protein, calcium, phospholipase D, MAP kinase, and IL-6 production. J. Immunol. 153:3691.[Abstract]
  67. Gilbert, M. S., N. W. Bunnett, D. G. Payan. 1992. Antibodies to the rat substance P receptor: production and characterization. Cell. Mol. Neurobiol. 12:529.[Medline]
  68. Vigna, S. R., J. J. Bowden, D. M. McDonald, J. Fisher, A. Okamoto, D. C. McVey, D. G. Payan, N. W. Bunnett. 1994. Characterization of antibodies to the rat substance P (NK-1) receptor and to a chimeric substance P receptor expressed in mammalian cells. J. Neurosci. 14:834.[Abstract]
  69. Kaltreider, H. B., S. Ichikawa, P. K. Byrd, D. A. Ingram, J. L. Kishiyama, S. P. Sreedharan, M. L. Warnock, J. M. Beck, E. J. Goetzl. 1997. Upregulation of neuropeptides and neuropeptide receptors in a murine model of immune inflammation in lung parenchyma. Am. J. Respir. Cell. Mol. Biol. 16:133.[Abstract]
  70. Shigemote, R., Y. Nakaya, S. Nomura, R. Ogawa-Meguro, H. Ohishi, T. Kaneko, S. Nakanishi, N. Mizuno. 1993. Immunocytochemical localization of rat substance P receptor in the striatum. Neurosci. Lett. 153:157.[Medline]
  71. Blum, A. M., D. E. Elliott, A. Metwali, J. Li, K. Qadir, J. V. Weinstock. 1998. Substance P regulates somatostatin expression in inflammation. J. Immunol. 161:6316.[Abstract/Free Full Text]
  72. Blum, A. M., A. Metwali, M. Kim-Miller, J. Li, K. Qadir, D. E. Elliott, B. Lu, Z. Fabry, N. Gerard, J. V. Weinstock. 1999. The substance P receptor is necessary for a normal granulomatous response in murine Schistosomiasis mansoni. J. Immunol. 162:6080.[Abstract/Free Full Text]
  73. Biochot, E., N. Germain, Z. Emonds-Alt, C. Advenier, V. Lagente. 1998. Effects of SR 140333 and SR 48968 on antigen and substance P-induced activation of guinea-pig alveolar macrophages. Clin Exp. Allergy. 28:1299.[Medline]
  74. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
  75. Bost, K. L., D. W. Pascual. 1992. Substance P: a late acting B lymphocyte differentiation co-factor. Am. J. Physiol. 262:C537.[Abstract/Free Full Text]
  76. Larsson, A., R. M. Balow, T. L. Lindahl, P. O. Forsberg. 1993. Chicken antibodies: taking advantage of evolution: a review. Poultry Sci. 72:1807.[Medline]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
N. J. Stevenson, M. R. Addley, E. J. Ryan, C. R. Boyd, H. P. Carroll, V. Paunovic, C. A. Bursill, H. C. Miller, K. M. Channon, A. E. McClurg, et al.
CCL11 blocks IL-4 and GM-CSF signaling in hematopoietic cells and hinders dendritic cell differentiation via suppressor of cytokine signaling expression
J. Leukoc. Biol., February 1, 2009; 85(2): 289 - 297.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Blum, T. Setiawan, L. Hang, K. Stoyanoff, and J. V. Weinstock
Interleukin-12 (IL-12) and IL-23 Induction of Substance P Synthesis in Murine T Cells and Macrophages Is Subject to IL-10 and Transforming Growth Factor {beta} Regulation
Infect. Immun., August 1, 2008; 76(8): 3651 - 3656.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Sun, R. D. Ramnath, L. Zhi, R. Tamizhselvi, and M. Bhatia
Substance P enhances NF-{kappa}B transactivation and chemokine response in murine macrophages via ERK1/2 and p38 MAPK signaling pathways
Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1586 - C1596.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. A. Rettew, Y. M. Huet-Hudson, and I. Marriott
Testosterone Reduces Macrophage Expression in the Mouse of Toll-Like Receptor 4, a Trigger for Inflammation and Innate Immunity
Biol Reprod, March 1, 2008; 78(3): 432 - 437.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
L. D. Hazlett, S. A. McClellan, R. P. Barrett, J. Liu, Y. Zhang, and S. Lighvani
Spantide I Decreases Type I Cytokines, Enhances IL-10, and Reduces Corneal Perforation in Susceptible Mice after Pseudomonas aeruginosa Infection
Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 797 - 807.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J.-P. Lai, W. Z. Ho, L. E. Kilpatrick, X. Wang, F. Tuluc, H. M. Korchak, and S. D. Douglas
Full-length and truncated neurokinin-1 receptor expression and function during monocyte/macrophage differentiation
PNAS, May 16, 2006; 103(20): 7771 - 7776.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Metwali, A. M. Blum, D. E. Elliott, T. Setiawan, and J. V. Weinstock
Cutting Edge: Hemokinin Has Substance P-Like Function and Expression in Inflammation
J. Immunol., June 1, 2004; 172(11): 6528 - 6532.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Rasley, I. Marriott, C. R. Halberstadt, K. L. Bost, and J. Anguita
Substance P Augments Borrelia burgdorferi-Induced Prostaglandin E2 Production by Murine Microglia
J. Immunol., May 1, 2004; 172(9): 5707 - 5713.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. Bang, M. Biburger, W. L. Neuhuber, and G. Tiegs
Neurokinin-1 Receptor Antagonists Protect Mice from CD95- and Tumor Necrosis Factor-{alpha}-Mediated Apoptotic Liver Damage
J. Pharmacol. Exp. Ther., March 1, 2004; 308(3): 1174 - 1180.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. V. Weinstock, A. Blum, A. Metwali, D. Elliott, N. Bunnett, and R. Arsenescu
Substance P Regulates Th1-Type Colitis in IL-10 Knockout Mice
J. Immunol., October 1, 2003; 171(7): 3762 - 3767.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
D. R. Madrazo, S. L. Tranguch, and I. Marriott
Signaling via Toll-Like Receptor 5 Can Initiate Inflammatory Mediator Production by Murine Osteoblasts
Infect. Immun., September 1, 2003; 71(9): 5418 - 5421.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. P. M. van der Kleij, D. Ma, F. A. M. Redegeld, A. D. Kraneveld, F. P. Nijkamp, and J. Bienenstock
Functional Expression of Neurokinin 1 Receptors on Mast Cells Induced by IL-4 and Stem Cell Factor
J. Immunol., August 15, 2003; 171(4): 2074 - 2079.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. Bang, G. Sass, A. K. Kiemer, A. M. Vollmar, W. L. Neuhuber, and G. Tiegs
Neurokinin-1 Receptor Antagonists CP-96,345 and L-733,060 Protect Mice from Cytokine-Mediated Liver Injury
J. Pharmacol. Exp. Ther., April 1, 2003; 305(1): 31 - 39.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
S. F. Elsawa, W. Taylor, C. C. Petty, I. Marriott, J. V. Weinstock, and K. L. Bost
Reduced CTL Response and Increased Viral Burden in Substance P Receptor-Deficient Mice Infected with Murine {gamma}-Herpesvirus 68
J. Immunol., March 1, 2003; 170(5): 2605 - 2612.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. A. McConnell, R. S. Yunus, S. A. Gross, K. L. Bost, M. G. Clemens, and F. M. Hughes Jr.
Water Permeability of an Ovarian Antral Follicle Is Predominantly Transcellular and Mediated by Aquaporins
Endocrinology, August 1, 2002; 143(8): 2905 - 2912.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Rameshwar, D. D. Joshi, P. Yadav, J. Qian, P. Gascon, V. T. Chang, D. Anjaria, J. S. Harrison, and X. Song
Mimicry between neurokinin-1 and fibronectin may explain the transport and stability of increased substance P immunoreactivity in patients with bone marrow fibrosis
Blood, May 15, 2001; 97(10): 3025 - 3031.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. M. BLUM, A. METWALI, C. CRAWFORD, J. LI, K. QADIR, D. E. ELLIOTT, and J. V. WEINSTOCK
Interleukin 12 and antigen independently induce substance P receptor expression in T cells in murine schistosomiasis mansoni
FASEB J, April 1, 2001; 15(6): 950 - 957.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marriott, I.
Right arrow Articles by Bost, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marriott, I.
Right arrow Articles by Bost, K. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS