|
|
||||||||
The Sam and Rose Stein Institute for Research on Aging and the Theodore Gildred Cancer Center, Department of Medicine, University of California at San Diego, La Jolla, CA 92093
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
From efforts to dissect the functional capacities of these Ag receptors, V region sequences were shown to contain three noncontiguous linear intervals of greatest variability, which have been termed hypervariable regions or complementarity-determining regions (CDR)4 (7). Separating these CDR are intervals termed framework regions (FR) that are highly conserved among the members of a family. In crystallographic analyses that have elucidated the ß barrel structure of Abs, the CDR were found to represent loops that are juxtaposed to form the classic Ag binding site (reviewed in Refs. 8 and 9). By contrast, the FR subdomains fold into relatively rigid ß strands that maintain the overall Ig structure. However, these FR1 and FR3 subdomains were found to contain sequences that are distinct for each of the three clans. In fact, the nucleotide sequences of these FR subdomains are among the most highly conserved in mammals, with the FR1 and FR3 of clan III members displaying the greatest conservation (3, 10, 11, 12).
Competing theories have been presented to explain the maintenance of the clan-specific gene sequences across species and evolutionary boundaries. Tutter and Riblet (10, 11) compared inherited gene sequences and found that the frequencies of both silent and replacement mutations were significantly lower than expected, which was interpreted as indicative of selective conservation of clan III sequences at the nucleotide and not at the amino acid level. Presenting an alternative interpretation based on their own sequence analyses and molecular modeling of V regions, Kirkham and Schroeder (12) proposed that the FR subdomains did not solely provide structural and supportive scaffolding functions for the juxtaposed CDR sites. Instead, they demonstrated that the VH region FR1 and FR3 subdomains together form a separate conformational surface that is conserved and characteristic for each of the clans, which they postulated might represent an alternative ligand contact site (3, 12).
When originally presented, there was little more than circumstantial evidence to support this alternative binding site hypothesis. However, in recent years, certain microbial (13, 14, 15) and endogenous proteins (16, 17, 18) have been reported to have special properties, enabling direct interactions with these postulated Ig framework-associated alternative ligand-binding surfaces. Due to the obvious parallels with the activities of known T cell superantigens, many of these proteins have been postulated to represent B cell superantigens. We and others have considered the potential importance of the in vivo activities of a B cell superantigen (19), and speculated that interactions mediated through this Ig FR site might induce large scale alterations in the composition of the B cell or Ab repertoire. While this type of influence might affect all members of a species, possibly at an especially susceptible developmental stage, it is also possible that natural exposure may only occur occasionally in an individual host. However, despite their potential importance, except for our recent report (20), studies of these putative B cell superantigens have been limited to in vitro investigations.
The development of effective methods for monitoring of the consequences of in vivo B cell superantigen exposure poses special conceptual and technical challenges. One of the greatest hurdles is the lack of appropriate VH family-specific serologic markers. We suspect that the unavailability of this type of novel VH-targeted reagent is due to the conservation and ubiquitous expression of this same FR surface(s) in mammals, a state that must certainly have made these hosts immunologically tolerant to these determinants. Hence, we hypothesize that despite the obvious utility of this type of mAb, currently these reagents cannot be generated using available cellular technologies in commonly used experimental animals.
To surmount this postulated impediment, we sought to exploit the evolutionary distance of the chicken immune system. The idiosyncracies of the avian immune system are especially attractive for these studies (21, 22, 23, 24), as chicken Ab responses are formed from rearrangements of single VH and VL genes that are then highly modified by somatic mechanisms of hypermutation and gene conversion (reviewed in Refs. 25, 26). Therefore, to create these reagents, we first raised an Ab response to human monoclonal Ig in this avian host, and to isolate the mAbs of the required fine specificity, we harnessed the power of phage-display expression systems for in vitro clonal selection. By this approach, we were successful in isolating novel VH region-specific single chain V region (scFv) Abs specific for a conformational determinant that is completely restricted to the products of clan III genes. Moreover, in applications using diverse immunochemical formats, studies using these recombinant Abs demonstrated that clan III products are represented in the Ig repertoires of many terrestrial species. Further illustrating the utility of this novel highly specific clan III marker, we performed surveys of murine in vivo immune responses to a prototypic microbial B cell superantigen, which revealed the induction of a VH-restricted supraclonal defect. These studies provide a foundation for investigations into how a natural Ig-binding protein can mold the clonal composition within the B cell compartment.
| Materials and Methods |
|---|
|
|
|---|
A Leghorn chicken was immunized and boosted s.c. in the wing
with human clan III Ig. For the immunization
regimen, chickens received the native
human IgM (V323/clan III V
1) 18/2 (27) and the human
rIgM (V323/clan III V
2) Fab, 3-15 (28) (50 µg
each), in PBS, pH 7.4 (PBS), emulsified in CFA (Difco Laboratories,
Detroit, MI), with a boost after 2 wk of 3-15 and HEA (V330/clan III
V
3) (50 µg each) in IFA. A second boost of 3-15 and 18/2 (50 µg
each) in IFA was delivered 2 wk later. After 4 wk, induced Ab responses
were demonstrated by comparisons of anti-Ig-binding activity of
pre- and postimmunization IgY from egg yolk (data not shown), which was
purified using the Eggstraction Kit (Promega, Madison, WI). Briefly,
wells were coated with 3-15 at 5 µg/ml in PBS for 1 h at 37°C,
and then blocked in 2% BSA in PBS for 1 h at 37°C. Equivalent
concentrations of pre- and postimmunization IgY were added in serial
dilutions in 1% BSA/PBS and incubated for 1 h at 37°C. To
detect binding, peroxidase-labeled goat anti-IgY (Promega) was
added in 1% BSA/PBS for 1 h at 37°C. Plates were washed as
above, and tetramethylbenzidine substrate (Kirkegaard & Perry
Laboratories, Gaithersburg, MD) was added to wells. Plates were read at
OD450650 in a microplate reader (Bio-Rad,
Hercules, CA).
Creation of a chicken scFv Ab phage-display library
Adapting a standard protocol (29), avian bone
marrow and spleen were separately harvested into serum-free RPMI and
dissociated into single cell mononuclear cell suspensions and then
lysed in Tryzol (Life Technologies, Gaithersburg, MD). RNA was isolated
by phenol/chloroform/isoamyl alcohol (24:25:1) extraction and
precipitated in isopropanol at -20°C for 30 min. After
centrifugation at 14,000 rpm in a microfuge, the RNA pellet was washed
with cold 70% ethanol and recentrifuged. The pellet was air dried and
resuspended in nuclease-free diethyl pyrocarbonate water. RNA was
quantitated by OD260, and purity was determined
by the 260:280 ratio. For reverse transcription, 20 µg of RNA was
used with oligo(dT) primer according to the Superscript II kit (Life
Technologies). Each of four PCR reactions for H chain and L chain genes
used 1 µl of cDNA from the above reaction. The 100-µl PCR reaction
also included 10x reaction buffer, 2.5 µM of dNTP, 1
µg each of either H chain primers (CSCVHo-FL3,
GGTCAGTCCTCTAGATCTTCCGGCGGTGGTGGCAGCTCCGGTGGTGGCGGTTCCGCCGTGACGTTGGACGAG,
and CSCG-B, CTGGCCGGCCTGGCCACTAGTGGAGGAGACGATGACTTCGGTCC) or L
chain primers (CSCVk-F, GTGGCCCAGGCGGCCCTGACTCAGCCGTCCTCGGTGTC, and
CKJo-B, GGAAGATCTAGAGGACTGACCTAGGACGGTCAGG). After a 2-min hot start
at 96°C, 2.5 U of Taq polymerase was added to each
reaction tube, and then thermal cycling was conducted in Perkin-Elmer
9600 (Applied Biosystems, Columbia, MD) for 30 cycles of 96°C for
30 s, 56°C for 15 s, 72°C for 90 s, followed by a
final extension cycle of 72°C for 7 min. VH
products (
430 bp) and VL products (
380 bp)
were separately purified with a QIAquick kit (Qiagen, Chatsworth, CA).
In 20 tubes for overlap PCR reactions, 100 ng of each of
VH and VL PCR products was
included with 2.5 µM of dNTP, and 1 µg each of nested sense primer
(CSC-F, GAGGAGGAGGAGGAGGAGGTGGCCCAGGCGGCCCTGACTCAG) and antisense
primer (CSC-B, GAGGAGGAGGAGGAGGAGGAGCTGGCCGGCCTGGCCACTAGTGGAGG),
and nuclease-free water and the manufacturers PCR buffer in 100-µl
reaction volumes. After a 2-min hot start at 96°C, 2.5 U of
Taq polymerase was added to each reaction tube, with 30
cycles of 96°C for 30 s, 56°C for 15 s, 72°C for 2 min,
followed by a final extension step at 72°C for 7 min. The products of
these PCR reactions were combined, and the
750-bp band was purified
from a 2% agarose gel. Overlap product inserts and the pComb3H vector
(30) (kind gift of Dr. Carlos Barbas III, Scripps Research
Institute, La Jolla, CA) were prepared (20 µg of each) similarly by
SfiI digestion for 5 h at 50°C, followed by ethanol
precipitation, resuspension, and purification in a 2% agarose gel.
Appropriate DNA bands were excised and electroeluted (Millipore,
Bedford, MA). The ligation reaction included 700 ng of prepared single
chain (sc) Fv library and 1400 ng of prepared pComb3H with 2 U of T4
DNA ligase (Life Technologies) incubated overnight at room temperature,
which was later precipitated and resuspended in water before
electroporation into electrocompetent ER2354 cells (NEB, Beverly, MA).
By this approach, a library of >8.5 x 108
individual CFU was obtained.
Panning and binding studies of phage-display libraries
To obtain a phage-display form of the library, bacterial
cultures were rescued overnight by infection with VCS M13 helper phage
(Stratagene, La Jolla, CA) infection, and phage were precipitated in
the morning in 4% PEG-8000 with 3% NaCl. For the first five rounds of
panning, enzyme immunoassay microtiter wells were coated with human
and/or mouse Ig at 5 µg/ml and blocked with 2% BSA/PBS, then phage
were added alone or with a competitive inhibitor at 37°C for 2
h, and washed with PBS/0.05% Tween-20 (Table I
). Bound phage were
eluted with 0.1 M glycine-HCl, pH 2.2, and neutralized with 2 M Tris
base. After each round of selection, fresh cultures of log phase ER2354
cells (NEB) were infected with the eluted phage, and, after library
amplification, cultures were again rescued with helper phage. For the
sixth round of selection,
1012 phage were
incubated with rocking in 750 µl of RPMI for 2 h at room
temperature with
108 murine mononuclear
splenocytes from a naive 6-wk-old female BALB/c mouse. Afterward, cells
were spun for 10 min at 4000 rpm in a microfuge, then washed thrice
with 1 ml of PBS and respun, and then binding phage were eluted, as
described above.
|
Characterization of individual scFv Abs
The phage from the sixth round of selection were amplified in
XL-1 Blue cells (Stratagene), and the plasmid library was purified
(Qiagen). The scFv library was excised by SfiI digestion
(NEB) for 3 h at 50°C, gel purified (Qiagen), and ligated into a
similarly prepared pARA plasmid (gift of C. F. Barbas), a
compatible bacterial expression vector employing the arabinose promoter
that also fuses peptide tags to the scFv product. After transformation
into XL-1 Blue cells, and selection on LB plates with 25 µg/ml of
chloramphenicol, individual colonies were picked, and expanded in LB
media with 25 µg/ml of chloramphenicol. At an
OD600 of
0.5, cultures were induced with 0.5%
L-arabinose and grown overnight at 30°C.
Protein was purified from cell pellets under native conditions over
equilibrated Ni-NTA spin columns (Qiagen), and purified protein was
eluted and immediately dialyzed in PBS, pH 8. In preparation for
biotinylation, Abs were dialyzed against 0.25 M borate-buffered saline,
pH 8.8, then reacted with long linker N-hydroxy-succinimide
biotin (Sigma, St. Louis, MO) for 4 h at room temperature. The
reaction was stopped with 1 M NH4Cl, and
unreacted biotin was removed by dialysis against PBS for several days
with four buffer changes. To evaluate individual scFv Abs for binding
reactivity with a diverse panel of human and mouse monoclonal Ig, wells
were coated and blocked as previously described, and equivalent amounts
of scFv protein were loaded in serial dilutions. Binding was detected
with a biotinylated anti-hemagglutinin reagent (gift of C. F.
Barbas) that recognizes a pARA-encoded C-terminal epitope tag, with
detection using HRP-streptavidin. Alternatively, in assays using
directly biotinylated scFv Abs, binding was directly detected with
HRP-streptavidin. To simplify comparisons with the Fab-binding activity
of SpA, we used a chemically modified version (MSpA) that retains Fab
specificity, but does not bind Fc
(31), which was
biotinylated for detection of binding. For numeric comparisons, for
each murine Ig the concentration values were determined from binding
curves that provided an OD450650 of 0.5 (i.e.,
stronger binding is associated with lower values).
For competition studies, a representative labeled scFv, LJ-26, or SpA was mixed with decreasing amounts of unlabeled LJ-26, SpA (Repligen, Cambridge, MA), or a human Fv-binding protein, termed pFv (18) (gift of J.-P. Bouvet, Hopital Broussais, Paris, France). The concentration of pFv was estimated based on silver stain of polyacrylamide gel studies and Western immunoblot analysis (not shown). Inhibition values were determined by interpolation against a standard curve of the labeled scFv without inhibitor.
The reactivities of select scFv clones were further characterized in immunoblots. Briefly, purified Ig from diverse species (Jackson ImmunoResearch, West Grove, PA) were separated on SDS-PAGE, under reducing and nonreducing conditions, in 412% Tris-glycine gels (Novex, La Jolla, CA), and later electrotransferred to Immobilon P membranes (Millipore). To assess binding, membranes were blocked in PBS/1% casein and blotted with scFv-biotin or a MSpA-biotin at 2 µg/ml, then washed in 0.05% Tween-20/borate-buffered saline. Reactivity was detected with HRP-streptavidin and chemiluminescent substrate (Amersham, Buckinghamshire, U.K.).
Microfluorometric studies
Samples of human PBMC containing greater than 95% monoclonal B
cells from patients with chronic lymphocytic leukemia (CLL) (provided
by T. J. Kipps, University of California, San Diego), and normal
adult PBMC were stained with anti-CD5 PE (clone UCHT2),
anti-CD19 APC (clone HIB19), anti-
FITC (G20-193),
anti-
FITC (JDC-12), and LJ-26 biotin or biotin chicken scFv
isotype control and streptavidin-peridinin chlorophyl protein. In
studies of BALB/c, C57BL/6 or the AB29 (32), or T15i
(33, 34) Ig transgenic mice, certain groups received
neonatal treatment with endotoxin-free SpA, or hen egg lysozyme or
saline, following a previously described treatment regimen
(20). After the last treatment, bone marrow and splenic
mononuclear cells were isolated as previously described
(20) and evaluated freshly, or placed in overnight culture
before analysis. Cells were treated then with Fc block, and stained
with anti-IgM (R6-60.2), anti-B220 (RA3-6B2),
anti-IgMa (DS-1), and LJ-26 biotin or
biotinylated chicken scFv isotype control and streptavidin-peridinin
chlorophyl protein. Unless indicated, Abs were obtained from PharMingen
(La Jolla, CA). In certain studies, cells were also stained with a
PE-labeled MSpA (20, 31). Data were acquired on a
four-color FACSCalibur analytic flow cytometer (Becton Dickinson,
Mountain View, CA) and analyzed with FloJo (Tree Star, San Carlos, CA)
or CellQuest software (Becton Dickinson).
| Results |
|---|
|
|
|---|
The immunization regimen was designed to enhance the response to
determinants shared by human VH3 Abs, and the
panning strat- egy was designed to positively select for clones
with a cross-species clan III specificity, while clones specific for L
chain and constant region determinants should be negatively selected
(Table I
). Hence, the avian scFv phage-display library was subjected to
sequential rounds of selection against human and murine clan III Ig
coated onto wells, and during the later rounds clan II Ig inhibitors
were also mixed in solution with the phage libraries. For the final
round, selection was against murine splenic mononuclear cells. The
resulting libraries were subsequently evaluated for Ig-binding
activity, which demonstrated that Ig-binding activity rose
significantly after the fourth round of panning, and continued to
increase for the fifth and sixth rounds (Fig. 1
A).
|
To characterize the reactivities of individual Ab clones, the sixth
round library was transferred into a soluble scFv expression system,
and the binding of purified scFv clones was tested by ELISA. Initial
screening of 60 clones revealed a remarkable focusing of binding
specificities, with representative results for 19 clones illustrated in
Fig. 2
A. Although the chicken
was immunized with human IgM proteins, in these studies each of these
soluble scFv also reacted with a murine 7183/clan III IgG1 and a murine
J606/clan III IgG3, while these scFv were uniformly nonreactive with a
clan II IgM. These data are consistent with specific interactions with
cross-species-conserved VH region site(s).
|
|
The relative reactivities of SpA and LJ-26 were compared in direct
Fab-binding assays with murine IgM and IgG from clans I, II, and III,
with results compiled in Table II
. Herein, the deduced protein
sequences of the VH regions of these monoclonal
Ig are grouped by family and clan, and aligned to the human
germline V323 gene segment, which is believed to commonly encode for
Abs in the human repertoire with the strongest Fab-mediated binding
activity for SpA (14, 28). Similar to results from studies
of SpA with monoclonal human Ig (13, 14, 28, 36) and
murine Ig (37, 38), LJ-26 also did not exhibit detectable
binding reactivity with any of the monoclonal murine Ig from clan I or
II, which are significantly divergent from the V323 paragon,
especially in key diagnostic positions in FR1 and FR3 (3).
Most of the clan III IgM specificallyinteracted with both SpA and
LJ-26, and strong reactivity was exhibited by the human
VH3 and murine S107 and J606 family-encoded Ig.
However, for certain mAbs (i.e., 7183-encoded Ig; 452s.11, 363p.16, and
452p.18), the binding activities of LJ-26 and SpA diverged, as they
weakly bound SpA and were nonreactive with LJ-26. The greatest
discordance was for several clan III IgG, including the 7183-encoded
452p.2 and MOPC21, which were all strongly reactive with LJ-26, while
they bound SpA weakly or not at all. Furthermore, the lack of
reactivity of MOPC21 with SpA has been correlated with a replacement
mutation at position 57 and a natural variation of a serine at position
82a (38), which are reported to be critical residues for
SpA binding (39, 40, 41). Hence, the strong reactivity of this
avian Ab with MOPC21 may indicate that, while most of the contact
surface is similar for SpA and LJ-26, these particular
VH positions that are near the limits of the SpA
contact surface (35) are not involved in the interaction
with LJ-26. In general, while reactivity with SpA varied greatly
between different clan III Ig, there was much less of a range of
reactivities with LJ-26, which may suggest that the LJ-26 Ab recognizes
a much less complex VH region surface.
LJ-26 competes with a bacterial B cell superantigen and an endogenous human Fab-binding protein for binding to clan III Ig
Competition studies were performed to directly compare the
Fab-binding activity of LJ-26 with the natural clan III-restricted
Ig-binding proteins, SpA, and the human gut-associated sialoprotein,
pFv (18, 42). In the first type of competition
immunoassay, a fixed concentration of labeled LJ-26 was mixed with
different concentration of LJ-26, or an avian scFv isotype control, or
pFv, or SpA, and then later incubated in wells coated with a human clan
III IgM Fab. Binding of labeled LJ-26 to the human clan III Fab was
efficiently competed by unlabeled LJ-26, SpA, and pFv (Fig. 3
). Equivalent studies were also
performed using labeled SpA, and each of these proteins significantly
inhibited SpA binding (not shown). Together, these results suggest that
LJ-26 binds at, or near, the same highly conserved clan III Fab surface
that is responsible for the B cell superantigen activities of SpA and
pFv. It is also important to appreciate that despite the fact that this
scFv Ab has only a single binding site, in these studies the
LJ-26 Ab displayed activity binding equal to or greater than the native
SpA that has five domains capable of these Fab-binding interactions
(28, 43).
|
To evaluate the structural requirements for
VH region recognition, reactivity was assessed in
immunoblot analysis with purified human and murine Ig. As shown in Fig. 4
, both SpA and LJ-26 reacted only with
the nonreduced clan III Ig, while reactivity was abolished under
reducing conditions. Hence, the LJ-26 Ab, like the natural clan III
VH-binding proteins, interacts with a
conformational VH determinant that is abolished
by these reducing conditions.
|
|
To evaluate the reactivities of LJ-26 with B cell
membrane-associated Ig, a series of microfluorometric assays were
performed. In studies of PBMC from patients with chronic lymphocytic
leukemia (CLL), which contain essentially monoclonal (i.e., >95%)
CD5+CD19+ B cell
populations, neither LJ-26 nor MSpA bound B cell CLL-expressing clan II
Ig (e.g., COR) (Fig. 6
A) or
clan I Ig (not shown). In contrast, LJ-26 recognized most CLL that
express clan III Ig (e.g., GOS and HEC), whereas MSpA bound fewer clan
III-expressing CLL. These data document that LJ-26 recognizes a broad
range of B cell-associated clan III Ig, displaying strong reactivity
even with VH3-expressing B cells with low surface
Ig levels.
|
25% of CD19+ gated
mononuclear cells stained with MSpA or LJ-26 (Fig. 6
40% of the
LJ-26+ and MSpA+
populations express
L chain, while
60% of reactive populations
express
L chains, which is the exact physiologic distribution of
these L chains in the human immune system, indicating that these
interactions are independent of B cell L chain usage.
The reactivity of the LJ-26 Ab was also evaluated in transgenic mice
expressing defined VH and
VL genes. In studies of AB29 mice, which have an
expanded monoclonal B cell set expressing a human
VH4/clan II µ-chain paired with a human V
L
chain (32), as expected the splenic mononuclear cells
bearing human IgM were not recognized by the LJ-26 Ab (Fig. 7
A). However, in these mice,
about one-third of the B220+ splenocytes instead
express endogenous murine IgM, and LJ-26 recognized about 7% of these
polyclonal splenic murine IgM-bearing B cells. These findings are
consistent studies, in which 47% of C57BL/6 and 69% of BALB/c
B220+/IgM+ splenocytes
interact with the Fab binding site of SpA (20) (G.
Silverman, unpublished observation).
|
Investigations of a murine model of in vivo B cell superantigen-induced clonal defects
To test the hypothesis that natural B cell superantigens can affect the in vivo lymphocyte clonal composition, we investigated the consequences of exposure on heterozygous T15i x C57BL/6 F1 mice. Similar to the homozygous T15i mice, in these naive mice, most of the B cells that bear the IgMa allotype coexpress the H chain with the VHT15 rearrangement paired with diverse L chains (34); hence, there is not a significant population specific for any single conventional Ag. The remainder represent endogenous polyclonal B cells expressing the parental IgMb allotype, and hence, any fluctuations in the transgene-associated B cell set are measurable by use of VHT15-reactive and IgM allotype-specific markers.
For these studies, we treated the neonatal heterozygous mice with SpA
or a control protein Ag, according to the same regimen recently used in
studies demonstrating superantigen-induced supraclonal loss in BALB/c
mice (20), and we evaluated the representation of
peripheral B cells in mice sacrificed 18 h after introduction of
the last dose. To ensure that a detected decrease in the representation
of VHT15-expressing B cells is due to cellular
deletion, and is not due to a reversible down-regulation of
membrane-associated Ig, in certain studies these splenocytes were
evaluated after 24 h of in vitro incubation in the absence of the
immunogens. As illustrated in Fig. 8
,
compared with groups that received the control treatment, in which
32 ± 1.9% (mean ± SEM) of B cells were LJ-26 reactive,
after SpA treatment only 3.7 ± 1.2% of B cells were LJ-26
reactive. Although due to gating differences, specific values were
somewhat different, 41.1 ± 2.3% of the control-treated B cells
expressed the transgene-associated IgMa allotype,
while in SpA-treated mice the representation of
IgMa-bearing B cells was reduced to 5.3 ±
1.4%, representing a highly significant 87% loss
(p < 0.005, one-tailed Student t
test). Also illustrated in Fig. 8
, by gating on B220/CD45R-bearing
cells, the concordance between IgMa and LJ-26
reactivity in these mice is directly demonstrated. Importantly, in the
SpA-treated mice, the residual LJ-26-reactive B cells displayed lower
levels of reactivity than detected in the control groups.
|
| Discussion |
|---|
|
|
|---|
To accomplish this goal, the avian immunization regimen consisted of
sequential exposures with three monoclonal clan III Ig that derive from
different human VH3 gene rearrangements, and that
included L chains from diverse human V
genes.
Subsequently, the genetic information for this Ab response was
transferred into a suitable phagemid vector, and Abs with desirable
specificities were isolated by a strategy in which only the initial
round of panning used one of the original immunogens, under relatively
low selection stringency. Later, to remove clones with irrelevant
specificities, washing stringency was increased and selection was
performed in the presence of soluble VH4/clan II
IgM to prevent carryover of unwanted binders, including those to C
region and L chain determinants. Within this strategy, a murine clan
III Ig-selecting agent was next substituted and washing stringency was
further increased. Both to reinforce selection for cross-species
conserved determinants, and to ensure that isolated clones would be
suitable for cell-staining studies, the final round was performed using
selection upon viable murine splenic B cells.
Specificity analysis using a large number of human and murine samples documented that our strategy resulted in the recovery of clones reactive with the products of diverse genes from structurally related and highly expressed human and murine VH families. Reactivity was completely restricted to clan III Ig, with demonstrated complete nonreactivity with diverse clan I and clan II Ig. Predictably, reactivity with the representative LJ-26 Ab was much more frequent in the adult human peripheral B cell compartment than in the murine immune system, which is consistent with known species-specific VH gene family expression patterns (i.e., VH3/clan III is dominant in humans, while J558/clan I is dominant in mice).
From investigations of cross-species reactivity, we documented that the LJ-26 binding site, like the SpA binding site, is conserved on diverse mammalian species, activities generally consistent with reported Ab gene usage (discussed in Refs. 4, 5, 6, 12). We also demonstrated specific, but relatively weak, reactivity with sheep and bovine Ig, results seemingly in conflict with recent reports that these species do not have clan III genes (44, 45). However, clan III gene homologues have recently been cloned from sheep (John Reynolds, personal communication). We also found LJ-26 reactivity with frog Ig, which was predicted based on the deduced sequence of Xenopus V1 and related families (46). Although chicken VH genes are also clan III homologues, we did not expect to find such strong LJ-26 reactivity with chicken Ig. It is possible that this represents a neospecificity created by the in vitro combinatorial pairing of the avian VH and VL genes from cloning into the phagemid vector. However, because this Ab clone was rescued from a postimmunization response, we interpret this as more likely an indication that strict B cell immune tolerance is not maintained in this avian host.
The immunization and selection methods did not include SpA and pFv; therefore, we were somewhat surprised to discover that binding of the avian anti-clan III scFv was competitive with these clan III-specific natural B cell superantigens. Moreover, in several comparative assays of Abs with diverse VH regions, the binding specificities of SpA and LJ-26 were generally found to be quite similar. Akin to earlier reports of the specificity of superantigen binding (13, 14, 20, 38), LJ-26 was shown to recognize a conformational determinant that could be destroyed by reducing conditions. These findings may indicate that the clan III-specific VH surface responsible for the binding of B cell superantigens is highly accessible and perhaps dominant for immune recognition in a nontolerant host.
In studies of a panel of murine mAbs, reactivity of clan III Ig with LJ-26 was somewhat more common than interactions with the Fab binding site of SpA. Notably, LJ-26 recognized a product of the clan III/X24 family, while SpA did not. In addition, LJ-26 often had greater reactivity with clan III IgG, suggesting that somatic hypermutation may less commonly have an adverse effect upon recognition by the LJ-26 Ab. In microfluorometric assays of human CLL specimens, despite low surface Ig levels, more clan III CLL were also identified by LJ-26 than by SpA. We also found that in assays of polyclonal human peripheral B cells from healthy donors, LJ-26 staining displayed a closer direct correlation with the level of total surface Ig expression, providing a sharp diagonal. By comparison, although a very similar proportion of binders was recognized, there was much greater heterogeneity in the Fab-binding interactions of SpA. We speculate that the binding of the LJ-26 Ab may be less sensitive than SpA to local or remote mutational effects, perhaps because it interacts with a smaller surface that is less diversified in the products of different inherited and somatically mutated clan III genes. Based on the competitive inhibition studies, it is likely that, in part, these differences also reflect the higher binding affinity of the LJ-26 Ab.
Based on primary sequence correlation, we predict that the site on the surface of clan III VH region involved in the binding interaction of the LJ-26 Ab is a more limited surface than the contact site responsible for the binding of natural superantigens. Importantly, inherited polymorphisms and somatic variations at VH positions 57 and 82a do not correlate with differences in reactivity with the LJ-26 Ab, while these residues can greatly affect SpA-binding activity (39, 40, 41). Although the data are still too limited for meaningful mapping, it is likely that like SpA (35), the LJ-26 contact site is remote from the CDR loops involved in binding of conventional Ags, and may involve the VH ß strands of the FR1 and FR3 subdomains.
To directly evaluate the utility of the LJ-26 Ab for investigations of repertoire changes induced by B cell superantigen exposure, we used the T15i system generated by Taki et al. (33, 34), which we found was well suited to our goals. In part, this is because the expressed VHT15 transgene is paired with diverse endogenous L chains, which does not create a uniform population with a common conventional ligand-binding specificity. Hence, the effects induced by SpA exposure can only be due to unconventional VH region-mediated binding interactions (i.e., superantigen-VH framework). Most importantly, rearrangements of unmutated S107 genes commonly encode for B cell receptors with among the highest binding affinity for SpA, independent of heavy chain CDR3 or L chain usage (38), making it ideal for these investigations of the effects of a B cell superantigen on immune repertoire composition.
At a minimum, these studies have validated a strategy for the creation of novel reagents that are uniquely well suited to the study of the consequences of B cell superantigen exposure. Reiteration of this avian Ab-cloning approach is almost certain to provide reagents with complementary specificities to complete the overview of the expressed mammalian VH repertoire. Additional reagents for identifying further subdivisions of VH groupings, and their VL analogues should also be obtainable.
More importantly, we have advanced the hypothesis that Ig frameworks have functions beyond those of a passive scaffolding, i.e., rigid structural elements that position the CDR loops to create composite surfaces capable of binding diverse ligands. The VH surface created by the FR1/3 subdomains has been conserved even in primitive cartilaginous fish (reviewed in Ref. 47), which we believe is due to relationship(s) with novel environmental ligand(s), or perhaps due to their interactions with special Ig adapter molecules conveying functions that reiterate themes first appreciated for Fc regions. These studies have also provided the first evidence that in the suitable host, these conserved surfaces can be recognized by the immune system. In the future, serologic tools akin to LJ-26 should advance our understanding of the impact of poorly understood infectious, inflammatory, and autoimmune disease processes upon the B cell compartment.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Department of Biological Chemistry, University of Michigan Medical School, Ann Arbor, MI 48109. ![]()
3 Address correspondence and reprint requests to Dr. Gregg J. Silverman, Department of Medicine-0663, University of California at San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0663. E-mail address: ![]()
4 Abbreviations used in this paper: CDR, complementarity-determining region; CLL, chronic lymphocytic leukemia; FR, framework region; HEL, hen egg lysozyme; MSpA, chemically modified SpA that retains Fab-binding activity; pFv, protein Fv; scFv, single chain Fv; SpA, staphylococcal protein A. ![]()
Received for publication October 5, 1999. Accepted for publication February 22, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. S. Goodyear, F. Sugiyama, and G. J. Silverman Temporal and Dose-Dependent Relationships between In Vivo B Cell Receptor-Targeted Proliferation and Deletion-Induced by a Microbial B Cell Toxin J. Immunol., February 15, 2006; 176(4): 2262 - 2271. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Goodyear and G. J. Silverman Staphylococcal toxin induced preferential and prolonged in vivo deletion of innate-like B lymphocytes PNAS, August 3, 2004; 101(31): 11392 - 11397. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Cappione, A. E. Pugh-Bernard, J. H. Anolik, and I. Sanz Lupus IgG VH4.34 Antibodies Bind to a 220-kDa Glycoform of CD45/B220 on the Surface of Human B Lymphocytes J. Immunol., April 1, 2004; 172(7): 4298 - 4307. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Goodyear, M. Narita, and G. J. Silverman In Vivo VL-Targeted Activation-Induced Apoptotic Supraclonal Deletion by a Microbial B Cell Toxin J. Immunol., March 1, 2004; 172(5): 2870 - 2877. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Goodyear and G. J. Silverman Death by a B Cell Superantigen: In Vivo VH-targeted Apoptotic Supraclonal B Cell Deletion by a Staphylococcal Toxin J. Exp. Med., May 5, 2003; 197(9): 1125 - 1139. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Scamurra, D. B. Nelson, X. M. Lin, D. J. Miller, G. J. Silverman, T. Kappel, J. R. Thurn, E. Lorenz, A. Kulkarni-Narla, and E. N. Janoff Mucosal Plasma Cell Repertoire During HIV-1 Infection J. Immunol., October 1, 2002; 169(7): 4008 - 4016. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Silverman, S. P. Cary, D. C. Dwyer, L. Luo, R. Wagenknecht, and V. E. Curtiss A B Cell Superantigen-induced Persistent "Hole" in the B-1 Repertoire J. Exp. Med., July 3, 2000; 192(1): 87 - 98. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Graille, E. A. Stura, A. L. Corper, B. J. Sutton, M. J. Taussig, J.-B. Charbonnier, and G. J. Silverman Crystal structure of a Staphylococcus aureus protein A domain complexed with the Fab fragment of a human IgM antibody: Structural basis for recognition of B-cell receptors and superantigen activity PNAS, May 9, 2000; 97(10): 5399 - 5404. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |