The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reif, K.
Right arrow Articles by Cyster, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reif, K.
Right arrow Articles by Cyster, J. G.
The Journal of Immunology, 2000, 164: 4720-4729.
Copyright © 2000 by The American Association of Immunologists

RGS Molecule Expression in Murine B Lymphocytes and Ability to Down-Regulate Chemotaxis to Lymphoid Chemokines1 ,2

Karin Reif and Jason G. Cyster3

Department of Microbiology and Immunology, University of California, San Francisco, CA 94143


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ag-mediated changes in B lymphocyte migration are important for normal immune function, yet the mechanisms by which these changes occur are poorly defined. Because chemokines direct many lymphocyte movements, molecules that regulate signaling by G protein-coupled chemokine receptors are likely to participate in Ag receptor-induced changes in cell migration. In this study, we have investigated the expression pattern and activity in murine B cells of members of the regulators of G protein signaling (RGS) family of molecules. We present the sequence of mouse RGS1 and describe a novel short isoform of RGS3 that we term RGS3s. Following in vivo activation by Ag, B cells rapidly up-regulate expression of RGS1 and RGS2 while simultaneously decreasing expression of RGS3 and RGS14. Anergic hen egg lysozyme autoantigen-binding B cells are also shown to have slightly elevated RGS1 and RGS2 expression. CD40 signaling, by contrast, fails to cause rapid up-regulation of RGS1 or RGS2. Using a transient transfection approach in a mature B cell line, 2PK3, we demonstrate that RGS1 and RGS3s are effective inhibitors of chemotaxis toward the lymphoid tissue chemokines stromal cell-derived factor-1, B lymphocyte chemoattractant, and EBV-induced molecule 1 ligand chemokine, whereas RGS2 has a minimal effect on migration to these chemokines. Together these findings support the conclusion that Ag-mediated changes in RGS molecule expression are part of the mechanism by which Ag receptor signaling regulates B cell migration within lymphoid tissues. The findings also suggest important roles for additional G protein-mediated events in B cell activation and tolerance.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Migration of resting and Ag-engaged B lymphocytes to specific compartments within lymphoid organs is important for recirculation and for mounting immune responses (1). Exclusion of autoreactive B lymphocytes from lymphoid follicles also plays a role in B cell tolerance (2). Recent progress has been made in identifying chemokines and chemokine receptors that are responsible for lymphocyte homing in secondary lymphoid organs. The chemokine receptor CXCR5 (formerly Burkitt’s lymphoma receptor 1) is expressed by mature B cells and is required for B cell migration into lymphoid follicles (3). Its ligand, a CXC chemokine termed B lymphocyte chemoattractant (BLC)4 or B cell-attracting chemokine-1, is expressed in the follicular regions of secondary lymphoid organs (4, 5). Predominant chemokines present in the T zones of lymphoid organs are the CCR7 ligands, secondary lymphoid tissue chemokine (SLC)/6Ckine, and EBV-induced molecule 1 ligand chemokine (ELC)/macrophage-inflammatory protein-3ß (reviewed in Refs. 1, 6). In agreement with a role in T zone organization, SLC and ELC strongly attract naive T lymphocytes and weakly attract B cells (7, 8). Another candidate for positioning B and T lymphocytes within secondary lymphoid organs is stromal cell-derived factor-1 (SDF-1), the ligand for CXCR4 (9).

Chemokine receptors are coupled to heterotrimeric G proteins, which consist of {alpha}, ß, and {gamma} subunits. Four families of G{alpha} subunits can be distinguished based on their function and amino acid sequence homology, and are termed G{alpha}s, G{alpha}i, G{alpha}q, and G{alpha}12. In vitro studies suggest that G{alpha}i family members are essential for mediating chemoattractant responses (10). For G{alpha} subunits to function, they must switch between an inactive GDP-bound and an active GTP-bound conformation. Essential elements in this GDP/GTP cycling are positive regulators that accelerate the nucleotide exchange on G{alpha} and negative regulators that increase the intrinsic GTPase activity of G{alpha}. While activated G protein-coupled receptors (GPCRs) themselves act as nucleotide exchange factors (GEFs), GTPase-activating proteins (GAPs) for heterotrimeric G proteins have only recently been recognized and were named regulators of G protein signaling (RGS) molecules (11, 12, 13, 14). RGS proteins contain a highly homologous region of about 120 aa, referred to as the RGS domain, that confers the GAP activity of the protein by stabilizing the GTP-to-GDP transition state of G{alpha} subunits. Most RGS proteins are relatively small, consisting of ~200 aa, but an increasing number of larger RGS proteins have been described that contain additional functional domains such as a PDZ domain in RGS12, a Dbl homology domain in p115RhoGEF, and a B-raf homology domain in RGS14 (15). Studies on the specificity of RGS molecules for different G proteins to date have indicated that human RGS1, RGS3, RGS4, and RGS16 predominantly interact with G{alpha}i subunits, RGS2 with G{alpha}q, RGSZ1 with G{alpha}z, and p115RhoGEF with G{alpha}12/13. These relationships may not be rigid, however, as some studies have indicated that RGS1 and RGS3 can inhibit signaling via G{alpha}q-coupled receptors (16, 17, 18), while RGS2 may antagonize some G{alpha}i-coupled receptors (13). Evidence is accumulating that the specificity of RGS proteins can also be regulated through interactions with the GPCRs themselves (16, 19, 20). Further work is therefore needed to understand how individual RGS proteins regulate individual GPCRs.

Lymphoid tissues and cells have been found to express multiple RGS molecules (21). Human RGS1 (BL34/1R20) was first identified through its expression in activated B cells (22, 23), and RGS3 was isolated by screening a B cell cDNA library with an RGS domain probe (13). RGS2 (GOS8) was first isolated as a gene induced by treatment of human blood mononuclear cells with the T cell mitogen, Con A (24). Further work has shown that expression of human RGS1 is induced in B cells by treatment with anti-IgM Abs as well as by IL-4, cAMP, or platelet-activating factor (13, 22, 23). RGS1 is strongly inducible by phorbol esters, whereas RGS2 is induced more strongly by calcium ionophore (25). RGS14 is also highly expressed in spleen as well as in brain and lung (26). Recently, it has also been reported that RGS16 is expressed in some lymphoid cell types (27).

To explore whether RGS molecules might function downstream of B cell surface receptors in regulating B cell responsiveness to lymphoid chemokines, we have characterized the expression pattern and activity of several mouse RGS proteins. We report the sequence of mouse RGS1 and describe a novel short isoform of RGS3, RGS3s, present in both mice and humans. Mouse RGS1 and RGS3 are expressed at high levels in spleen and lymph nodes. The expression patterns of mouse RGS2 and RGS14 are also examined, and RGS1, RGS2, RGS3, and RGS14 transcript levels are shown to be rapidly modulated in B lymphocytes in response to Ag challenge in vivo. Using cell lines transfected with RGS1-, RGS2-, and RGS3-GFP fusion proteins, we demonstrate that RGS1 and RGS3 can attenuate migration to the lymphoid chemokines BLC, ELC, and SDF-1. These findings suggest an important role for RGS molecules in helping regulate cell positioning in lymphoid organs during the immune response.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents

Mouse rELC (macrophage-inflammatory protein-3ß) was purchased from R&D Systems (Minneapolis, MN). Mouse rBLC was isolated as a HIS-tagged protein, as described (28). Human SDF-1{alpha} (N33A) was synthesized by chemical ligation and was a gift from M. Siani (Gryphon Sciences, South San Francisco, CA). Note human and mouse SDF-1 only differ in 1 aa, and SDF-1{alpha} (N33A) has identical activity to native human and mouse SDF-1. The anti-CD40 mAb (clone FGK) (29) was a gift from Antonius Rolink (Basel Institute for Immunology, Basel, Switzerland). Hen egg lysozyme (HEL) was purchased from Sigma (St. Louis, MO).

Mice and animal challenge

C57BL/6 MD4 Ig transgenic (IgHEL) mice carry transgenes encoding IgMa and IgDa heavy and light chains specific for HEL (30). C57BL/6 HEL transgenic mice were of the ML5 line, which carries a transgene encoding HEL under the metallothionine promotor and contains HEL at 10–30 ng/ml in serum (30). C57BL/6 MD4 and ML5 transgenic mice were mated to obtain double-transgenic (IgHEL/HEL) mice. Transgenic mice were screened by tail bleeding, followed by flow cytometry analysis to assess the Ig or double-transgenic nature of B cells, as previously described (31). C57BL/6 mice were obtained from Jackson ImmunoResearch (West Grove, PA). For activation experiments, 6–10-wk-old IgHEL or nontransgenic mice were injected i.p. with 4.5 mg HEL, 200 µg anti-CD40 mAb, or 200 µg control rat mAb in RPMI 1640 medium.

Clone identification and sequence analysis

Advanced BLAST searches of the NCBI mouse expressed sequence tag (EST) database using TBLASTN (32) with the respective template, retrieved mouse ESTs for RGS1, RGS2, RGS3s, RGS3p, and RGS14, as indicated in the result section. The indicated mouse EST clones were obtained from Genome Systems (St. Louis, MO) as EcoRI-NotI inserts in the pT7T3-Pac vector, and sequenced. Similarity scores were calculated using Clustalw with the Blosum matrix. To obtain a probe for detecting RGS14 expression, the database was searched with the mouse cDNA sequence that had previously been deposited in GenBank (Accession U85055). One EST clone was identified (AA981480) containing the 3'-untranslated region and sequence encoding the C-terminal 5 aa of mouse RGS14.

Expression of murine RGS proteins

GFP-RGS fusion proteins were generated by cloning cDNA fragments encoding the open reading frame of RGS1, RGS2, or RGS3 into the pEGFP-C1 plasmid (Clontech, Palo Alto, CA). To adapt the respective cDNA in frame to the sequence encoding EGFP, compatible restriction sites were introduced by PCR at the 5' and 3' end of the coding region in the RGS cDNAs. In addition, a truncated version of RGS1 was designed that retains the N-terminal 60 aa, but lacks the RGS domain. Primers used were as follows (written 5'-3'): RGS1or RGS1T60 sense, CCGGGATCCAGATCTCCAGGAATGTTCTTTTCTGCTAGCCCAAAGG; RGS1 antisense, CGCGGATCCACTAGTCTGTCAGCCAGGAATCACTCACTTTAAAGT; RGS1T60 antisense, GTTCTGCAGTCAAAGTATGTCTTTGGACTTGGCCGATTTC; RGS2 sense, CCGTCTCGAGCTCAAAGTGCCATGTTCCTGGCTGTCC, and antisense, CGCGGATCCGGGGGACTCCTGGTCTCATGTAGC; and RGS3s sense, CCGTCTCGAGCTCTCCGAGGCATGTACCTCACACGCA, and antisense, CGCGGATCCGGATACTGGTGGTCCCTAGAGCGG. Cloning sites used were for RGS1 BglII-BamHI, for RGS1T60 BglII-PstI, and for RGS2 and RGS3s XhoI-BamHI. Obtained expression constructs were verified by sequence analysis.

Cell culture and transient transfection

The murine B cell lines were maintained in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, 50 µg/ml streptomycin, 50 U/ml penicillin, 10 mM HEPES, and 50 µM 2-ME. 2PK3 and 300-19 cells were transfected by electroporation with the following amounts of plasmid DNA: 10 µg pEGFP-C1, 30 µg pEGFP-C1-mRGS1, 40 µg pEGFP-C1-mRGS1T60, 40 µg pEGFP-C1-mRGS2, and 30 µg pEGFP-C1-mRGS3s. Cells (1–1.5 x 107 in 0.4 ml) were pulsed at 250 V and 960 µF. Assays were started 10–14 h after transfection.

Cell purification and flow cytometry

Mouse lymphocyte cell suspensions were obtained from spleen or lymph node by passing teased tissues through a 70-µM cell strainer (Falcon; Becton Dickinson, Franklin Lakes, NJ). B cells were purified from spleen cell suspensions by staining non-B cells with anti-CD43 biotin and anti-CD11c biotin (PharMingen, San Diego, CA) and depletion using streptavidin-MACS beads and a MACS (Miltenyi Biotec, Auburn, CA). T cells were isolated from spleen or lymph nodes by staining non-T cells with biotinylated Abs to B220, Mac-1 (Caltag Laboratories, Burlingame, CA), CD11c, and Gr-1 (PharMingen), followed by depletion by MACS. Flow cytometry analysis on a FACScan (Becton Dickinson, San Jose, CA) confirmed that purity of the isolated B cells was >92% B220+ cells, and of isolated T cells >93% CD4+ or CD8+ cells. When mice were challenged with HEL or anti-CD40 mAb before isolation of B cells, purified B cells were also tested for the induction of CD69 using anti-CD69 FITC (PharMingen). For integrin and CXCR5 expression analysis, the following Abs were used: anti-CD11a (LFA-1 {alpha}L chain) biotin (PharMingen), followed by streptavidin-PE (Caltag); anti-CD29 (ß1 integrin chain), followed by anti-hamster IgG PE (PharMingen); and anti-CXCR5 (Burkitt’s lymphoma receptor 1) (33), followed by anti-rabbit Ig biotin (PharMingen) and streptavidin PE.

Northern blot analysis

A total of 10–15 µg of RNA from mouse tissues or purified cells was subjected to gel electrophoresis and transferred to a Hybond-N+ membrane (Amersham Pharmacia Biotech, Piscataway, NJ). Blots were probed successively with random-primed 32P-labeled mouse DNA probes (>2 x 106 cpm/ml) at 65°C for 1–4 h in ExpressHyb solution (Clontech). Membranes were washed according to the manufacturer’s instructions, exposed to a Phosphor-Screen (Molecular Dynamics, Sunnyvale, CA), and quantified by PhosphorImager analysis. The cDNA fragments used as probes were from the mouse EST clones in the pT7T3-Pac vector, as follows: RGS1 XbaI-PvuII (809 bp); RGS2 BstXI-BanII (605 bp); RGS3 XhoI-HindIII (359 bp; the XhoI site is in the vector polylinker; the fragment encodes aa 222–316 of the predicted full-length mouse RGS3 protein); RGS3s AvrII-XmaI (197 bp; this probe includes 145 bp specific to RGS3s); and RGS14 EcoRI-NdeI (480 bp; the EcoRI site is in the vector polylinker). To control for loading and RNA integrity, membranes were reprobed with a mouse elongation factor-1{alpha} probe.

Chemotaxis assay

Chemotaxis assays were performed in 5-µm Transwell plates (Corning Costar, Cambridge, MA). Transfected cells were collected and resuspended in RPMI 1640 containing 0.5% BSA and 10 mM HEPES (migration media) at a concentration of 7.5 x 106/ml (live cells). Chemokines were resuspended in migration media to the indicated concentration, and 600 µl was aliquoted into 24-well plates forming the bottom chamber during the assay. The 5-µm-pore polycarbonate Transwell inserts were transferred to the wells containing media alone or plus chemokine, 100 µl of cells were added into the Transwell insert (top chamber), and cells were allowed to migrate through the porous bottom for 3 h at 37°C. Cells that migrated to the bottom chamber were enumerated, and GFP-positive cells were identified by collecting events for a fixed time (60 s) on a FACScan. By counting a 1/5 dilution of input cells in the same manner, the absolute number of cells that migrated to the bottom chamber could be determined. The percentage of migrated cells was calculated by dividing the number of transmigrated GFP-negative, GFP-dull, and GFP-bright cells by the number of input cells expressing the same GFP levels. Each data point is the mean of duplicate wells. To simplify the comparison between the different transfected cell populations, the GFP-negative fractions of each GFP-RGS-transfected cell population were normalized to the GFP-negative fraction of the control GFP-transfected cells. This was achieved by first determining the percentage of input GFP-negative cells that migrated in the control GFP-transfected population and then dividing this number by the percentage of input GFP-negative cells that migrated in each GFP-RGS-transfected population. The percentage of cells in each of the GFP-negative, dull, and bright gates that migrated was then multiplied by this number. The data presented for the different GFP-RGS-transfected population in the GFP-dull and GFP-bright compartment are the mean from duplicate wells normalized to the migration of GFP-negative cells in the same wells. Dead cells identified by their decreased forward scatter were not included in the analysis.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of murine RGS1 and 3 and a novel RGS3 variant

To study the expression and function of murine RGS1 and RGS3, we searched the mouse NCBI EST database by using human RGS1 (22, 23), or human RGS3 (13) as a template. Twelve mouse ESTs homologous to human RGS1 were identified (AA154742, AA110076, AA120409, AA118893, AA199350, AA289401, AA200913, AA547074, AA608105, AA561820, AA915687, and AA684124) that could be aligned into a contig, and sequence analysis of clone AA154742 revealed a cDNA of 1274 bp encoding a predicted protein of 196 aa (Fig. 1GoA). The high nucleotide identity (76%) and amino acid identity (87%) of this sequence with human RGS1 (Fig. 1GoA) support its designation as murine RGS1. The search for mouse RGS3 led to identification of EST clones W49391, AA880930, and AA789696 that contained a 3'-untranslated region and nucleotides encoding for 297 aa homologous to the C terminus of human RGS3. This partial mouse RGS3 cDNA showed 90% amino acid identity to human RGS3 (aa 222–519 of human RGS3) and 79% nucleotide identity (nt 591-2638 of human RGS3). We also identified three ESTs (AA278130, AA717912, and AI529982) encoding a novel variant of RGS3 that lacks the N-terminal 326 aa encoded by exon 3 in human RGS3 (34) and contains an alternative 5' region encoding 21 aa, giving rise to a predicted protein of 192 aa (Fig. 1GoB). A search of the human EST database revealed two ESTs (H08458 and N87218) encoding an identical NH2-terminal region to that identified in the short form of mouse RGS3 and also containing highly similar 5'-untranslated sequence (data not shown). The existence of this variant RGS3 sequence in both mouse and human indicates a conserved role and leads us to name this form of RGS3 as RGS3s. Finally, we isolated and sequenced mouse RGS2 from the EST clone AA221794. The sequence was found to differ from the previously reported mouse RGS2 cDNA (35) by 4 nt in the coding region. The EST cDNA contained the nucleotides GG instead of CC at position 137/138 and GC instead of CG at position 254/255, and these changes alter the amino acid sequence at four positions (Fig. 1GoA). The new sequence at these positions is identical to the sequence in human RGS2, indicating that human and mouse RGS2 may differ by as little as 8 aa (96% amino acid identity). When the mouse RGS protein sequences were aligned together with their human counterparts (Fig. 1Go), it was apparent that the RGS domains were highly conserved, with 11 aa changes between mouse RGS1 and human RGS1, 7 between mouse RGS3 and human RGS3, and only 1 difference between mouse RGS2 and human RGS2.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 1. Murine RGS1, RGS2, and RGS3 protein sequences and alignment with corresponding human RGS sequences. A, Alignment of mouse RGS1 (mRGS1) protein sequence with those of human RGS1 (hRGS1), mouse RGS2 (mRGS2), and human RGS2 (hRGS2). Residues shaded in gray refer to the changes in the amino acid sequence found between mRGS2 and the previously published mRGS2 cDNA (U67187). B, Alignment of RGS3 protein sequences. The short isoform of mouse RGS3 (mRGS3s) and the C-terminal portion of full-length human RGS3 (hRGS3) (aa 327–519, encoded by exons 4–8) were aligned to the partial cDNA clone of murine RGS3 (mRGS3p). The boxed sequence refers to the unique region present in RGS3s. Identical amino acids to mRGS1 (A) or mRGS3p (B) are shown as hyphens, and dots represent gaps inserted for optimal alignment. The line above the amino acid sequences indicates the region of the RGS domain. Numbering is with respect to the first amino acid of the full-length protein. These sequence data are available from GenBank/EMBL/DDBJ under accession numbers AF215667 (mRGS1), AF215668 (mRGS2), AF215669 (mRGS3s), and AF215670 (mRGS3).

 
Tissue distribution of murine RGS1, RGS2, RGS3, and RGS14 transcripts

Human or rat molecules of RGS1, RGS2, RGS3, and RGS14 have been reported to be expressed in lymphoid tissues (22, 23, 24, 26). To examine the expression pattern of these RGS members in murine lymphoid tissues, Northern blot analyses were performed (Fig. 2Go). RGS1 was most abundant in spleen, lymph node, and intestine, with moderate expression in Peyer’s patches and skeletal muscle. The high expression in RAG1-/- spleen indicates that a significant amount of the constitutive RGS1 expression in spleen is in non-B or T lymphocytes, and consistent with this, purified T cells expressed only intermediate amounts of RGS1, and expression in purified B cells was low to undetectable (Figs. 2GoA and 3B). Low expression of RGS1 was also detected in thymus, lung, peritoneal cells, white blood cells, and bone marrow cells (Fig. 2GoA). Comparison of two murine B cell lines, the 300-19 pre B cell line (36) and the IgG+ mature B cell line, 2PK3 (37), revealed a striking difference in RGS1 levels, with strong expression in the 300-19 cells, but no detectable expression in 2PK3 cells (Fig. 2GoA). RGS2 was found to be strongly expressed in brain, heart, lung, spleen, white blood cells, and bone marrow cells (Fig. 2GoA) in accordance with previous studies (35). Again strong expression was detected in RAG1-/- spleen and expression was low in purified lymphocytes. However, in contrast to RGS1, basal RGS2 expression was detected in freshly isolated B cells, and this level was typically higher than in T cells (Fig. 2GoA). 300-19 pre-B cells expressed detectable levels of RGS2, whereas the 2PK3 cell line differed from mature B cells in lacking measurable RGS2 (Fig. 2GoA). Analysis of full-length (~3.5-kb) mouse RGS3 transcripts revealed their presence in most tissues, with lymphoid tissues typically expressing high levels (Fig. 2Go, A and B). B and T lymphocytes also appeared to make only a small contribution to total splenic RGS3 based on expression levels in RAG1-/- spleen, although RGS3 expression was evident in both subsets of lymphocytes (Figs. 2Go, A and B, and 3B). The 300-19 and 2PK3 cell lines expressed little mouse RGS3 (Fig. 2Go, A and B). Mouse RGS3s (~1.8 kb) was also expressed in most lymphoid tissues, but typically at lower levels than full-length RGS3 (Fig. 2GoB). High expression of mouse RGS3s was detected in heart, brain, and lung (Fig. 2GoB). Finally, RGS14 expression was examined because of a report indicating it was highly expressed in rat spleen (26). Mouse RGS14 was constitutively present at high levels in most lymphoid tissues and cells, including thymus, spleen, lymph node, peritoneal cells, white blood cells, and bone marrow cells. High basal expression was detected in freshly purified B and T lymphocytes, and consistent with this, the level of RGS14 was reduced in total RNA from RAG1-/- spleen compared with wild-type spleen (Fig. 2GoA). Low expression of RGS14 was detected in Peyer’s patches, lung, heart, skeletal muscle, intestine, and the 2PK3 and 300-19 cell lines (Fig. 2GoA).



View larger version (86K):
[in this window]
[in a new window]
 
FIGURE 2. Expression pattern in mouse tissues of RGS1, RGS2, RGS3, and RGS14. Northern blot analysis of total RNA showing levels of RGS1, RGS2, RGS3, and RGS14 mRNA (A) and RGS3 and RGS3s mRNA (B) in the indicated cells and tissues. As a control for RNA loading, the blots were hybridized with an EF1-{alpha} probe. BM, bone marrow; mlN, mesenteric lymph nodes; PP, Peyer’s patches; Spl, spleen; skel, skeletal. The tissue from which the B or T cells were isolated is indicated in parentheses.

 
RGS expression is dynamically regulated in in vivo activated B cells

To analyze the expression pattern of RGS1, RGS2, RGS3, and RGS14 during Ag stimulation of B lymphocytes, we used IgHEL transgenic mice carrying Ig heavy and light chain transgenes encoding IgMa and IgDa specific for the protein Ag HEL (30). Consistent with previous studies reporting spontaneous changes in RGS1 and RGS2 in human PBMC following in vitro culture (25), we found that expression of RGS1, 2, and 14 underwent rapid changes in murine B cells upon in vitro culture (data not shown). To circumvent this problem, B cells were activated in vivo by i.p. challenge of IgHEL transgenic mice with HEL, and splenic B cells were then purified at various time points and used directly for RNA preparation. Intraperitoneal injection of HEL Ag was effective in activating splenic B cells in an Ag-specific manner, as established by the increase in expression of the activation marker CD69 on B cells in IgHEL transgenic mice, but not in nontransgenic mice (Fig. 3GoA, left panels). Northern blot analysis of total RNA from the isolated B cell populations revealed marked differences in the pattern of RGS molecule expression (Fig. 3Go, B and C). RGS1 transcripts were expressed at very low levels in B cells from unchallenged mice, but were rapidly induced to high levels after in vivo exposure of IgHEL transgenic B cells to HEL Ag (Fig. 3Go, B and C) and persisting at elevated levels for at least 6 h (Fig. 3Go, B and C). The time course of RGS2 induction in HEL-stimulated IgHEL B cells was similar, except RGS2 mRNA levels became elevated only ~2-fold over quiescent levels compared with about a 40-fold increase in RGS1 transcript levels (Fig. 3GoC). In marked contrast, RGS3 and RGS14 transcripts were present in naive B cells at substantial levels and HEL stimulation suppressed expression (Fig. 3Go, B and C). Although RGS3 mRNA was only moderately down-regulated in response to HEL activation, to about half basal levels, RGS14 transcripts showed a more substantial 6-fold decrease. Thus, the RGS1 and RGS2 genes vs the RGS3 and RGS14 genes exhibit reciprocal patterns of expression in naive and Ag-stimulated B cells in vivo.



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 3. Altered expression of RGS molecules after BCR and CD40 stimulation in mouse B cells. A, Time course of CD69 expression in IgHEL B cells exposed in vivo to HEL (left panel, top) or nontransgenic B cells exposed in vivo to anti-CD40 mAbs (right panel, top). CD69 induction in response to HEL is specific for IgHEL transgenic B cells and was not detected in nontransgenic B cells (left panel, bottom). The effect of anti-CD40 mAb was also specific and did not occur after challenge with a control rat mAb (right panel, bottom). Mice were challenged for 6 h (bottom panels) or the indicated times (top panels). B–F, Northern blot analyses showing levels of RGS1, RGS2, RGS3, and RGS14 mRNA in quiescent and activated B cells isolated from spleen tissues of the indicated mice. As a control for RNA loading, the blots were hybridized with an EF1-{alpha} probe. B, Time course of RGS gene expression in IgHEL B cells before (0 h) or after 2, 6, 12, or 24 h of in vivo exposure to HEL. C, Quantification of relative RGS mRNA levels at the 0-, 2-, and 6-h time points from the Northern blot shown in B and additional blots. Relative RGS mRNA levels were determined by PhosphorImager analysis of the Northern blots and were normalized to the value obtained for the EF1-{alpha} mRNA level. Data show the fold change in RGS mRNA level relative to the mean value of the unstimulated (0-h) cells. Data for individual mice are shown as white dots and means as black bars. n, Indicates the number of individual mice. Statistical analysis by Student’s t test; comparing activated cells to the untreated controls was as follows: RGS1 at 2 and 6 h (p < 0.005); RGS2 at 2 h (p < 0.01) and 6 h (p < 0.005); and RGS14 at 2 and 6 h (p < 0.001). The decrease in RGS3 expression at 2 and 6 h was not statistically significant (p < 0.5). D, Expression of RGS genes in B cells after in vivo challenge of nontransgenic mice with anti-CD40 mAb for the indicated times. Two independent experiments are shown. E, Northern blot analysis of RGS expression in B lymphocytes freshly isolated from spleens of IgHEL transgenic or IgHEL/HEL double (Dbl)-trangenic mice. Numbers refer to individual mice analyzed. F, Relative RGS mRNA levels of the Northern blot shown in E and similar blots. Quantification was as in C.

 
To explore the specificity of RGS induction in B cells during the response to Ag challenge, we also tested the effect of in vivo stimulation by CD40 using an agonistic anti-CD40 Ab (29). In contrast to the initial follicular exclusion of B cells in response to B cell receptor (BCR) signaling, CD40 signaling is associated with B cell migration into follicles and formation of germinal centers (39). Consistent with previous studies using anti-CD40 in vivo (40), we found that treatment with anti-CD40 Ab, but not with a control IgG Ab, was effective in causing activation of splenic B cells (Fig. 3GoA, right panels). In striking contrast to the effects of activation by Ag, challenge of mice with anti-CD40 mAb for various times did not change RGS1 expression in B cells and caused a modest decrease in RGS2 mRNA levels (Fig. 3GoD). RGS3 and RGS14 transcripts appeared to be transiently reduced in response to CD40 stimulation, as observed for BCR-activated B cells.

Chronic exposure of B cells to self Ag leads to a state of anergy and causes changes in cell migration and survival (2). To examine the effect of chronic self Ag exposure on the expression levels of RGS mRNA in B cells, B lymphocytes were isolated from IgHEL/HEL double-transgenic mice. These mice carry in addition to the IgHEL transgenes a second transgene encoding soluble HEL as a circulating self Ag in a form and amount sufficient to trigger anergy, but not deletion (30). In chronically stimulated B cells isolated from IgHEL/HEL double-transgenic mice, levels of RGS1 and RGS2 transcripts were elevated by about 2- or 3-fold, respectively (Fig. 3Go, E and F). Interestingly, the extent of up-regulation was reciprocal to that observed following acute activation: RGS2 transcript levels were relatively higher in chronically vs acutely activated B cells, whereas RGS1 levels were substantially lower in the chronically activated B cells. Both RGS3 and RGS14 appeared to be expressed at slightly reduced levels in chronically stimulated compared with naive B cells (Fig. 3Go, E and F), although the reductions appeared less marked than seen in acutely activated B cells.

RGS1 and RGS3 inhibit chemotaxis of transfected B cell lines to lymphoid chemokines

To test whether RGS1, RGS2, or RGS3 could regulate B cell chemotactic responses to lymphoid chemokines, we first sought to identify a transfectable B cell line that was responsive to BLC, ELC, and SDF-1. We compared the 300-19 pre-B cell line previously used in chemotaxis studies (41), with the IgM+ WEHI231 B cell line (42), the IgG+ mature B cell lines A20 (43) and 2PK3 (37), the surface Ig-negative M12 B cell line (43), and the J558L plasmacytoma cell line (44). Using 5-µM-pore Transwell chemotaxis chambers, we found that the 2PK3 cell line responded well to all three lymphoid chemokines, whereas 300-19 pre-B cells responded only weakly to SDF-1 and ELC and failed to respond to BLC. Among the other cell lines, A20 and J558L cells showed little ability to migrate to any of the chemokines, M12 cells exhibited high background migration but were able to respond to SDF-1 and BLC, and WEHI231 cells responded to SDF-1 and weakly to BLC and ELC (data not shown). 2PK3 cells were therefore chosen for most of our experiments, although, because of their previous characterization, 300-19 cells were also tested in some cases. To be able to measure quantitatively levels of transfected RGS protein, we tagged the N terminus of mouse RGS1, mouse RGS2, and mouse RGS3s with green fluorescent protein (GFP). 2PK3 cells were transiently transfected with the chimeric GFP-RGS constructs or as controls with GFP or GFPmRGS1T60, a RGS1 chimera that lacks the RGS domain and hence the GAP activity of the molecule (Fig. 4GoA). The chemotactic response of transfected cells to BLC, ELC, or SDF-1 was measured in Transwell migration assays, and the migratory cells were divided into those expressing intermediate (GFP-dull, second quadrant) or high (GFP-bright, third quadrant) amounts of RGS-GFP fusion protein. During our analysis, we found that each batch of transfected cells showed differences in the overall migration levels, assessed by the response of the GFP-negative cells in each population. To compensate for this, the migration of each transfected population was normalized so that the response of the GFP-negative cells was matched (see Materials and Methods). We found that mouse RGS1 was a strong inhibitor of the migratory response to both ELC and BLC when expressed at sufficiently high levels (GFP-bright) (Fig. 4GoB), inhibiting migration by about 90% at all concentrations of BLC or ELC compared with migration of control cells expressing GFP alone (Fig. 4GoB). The inhibition was dose dependent, as cells expressing lower amounts of RGS1 molecules (GFP-dull) were less compromised in their response to ELC or BLC, demonstrating an inhibition of about 60% (Fig. 4GoB). The inhibitory effect observed was strongly dependent on the RGS domain, as the truncated GFPmRGS1T60 molecule had little effect (Fig. 4GoB). Similar to RGS1, expression of mouse RGS3s also inhibited migration to ELC and BLC, although the inhibition was less pronounced, being 20–23% at low RGS3s expression (GFP-dull) and about 70% at higher RGS3s expression levels (GFP-bright). Both RGS1 and RGS3s limited 2PK3 cell chemotaxis to SDF-1, but to a lesser extent than in response to ELC or BLC (Fig. 4GoB). In agreement with RGS1 and RGS3s inhibiting chemotaxis through effects on chemokine responsiveness rather than by causing changes in other molecules needed for the chemotactic response, flow-cytometric analysis showed that levels of LFA-1, ß1 integrin, and CXCR5 in the transfected cells were unchanged (Fig. 5Go). In contrast with the effect of mouse RGS1 and mouse RGS3s, mouse RGS2 had weak effects on 2PK3 cell chemotaxis. Compared with the RGS domain-deficient GFPmRGS1T60 construct, GFPmRGS2 had no effect on the response to SDF-1 and only a small effect on the response to BLC and ELC (Fig. 4GoB). These findings for RGS2 are consistent with other studies suggesting RGS2 is relatively specific for G{alpha}q family members and has little activity against G{alpha}i proteins (16, 45). To confirm that the GFPmRGS2 protein was active as a GAP, we tested its ability to inhibit signaling by the G{alpha}q-coupled M1 muscarinic receptor. Jurkat cells stably expressing the M1 receptor (46) were transiently transfected with GFPmRGS2 or GFP alone, and the GFP-bright cells were tested for ability to flux calcium in response to the M1 receptor agonist, carbachol. A substantial reduction in the calcium flux was observed in the RGS2-transfected cells compared with cells containing GFP alone (data not shown), providing strong evidence that the GFPmRGS2 protein was functional.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 4. RGS1 and RGS3 negatively regulate chemotaxis of 2PK3 cells and 300-19 cells to lymphoid chemokines. A, Flow cytometry of GFP levels in 2PK3 cells transiently transfected with either GFP, GFPmRGS1, GFPmRGS1T60, GFPmRGS2, or GFPmRGS3s expression vectors. Relative GFP expression is indicated by N, D, and B, which refers to GFP-negative, GFP-dull, or GFP-bright gates. The GFP-negative population encompassed 63–81% of total live cells, the GFP-dull gate 13–17%, and the GFP-bright gate 11–16%, except for the GFPmRGS2-bright population that contained ~4% of total live cells. The expression levels shown are from the input cell populations of the ELC experiment in B. Similar expression levels were observed in every experiment. B, Regulation of chemotactic activity by RGS proteins in transiently transfected 2PK3 cells. Cells were transiently transfected with pEGFP-C1 containing no insert (GFP alone) ({diamond}), mouse RGS1 ({blacksquare}), mouse RGS2 ({blacktriangleup}), mouse RGS3s (•), or mouse RGS1T60, which does not contain the RGS domain ({square}). Transfected cell populations were subjected to chemotaxis through 5-µm-pore Transwell filters. The number of input and migrated cells in each GFP gate, as outlined in A, was determined by flow cytometry. Results are expressed as the percentage of input cells in each GFP gate that migrated to the bottom chamber. The data were normalized to the GFP-negative populations, as described in Materials and Methods. C, Effects of RGS1 and RGS1T60 on 300-19 cell chemotaxis to SDF-1. 300-19 cells were transiently transfected with GFP, GFPmRGS1, or GFPmRGS1T60, and chemotaxis was measured as described for 2PK3 cells in B. The results in B are representative of three or four independent experiment, and data points represent the mean of assay points performed in duplicate; and results in C are the mean of seven experiments with data points performed in duplicate.

 


View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 5. RGS1 and RGS3s do not alter surface integrin or CXCR5 expression. Cell surface expression of LFA-1, ß1 integrin, and CXCR5 by 2PK3 cells transiently transfected with GFPmRGS1 and GFPmRGS3s, as indicated, 13 h after transfection. GFPmRGS1- or GFPmRGS3s-transfected 2PK3 cells were gated on the GFP-negative (dotted line) or GFP-bright (thick solid line) populations, as described in Fig. 4GoA to compare RGS-negative vs RGS-expressing cells. Control staining without primary Ab (for ß1 integrin or CXCR5 staining) or with a control biotinylated rat IgG (for LFA-1 staining) in the GFP-negative (thin solid line) or the GFP-bright (dashed line) gate shows the background level of fluorescence.

 
To test whether RGS1 could also down-modulate chemotaxis of 300-19 cells, we transiently transfected the cells with GFPmRGS1 or the control GFPmRGS1T60 construct, and tested the chemotactic response to SDF-1 (Fig. 4GoC). Notably, although expression of GFPmRGS1 had an inhibitory effect on 300-19 cell migration (Fig. 4GoC), the effect was not as strong as in 2PK3 cells, with about 30% inhibition for GFP-dull cells and 50% inhibition for GFP-bright cells. In this regard, it is important to note that 300-19 cells, in contrast to 2PK3 cells, express substantial levels of endogenous RGS1 mRNA (Fig. 2GoA). High endogenous RGS1 protein expression might cause this inhibitory pathway to be near saturation even without the introduction of further RGS1 by transfection. In agreement with this possibility was the very low chemotactic response to SDF-1 of untransfected 300-19 cells compared with 2PK3 cells. At optimal SDF-1 concentrations, only 1% of total 300-19 cells migrated (Fig. 4GoC) compared with 35% of total 2PK3 cells (Fig. 4GoB). Interestingly, transfection of 300-19 cells with the GFPmRGS1T60 mutant caused an increase in the migration to SDF-1 compared with cells transfected with GFP alone (Fig. 4GoC). This effect was not seen in the 2PK3 cells that do not express endogenous RGS1 (Fig. 4GoB). As RGS1T60 lacks the GAP activity of RGS1, but retains the unique NH2-terminal region, it may compete with endogenous RGS1 for receptor/G{alpha}i association, while being unable to negatively regulate G{alpha}i responses. Taken together, these findings provide evidence that the endogenous RGS1 gene can be expressed at sufficient levels to have effects on cell migration.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The findings above establish that in vivo activation of B lymphocytes by Ag promotes rapid up-regulation of RGS1 and RGS2 and decreased expression of RGS3 and RGS14. Self-reactive B cells that have been chronically exposed to autoantigen have a small constitutive elevation in expression of RGS1 and RGS2. In transfection studies in a mature B cell line, RGS1 and RGS3s, but not RGS2, strongly inhibit the G{alpha}i-dependent chemotactic response to lymphoid chemokines BLC, ELC, and SDF-1. These observations suggest that Ag receptor-induced changes in RGS molecule expression may function to regulate B cell responsiveness to lymphoid chemokines and thereby help direct cell-positioning events in lymphoid organs.

To study the activity of RGS1 and RGS3 molecules in regulating chemokine responsiveness in murine lymphocytes, it was first necessary to isolate their mouse homologues. A single form of mouse RGS1 was identified in the EST database that was similar over its entire length to its human homologue. In addition to a conserved RGS domain, this included an ~60-aa amino-terminal domain that is unique to RGS1. Searches for mouse homologues of RGS3 led to identification of two forms of RGS3, a partial clone that appeared to correspond to full-length human RGS3, and several clones encoding a short form of mouse RGS3. Human ESTs encoding an analogous short form of human RGS3 were also identified, and we have designated this new RGS3 variant as RGS3s. In this variant, the amino-terminal 348 aa encoded by exons 3 and 4 of human RGS3 (34) are replaced by a predicted 21-aa domain (Fig. 1GoB). The 5' untranslated sequence of mouse and human RGS3s is also highly conserved and is distinct from sequence previously reported in human RGS3 exon 1, 2, or 3 (data not shown). The mechanisms leading to the expression of this new form of RGS3 are presently unclear, although they presumably involve splicing of one (or more) novel exon to the splice acceptor of what has previously been defined in human RGS3 as exon 5 (34). Future genomic sequence analysis should establish how many exons make up the unique region of RGS3s as well as determining their location with respect to the previously defined exons. Interestingly, a truncated version of RGS3 (termed RGS3T) has previously been identified by 5' race analysis (47). The untranslated sequence of RGS3T was found to begin within exon 3, and translation was suggested to start at either of three ATG codons within the 3' end of exon 3. The RGS3s sequence defined in this study is distinct from the predicted RGS3T because RGS3s contains sequence (and putative exons) not present in the original RGS3, whereas the sequence encoded within RGS3T, although truncated, is identical to the original RGS3. Because RGS3s and RGS3T transcripts appear to be of similar size, they may both contribute to the prominent lower m.w. RGS3 hybridization bands seen on Northern blots of human heart, brain, lung, kidney, and liver RNA (13, 38). As discussed further below, the different amino-terminal regions may have significant effects on the function of RGS3. Thus, in future studies, it will be important to determine the relative amounts of the different RGS3 isoforms in B cells and other cell types.

By expressing GFP fusion proteins of RGS1, RGS2, and RGS3s in the 2PK3 B lymphoma cell line, we have been able to establish that RGS1 and RGS3s antagonize chemotactic responses mediated by SDF-1, BLC, and ELC, chemokines that signal through three different receptors (CXCR4, CXCR5, and CCR7, respectively). By contrast, RGS2 had only limited effects, causing slight reductions in the response to BLC and ELC and little or no reduction in SDF-1 responses. These findings are in close agreement with a recent report from Bowman et al., who found that human RGS1, 3, and 4, but not human RGS2, diminished the chemotactic response of transfected L1.2 pre-B cells to fMLP, IL-8, and monocyte chemoattractant protein-1 (48). In another recent study, RGS3 was shown to antagonize the migratory response of intermedullary collecting duct kidney cells to lysophosphatidic acid (49). Interestingly, in the study of Bowman et al., RGS3 was more effective at inhibiting chemokine responses than RGS1 (48), whereas in our experiments, the RGS1 construct was more effective than the RGS3 construct (Fig. 4Go). These differences may reflect specific properties of the transfected cell lines (L1.2 vs 2PK3 and 300-19) or of the different chemokine receptors under study. However, it should be noted that the construct used by Bowman et al. contained the original large RGS3 isoform, whereas our construct was made with the shorter RGS3s variant. The NH2-terminal domain of RGS3 has recently been shown to translocate to cell membranes in response to increases in intracellular calcium (17), suggesting it may enhance the ability of RGS3 to inactivate membrane-associated G proteins. It therefore seems possible that the stronger inhibitory effect of RGS3 than RGS3s reflects intrinsic differences in the G{alpha}i inhibitory properties of the two proteins. In addition to effects on chemotactic responses, RGS1, 2, and 3 have previously been shown to inhibit IL-8-induced activation of extracellular signal-regulated kinase (ERK) in transfected 293T cells (13). In biochemical studies, RGS1 and 3 functioned as GAPs for G{alpha}i (50, 51), whereas RGS2 was more effective as a GAP for G{alpha}q (16, 45). However, some studies have indicated that RGS1 and RGS3 can also have functional effects on G{alpha}q family members (16, 17, 18, 47), and RGS2 may be able to antagonize some G{alpha}i family members (13). Because the chemotactic response requires signaling by pertussis toxin-sensitive G{alpha}i-coupled receptors, our findings support the conclusion that RGS1 and 3 can function as GAPs for G{alpha}i molecules, whereas RGS2 is an inefficient GAP for this family of proteins.

The physiological relationship between BCR-induced changes in RGS molecule expression and changes in B cell responsiveness to chemokines is presently not understood. BCR triggering in B cells leads to a decrease in the magnitude of the response to the CXCR4 ligand, SDF-1, and an increase in the response to the CCR7 ligands, ELC and SLC (7, 52, 53). It seems possible that the rapid increase in RGS1 induced by BCR signaling works together with other processes, such as phosphorylation-mediated down-regulation of CXCR4 receptors (53), to decrease the chemotactic response to SDF-1. In this respect, it is noteworthy that germinal center B cells have high levels of RGS1 (22) and CXCR4, but fail to migrate to SDF-1 (52). Consistent with this is the low chemotactic response to SDF-1 of 300-19 pre-B cells, which express high constitutive levels of endogenous RGS1 (Figs. 2GoA and 4C). Likewise, the ability of the truncated form of RGS1 (RGS1T60) to augment the response of 300-19 pre-B cells to SDF-1 (Fig. 4GoC) indicates a possible physiological role for RGS1 in regulating CXCR4 responsiveness, because this deletion mutant might be expected to antagonize interactions needed for full-length RGS1 to function. 2PK3 cells did not have detectable endogenous RGS1 expression and, as predicted by this model, overexpression of RGS1T60 in these cells failed to augment the response to SDF-1. However, it remains to be established in which cell populations RGS1 regulates CXCR4 responsiveness in vivo.

Despite the increase in RGS1 message following BCR engagement and the ability of RGS1 to antagonize the response of transfected 2PK3 cells to ELC, chemotaxis of mature B cells to ELC is increased after BCR stimulation. This suggests that the action of RGS1 in inhibiting chemokine receptor-stimulated migration may be more selective in mature B cells than in the transformed 2PK3 cell line. RGS selectivity for responses mediated by particular chemokine receptors could arise at several levels, such as the G protein-coupling propensity of the chemokine receptor (54, 55), or through direct interaction of RGS molecules with chemokine receptors, as has been suggested in other GPCR systems (16, 19, 20). Alternatively, the levels of RGS1 induced in mature B cells by Ag may not be sufficient to inhibit the ELC response. Reciprocally, perhaps the small decrease in RGS3 expression that occurs in B cells activated in vivo by Ag contributes to the enhanced chemotactic response to ELC. The decreased expression of RGS14 might also be important in this enhancement, although it has yet to be shown whether RGS14 is an antagonist of chemokine-mediated chemotaxis. Alignment of the RGS14 GAP domain with other RGS molecules (data not shown) indicates is has highest similarity with RGS12, which can regulate G{alpha}i (19), consistent with a possible role for RGS14 in regulating chemotaxis.

Further to the changes in RGS expression in B cells activated acutely by Ag, small differences in RGS molecule expression were evident in chronically stimulated, anergic, B cells (Fig. 3Go). IgHEL/HEL double-transgenic mice contain fewer B cells than IgHEL transgenic mice, and the purity of the B cell preparations obtained from the double-transgenic animals is typically a few percentages lower than from IgHEL transgenic mice, making it possible that the differences seen in RGS molecule expression are due to differences in B cell purity. We think this unlikely, however, because if the elevation in RGS1 and 2 in anergic cells was attributable to contaminating cells, then it might be expected that RGS3 and 14 should also be elevated, as all four RGS molecules are expressed at high levels in total spleen cells (Fig. 2Go). Yet RGS3 and RGS14 levels were not elevated in the anergic cells and may even be reduced (Fig. 3Go). Previous studies in human PBMC have shown that RGS1 is strongly induced by phorbol esters, activators of the ERK pathway, whereas RGS2 is strongly up-regulated by treatment with ionomycin (25). Anergic B cells have a small constitutive elevation in ERK activity and in intracellular calcium (56), and these signals may therefore contribute to the elevated basal RGS1 and RGS2 expression. It seems possible that the differences in RGS1 molecule expression could contribute to the reduced competitiveness of anergic B cells for migrating into lymphoid follicles (57). The significance of the elevated RGS2 expression induced by acute and chronic Ag exposure remains an intriguing question because the role of signaling by G{alpha}q family molecules in B cells is poorly defined. One group has suggested that G{alpha}q molecules may regulate signaling via Bruton’s tyrosine kinase (Btk) (58, 59), raising the possibility that RGS2 functions in activated and anergic B cells to limit the extent of Btk activity.

In summary, our studies together with others suggest that regulated expression of RGS1 and RGS3, and possibly RGS14, plays a role in changing B cell responsiveness to chemokines during the response of B cells to foreign or self Ags. Alterations in RGS2 expression during acute and chronic B cell activation appear more likely to regulate other, presently unknown, GPCR signals in B cells. In future studies, it will be important to characterize whether the additional RGS family members that have recently been identified in lymphoid tissues, including RGS12 (19, 26) and RGS16 (27), are also modulated during B lymphocyte activation. A more complete understanding of RGS function in regulating B cell migration, differentiation, and tolerance will also require greater knowledge of the interplay between these proteins and other molecules, such as GPCR kinases, protein kinase Cs, protein kinase As, and arrestins, that also regulate GPCR signaling.


    Acknowledgments
 
We thank Paul Hyman for producing recombinant chemokines; A. Rolink for the anti-CD40 Ab; Cliff McArthur for calcium analysis on the MoFlo; and Mark Ansel, Eric Ekland, and Sanjiv Luther for comments on the manuscript.


    Footnotes
 
1 K.R. was supported by a European Molecular Biology Organization fellowship and is presently supported by a Human Frontier Science Program fellowship. J.G.C. is a Pew Scholar in the biomedical sciences. This work was supported by a grant from the National Institutes of Health (AI40098). Back

2 The sequences presented in this paper have been submitted to GenBank/EMBL/DDBJ under accession numbers AF215667 (mRGS1), AF215668 (mRGS2), AF215669 (mRGS3s), and AF215670 (mRGS3). Back

3 Address correspondence and reprint requests to Dr. Jason G. Cyster, Department of Microbiology and Immunology, 513 Parnassus Avenue, Box 0414, Room HSE301, University of California, San Francisco, CA 94143. Back

4 Abbreviations used in this paper: BLC, B lymphocyte chemoattractant; BCR, B cell receptor; ELC, EBV-induced molecule 1 ligand chemokine; ERK, extracellular signal-regulated kinase; EST, expressed sequence tag; GAP, GTPase-activating protein; GEF, nucleotide exchange factor; GFP, green fluorescent protein; GPCR, G protein-coupled receptor; HEL, hen egg lysozyme; RAG, recombination-activating gene; RGS, regulator of G protein signaling; SDF-1, stromal cell-derived factor-1; SLC, secondary lymphoid tissue chemokine. Back

Received for publication September 8, 1999. Accepted for publication February 18, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Cyster, J. G.. 1999. Chemokines and cell sorting in lymphoid organs. Science 286:2098.[Abstract/Free Full Text]
  2. Cyster, J. G.. 1997. Signaling thresholds and interclonal competition in preimmune B-cell selection. Immunol. Rev. 156:87.[Medline]
  3. Forster, R., A. E. Mattis, E. Kremmer, E. Wolf, G. Brem, M. Lipp. 1996. A putative chemokine receptor, BLR1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell 87:1037.[Medline]
  4. Gunn, M. D., V. N. Ngo, K. M. Ansel, E. H. Ekland, J. G. Cyster, L. T. Williams. 1998. A B-cell-homing chemokine made in lymphoid follicles activates Burkitt’s lymphoma receptor-1. Nature 391:799.[Medline]
  5. Legler, D. F., M. Loetscher, R. S. Roos, I. Clark-Lewis, M. Baggiolini, B. Moser. 1998. B cell-attracting chemokine 1, a human CXC chemokine expressed in lymphoid tissues, selectively attracts B lymphocytes via BLR1/CXCR5. J. Exp. Med. 187:655.[Abstract/Free Full Text]
  6. Yoshie, O., T. Imai, H. Nomiyama. 1997. Novel lymphocyte-specific CC chemokines and their receptors. J. Leukocyte Biol. 62:634.[Abstract]
  7. Ngo, V. N., H. L. Tang, J. G. Cyster. 1998. Epstein-Barr virus-induced molecule 1 ligand chemokine is expressed by dendritic cells in lymphoid tissues and strongly attracts naive T cells and activated B cells. J. Exp. Med. 188:181.[Abstract/Free Full Text]
  8. Gunn, M. D., K. Tangemann, C. Tam, J. G. Cyster, S. D. Rosen, L. T. Williams. 1998. A chemokine expressed in lymphoid high endothelial venules promotes the adhesion and chemotaxis of naive T lymphocytes. Proc. Natl. Acad. Sci. USA 95:258.[Abstract/Free Full Text]
  9. Nagasawa, T., T. Nakajima, K. Tachibana, H. Iizasa, C. C. Bleul, O. Yoshie, K. Matsushima, N. Yoshida, T. A. Springer, T. Kishimoto. 1996. Molecular cloning and characterization of a murine pre-B-cell growth-stimulating factor/stromal cell-derived factor 1 receptor, a murine homolog of the human immunodeficiency virus 1 entry coreceptor fusin. Proc. Natl. Acad. Sci. USA 93:14726.[Abstract/Free Full Text]
  10. Weiner, O. D., G. Servant, C. A. Parent, P. N. Devreotes, H. R. Bourne. 1999. Cell polarity in response to chemoattractants. , ed. Cell Polarity: Frontiers in Molecular Biology Oxford University Press, Oxford.
  11. De Vries, L., M. Mousli, A. Wurmser, M. G. Farquhar. 1995. GAIP, a protein that specifically interacts with the trimeric G protein G{alpha}i3, is a member of a protein family with a highly conserved core domain. Proc. Natl. Acad. Sci. USA 92:11916.[Abstract/Free Full Text]
  12. Koelle, M. R., H. R. Horvitz. 1996. EGL-10 regulates G protein signaling in the C. elegans nervous system and shares a conserved domain with many mammalian proteins. Cell 84:115.[Medline]
  13. Druey, K. M., K. J. Blumer, V. H. Kang, J. H. Kehrl. 1996. Inhibition of G-protein-mediated MAP kinase activation by a new mammalian gene family. Nature 379:742.[Medline]
  14. Dohlman, H. G., J. Song, D. Ma, W. E. Courchesne, J. Thorner. 1996. Sst2, a negative regulator of pheromone signaling in the yeast Saccharomyces cerevisiae: expression, localization, and genetic interaction and physical association with Gp{alpha}1 (the G-protein {alpha} subunit). Mol. Cell. Biol. 16:5194.[Abstract]
  15. De Vries, L., M. Gist Farquhar. 1999. RGS proteins: more than just GAPs for heterotrimeric G proteins. Trends Cell Biol. 9:138.[Medline]
  16. Xu, X., W. Zeng, S. Popov, D. M. Berman, I. Davignon, K. Yu, D. Yowe, S. Offermanns, S. Muallem, T. M. Wilkie. 1999. RGS proteins determine signaling specificity of Gq-coupled receptors. J. Biol. Chem. 274:3549.[Abstract/Free Full Text]
  17. Dulin, N. O., A. Sorokin, E. Reed, S. Elliott, J. H. Kehrl, M. J. Dunn. 1999. RGS3 inhibits G protein-mediated signaling via translocation to the membrane and binding to G{alpha}11. Mol. Cell. Biol. 19:714.[Abstract/Free Full Text]
  18. Neill, J. D., L. W. Duck, J. C. Sellers, L. C. Musgrove, A. Scheschonka, K. M. Druey, J. H. Kehrl. 1997. Potential role for a regulator of G protein signaling (RGS3) in gonadotropin-releasing hormone (GnRH) stimulated desensitization. Endocrinology 138:843.[Abstract/Free Full Text]
  19. Snow, B. E., R. A. Hall, A. M. Krumins, G. M. Brothers, D. Bouchard, C. A. Brothers, S. Chung, J. Mangion, A. G. Gilman, R. J. Lefkowitz, D. P. Siderovski. 1998. GTPase activating specificity of RGS12 and binding specificity of an alternatively spliced PDZ (PSD-95/Dlg/ZO-1) domain. J. Biol. Chem. 273:17749.[Abstract/Free Full Text]
  20. Zeng, W., X. Xu, S. Popov, S. Mukhopadhyay, P. Chidiac, J. Swistok, W. Danho, K. A. Yagaloff, S. L. Fisher, E. M. Ross, et al 1998. The N-terminal domain of RGS4 confers receptor-selective inhibition of G protein signaling. J. Biol. Chem. 273:34687.[Abstract/Free Full Text]
  21. Kehrl, J. H.. 1998. Heterotrimeric G protein signaling: roles in immune function and fine-tuning by RGS proteins. Immunity 8:1.[Medline]
  22. Hong, J. X., G. L. Wilson, C. H. Fox, J. H. Kehrl. 1993. Isolation and characterization of a novel B cell activation gene. J. Immunol. 150:3895.[Abstract]
  23. Murphy, J. J., J. D. Norton. 1993. Multiple signaling pathways mediate anti-Ig and IL-4-induced early response gene expression in human tonsillar B cells. Eur. J. Immunol. 23:2876.[Medline]
  24. Siderovski, D. P., S. P. Heximer, D. R. Forsdyke. 1994. A human gene encoding a putative basic helix-loop-helix phosphoprotein whose mRNA increases rapidly in cycloheximide-treated blood mononuclear cells. DNA Cell Biol. 13:125.[Medline]
  25. Heximer, S. P., A. D. Cristillo, D. R. Forsdyke. 1997. Comparison of mRNA expression of two regulators of G-protein signaling, RGS1/BL34/1R20 and RGS2/G0S8, in cultured human blood mononuclear cells. DNA Cell Biol. 16:589.[Medline]
  26. Snow, B. E., L. Antonio, S. Suggs, H. B. Gutstein, D. P. Siderovski. 1997. Molecular cloning and expression analysis of rat Rgs12 and Rgs14. Biochem. Biophys. Res. Commun. 233:770.[Medline]
  27. Beadling, C., K. M. Druey, G. Richter, J. H. Kehrl, K. A. Smith. 1999. Regulators of G protein signaling exhibit distinct patterns of gene expression and target G protein specificity in human lymphocytes. J. Immunol. 162:2677.[Abstract/Free Full Text]
  28. Ansel, K. M., L. J. McHeyzer-Williams, V. N. Ngo, M. G. McHeyzer-Williams, J. G. Cyster. 1999. In vivo activated CD4 T cells up-regulate CXC chemokine receptor 5 and reprogram their response to lymphoid chemokines. J. Exp. Med. 190:1123.[Abstract/Free Full Text]
  29. Rolink, A., F. Melchers, J. Andersson. 1996. The SCID but not the RAG-2 gene product is required for Sµ-S epsilon heavy chain class switching. Immunity 5:319.[Medline]
  30. Goodnow, C. C., J. Crosbie, S. Adelstein, T. B. Lavoie, S. J. Smith-Gill, R. A. Brink, H. Pritchard-Briscoe, J. S. Wotherspoon, R. H. Loblay, K. Raphael, et al 1988. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature 334:676.[Medline]
  31. Cyster, J. G., C. C. Goodnow. 1995. Antigen-induced exclusion from follicles and anergy are separate and complementary processes that influence peripheral B cell fate. Immunity 3:691.[Medline]
  32. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389.[Abstract/Free Full Text]
  33. Schmidt, K. N., C. W. Hsu, C. T. Griffin, C. C. Goodnow, J. G. Cyster. 1998. Spontaneous follicular exclusion of SHP1-deficient B cells is conditional on the presence of competitor wild-type B cells. J. Exp. Med. 187:929.[Abstract/Free Full Text]
  34. Chatterjee, T. K., A. Eapen, A. B. Kanis, R. A. Fisher. 1997. Genomic organization, 5'-flanking region, and chromosomal localization of the human RGS3 gene. Genomics 45:429.[Medline]
  35. Chen, C., B. Zheng, J. Han, S. C. Lin. 1997. Characterization of a novel mammalian RGS protein that binds to G{alpha} proteins and inhibits pheromone signaling in yeast. J. Biol. Chem. 272:8679.[Abstract/Free Full Text]
  36. Reth, M. G., P. Ammirati, S. Jackson, F. W. Alt. 1985. Regulated progression of a cultured pre-B-cell line to the B-cell stage. Nature 317:353.[Medline]
  37. Lanier, L. L., N. L. Warner, J. A. Ledbetter, L. A. Herzenberg. 1981. Quantitative immunofluorescent analysis of surface phenotypes of murine B cell lymphomas and plasmacytomas with monoclonal antibodies. J. Immunol. 127:1691.[Abstract]
  38. Zhang, S., N. Watson, J. Zahner, J. N. Rottman, K. J. Blumer, A. J. Muslin. 1998. RGS3 and RGS4 are GTPase activating proteins in the heart. J. Mol. Cell. Cardiol. 30:269.[Medline]
  39. MacLennan, I. C. M.. 1994. Germinal centers. Annu. Rev. Immunol. 12:117.[Medline]
  40. Ferlin, W. G., E. Severinson, L. Strom, A. W. Heath, R. L. Coffman, D. A. Ferrick, M. C. Howard. 1996. CD40 signaling induces interleukin-4-independent IgE switching in vivo. Eur. J. Immunol. 26:2911.[Medline]
  41. Arai, H., C. L. Tsou, I. F. Charo. 1997. Chemotaxis in a lymphocyte cell line transfected with C-C chemokine receptor 2B: evidence that directed migration is mediated by ß{gamma} dimers released by activation of G{alpha}i-coupled receptors. Proc. Natl. Acad. Sci. USA 94:14495.[Abstract/Free Full Text]
  42. Boyd, A. W., J. W. Goding, J. W. Schrader. 1981. The regulation of growth and differentiation of a murine B cell lymphoma. I. Lipopolysaccharide-induced differentiation. J. Immunol. 126:2461.[Abstract]
  43. Kim, K. J., C. Kanellopoulos-Langevin, R. M. Merwin, D. H. Sachs, R. Asofsky. 1979. Establishment and characterization of BALB/c lymphoma lines with B cell properties. J. Immunol. 122:549.[Abstract/Free Full Text]
  44. Ralph, P.. 1973. Retention of lymphocyte characteristics by myelomas and {theta}+ lymphomas: sensitivity to cortisol and phytohemagglutinin. J. Immunol. 110:1470.[Abstract/Free Full Text]
  45. Heximer, S. P., N. Watson, M. E. Linder, K. J. Blumer, J. R. Hepler. 1997. RGS2/G0S8 is a selective inhibitor of Gq{alpha} function. Proc. Natl. Acad. Sci. USA 94:14389.[Abstract/Free Full Text]
  46. Goldsmith, M. A., D. M. Desai, T. Schultz, A. Weiss. 1989. Function of a heterologous muscarinic receptor in T cell antigen receptor signal transduction mutants. J. Biol. Chem. 264:17190.[Abstract/Free Full Text]
  47. Chatterjee, T. K., A. K. Eapen, R. A. Fisher. 1997. A truncated form of RGS3 negatively regulates G protein-coupled receptor stimulation of adenylyl cyclase and phosphoinositide phospholipase C. J. Biol. Chem. 272:15481.[Abstract/Free Full Text]
  48. Bowman, E. P., J. J. Campbell, K. M. Druey, A. Scheschonka, J. H. Kehrl, E. C. Butcher. 1998. Regulation of chemotactic and proadhesive responses to chemoattractant receptors by RGS (regulator of G-protein signaling) family members. J. Biol. Chem. 273:28040.[Abstract/Free Full Text]
  49. Gruning, W., T. Arnould, F. Jochimsen, L. Sellin, S. Ananth, E. Kim, G. Walz. 1999. Modulation of renal tubular cell function by RGS3. Am. J. Physiol. 276:F535.[Abstract/Free Full Text]
  50. Watson, N., M. E. Linder, K. M. Druey, J. H. Kehrl, K. J. Blumer. 1996. RGS family members: GTPase-activating proteins for heterotrimeric G-protein {alpha}-subunits. Nature 383:172.[Medline]
  51. Berman, D. M., A. G. Gilman. 1998. Mammalian RGS proteins: barbarians at the gate. J. Biol. Chem. 273:1269.[Free Full Text]
  52. Bleul, C. C., J. L. Schultze, T. A. Springer. 1998. B lymphocyte chemotaxis regulated in association with microanatomic localization, differentiation state, and B cell receptor engagement. J. Exp. Med. 187:753.[Abstract/Free Full Text]
  53. Guinamard, R., N. Signoret, I. Masamichi, M. Marsh, T. Kurosaki, J. V. Ravetch. 1999. B cell antigen receptor engagement inhibits stromal cell-derived factor (SDF)-1{alpha} chemotaxis and promotes protein kinase C (PKC)-induced internalization of CXCR4. J. Exp. Med. 189:1461.[Abstract/Free Full Text]
  54. Kuang, Y., Y. Wu, H. Jiang, D. Wu. 1996. Selective G protein coupling by C-C chemokine receptors. J. Biol. Chem. 271:3975.[Abstract/Free Full Text]
  55. Arai, H., I. F. Charo. 1996. Differential regulation of G-protein-mediated signaling by chemokine receptors. J. Biol. Chem. 271:21814.[Abstract/Free Full Text]
  56. Healy, J. I., R. E. Dolmetsch, L. A. Timmerman, J. G. Cyster, M. L. Thomas, G. R. Crabtree, R. S. Lewis, C. C. Goodnow. 1997. Different nuclear signals are activated by the B cell receptor during positive versus negative signaling. Immunity 6:419.[Medline]
  57. Cyster, J. G., S. B. Hartley, C. C. Goodnow. 1994. Competition for follicular niches excludes self-reactive cells from the recirculating B-cell repertoire. Nature 371:389.[Medline]
  58. Bence, K., W. Ma, T. Kozasa, X. Y. Huang. 1997. Direct stimulation of Bruton’s tyrosine kinase by G(q)-protein {alpha}-subunit. Nature 389:296.[Medline]
  59. Ma, Y. C., X. Y. Huang. 1998. Identification of the binding site for Gq{alpha} on its effector Bruton’s tyrosine kinase. Proc. Natl. Acad. Sci. USA 95:12197.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
M. M. Tomayko, S. M. Anderson, C. E. Brayton, S. Sadanand, N. C. Steinel, T. W. Behrens, and M. J. Shlomchik
Systematic Comparison of Gene Expression between Murine Memory and Naive B Cells Demonstrates That Memory B Cells Have Unique Signaling Capabilities
J. Immunol., July 1, 2008; 181(1): 27 - 38.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
T. Kohno and Y. Igarashi
Attenuation of cell motility observed with high doses of sphingosine 1-phosphate or phosphorylated FTY720 involves RGS2 through its interactions with the receptor S1P.
Genes Cells, July 1, 2008; 13(7): 747 - 757.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Gratchev, J. Kzhyshkowska, S. Kannookadan, M. Ochsenreiter, A. Popova, X. Yu, S. Mamidi, E. Stonehouse-Usselmann, I. Muller-Molinet, L. Gooi, et al.
Activation of a TGF-{beta}-Specific Multistep Gene Expression Program in Mature Macrophages Requires Glucocorticoid-Mediated Surface Expression of TGF-{beta} Receptor II
J. Immunol., May 15, 2008; 180(10): 6553 - 6565.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. W. Kin, D. M. Crawford, J. Liu, T. W. Behrens, and J. F. Kearney
DNA Microarray Gene Expression Profile of Marginal Zone versus Follicular B Cells and Idiotype Positive Marginal Zone B Cells before and after Immunization with Streptococcus pneumoniae
J. Immunol., May 15, 2008; 180(10): 6663 - 6674.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Piovan, V. Tosello, S. Indraccolo, M. Masiero, L. Persano, G. Esposito, R. Zamarchi, M. Ponzoni, L. Chieco-Bianchi, R. Dalla-Favera, et al.
Differential Regulation of Hypoxia-Induced CXCR4 Triggering during B-Cell Development and Lymphomagenesis
Cancer Res., September 15, 2007; 67(18): 8605 - 8614.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Xie, M. C. Gong, W. Su, J. Turk, and Z. Guo
Group VIA Phospholipase A2 (iPLA2beta) Participates in Angiotensin II-induced Transcriptional Up-regulation of Regulator of G-protein Signaling-2 in Vascular Smooth Muscle Cells
J. Biol. Chem., August 31, 2007; 282(35): 25278 - 25289.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. Lattin, D. A. Zidar, K. Schroder, S. Kellie, D. A. Hume, and M. J. Sweet
G-protein-coupled receptor expression, function, and signaling in macrophages
J. Leukoc. Biol., July 1, 2007; 82(1): 16 - 32.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Al-Alwan, Q. Du, S. Hou, B. Nashed, Y. Fan, X. Yang, and A. J. Marshall
Follicular Dendritic Cell Secreted Protein (FDC-SP) Regulates Germinal Center and Antibody Responses
J. Immunol., June 15, 2007; 178(12): 7859 - 7867.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Jaen and C. A. Doupnik
RGS3 and RGS4 Differentially Associate with G Protein-coupled Receptor-Kir3 Channel Signaling Complexes Revealing Two Modes of RGS Modulation: PRECOUPLING AND COLLISION COUPLING
J. Biol. Chem., November 10, 2006; 281(45): 34549 - 34560.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J.-I. Han, N.-N. Huang, D.-U. Kim, and J. H. Kehrl
RGS1 and RGS13 mRNA silencing in a human B lymphoma line enhances responsiveness to chemoattractants and impairs desensitization
J. Leukoc. Biol., June 1, 2006; 79(6): 1357 - 1368.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. Cao, P. Tan, C. H. Lee, H. Zhang, and J. Lu
A transforming growth factor-beta-induced protein stimulates endocytosis and is up-regulated in immature dendritic cells
Blood, April 1, 2006; 107(7): 2777 - 2785.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Berthebaud, C. Riviere, P. Jarrier, A. Foudi, Y. Zhang, D. Compagno, A. Galy, W. Vainchenker, and F. Louache
RGS16 is a negative regulator of SDF-1-CXCR4 signaling in megakaryocytes
Blood, November 1, 2005; 106(9): 2962 - 2968.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Le, M. Honczarenko, A. M. Glodek, D. K. Ho, and L. E. Silberstein
CXC Chemokine Ligand 12-Induced Focal Adhesion Kinase Activation and Segregation into Membrane Domains Is Modulated by Regulator of G Protein Signaling 1 in Pro-B Cells
J. Immunol., March 1, 2005; 174(5): 2582 - 2590.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Cho, D.-U. Kim, and J. H. Kehrl
RGS14 Is a Centrosomal and Nuclear Cytoplasmic Shuttling Protein That Traffics to Promyelocytic Leukemia Nuclear Bodies Following Heat Shock
J. Biol. Chem., January 7, 2005; 280(1): 805 - 814.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. E. Mick, T. K. Starr, T. M. McCaughtry, L. K. McNeil, and K. A. Hogquist
The Regulated Expression of a Diverse Set of Genes during Thymocyte Positive Selection In Vivo
J. Immunol., November 1, 2004; 173(9): 5434 - 5444.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Moratz, J. R. Hayman, H. Gu, and J. H. Kehrl
Abnormal B-Cell Responses to Chemokines, Disturbed Plasma Cell Localization, and Distorted Immune Tissue Architecture in Rgs1-/- Mice
Mol. Cell. Biol., July 1, 2004; 24(13): 5767 - 5775.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G.-X. Shi, K. Harrison, S.-B. Han, C. Moratz, and J. H. Kehrl
Toll-Like Receptor Signaling Alters the Expression of Regulator of G Protein Signaling Proteins in Dendritic Cells: Implications for G Protein-Coupled Receptor Signaling
J. Immunol., May 1, 2004; 172(9): 5175 - 5184.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. D. Cahir-McFarland, K. Carter, A. Rosenwald, J. M. Giltnane, S. E. Henrickson, L. M. Staudt, and E. Kieff
Role of NF-{kappa}B in Cell Survival and Transcription of Latent Membrane Protein 1-Expressing or Epstein-Barr Virus Latency III-Infected Cells
J. Virol., April 15, 2004; 78(8): 4108 - 4119.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. H. Ekland, R. Forster, M. Lipp, and J. G. Cyster
Requirements for Follicular Exclusion and Competitive Elimination of Autoantigen-Binding B Cells
J. Immunol., April 15, 2004; 172(8): 4700 - 4708.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Anger, W. Zhang, and U. Mende
Differential Contribution of GTPase Activation and Effector Antagonism to the Inhibitory Effect of RGS Proteins on Gq-mediated Signaling in Vivo
J. Biol. Chem., February 6, 2004; 279(6): 3906 - 3915.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Corcione, N. Arduino, E. Ferretti, L. Raffaghello, S. Roncella, D. Rossi, F. Fedeli, L. Ottonello, L. Trentin, F. Dallegri, et al.
CCL19 and CXCL12 Trigger in Vitro Chemotaxis of Human Mantle Cell Lymphoma B Cells
Clin. Cancer Res., February 1, 2004; 10(3): 964 - 971.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
N. Grillet, V. Dubreuil, H. D. Dufour, and J.-F. Brunet
Dynamic Expression of RGS4 in the Developing Nervous System and Regulation by the Neural Type-Specific Transcription Factor Phox2b
J. Neurosci., November 19, 2003; 23(33): 10613 - 10621.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Inngjerdingen, B. Rolstad, and J. C. Ryan
Activating and Inhibitory Ly49 Receptors Modulate NK Cell Chemotaxis to CXC Chemokine Ligand (CXCL) 10 and CXCL12
J. Immunol., September 15, 2003; 171(6): 2889 - 2895.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Lippert, D. L. Yowe, J.-A. Gonzalo, J. P. Justice, J. M. Webster, E. R. Fedyk, M. Hodge, C. Miller, J.-C. Gutierrez-Ramos, F. Borrego, et al.
Role of Regulator of G Protein Signaling 16 in Inflammation- Induced T Lymphocyte Migration and Activation
J. Immunol., August 1, 2003; 171(3): 1542 - 1555.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Tosetti, N. Pathak, M. H. Jacob, and K. Dunlap
RGS3 mediates a calcium-dependent termination of G protein signaling in sensory neurons
PNAS, June 10, 2003; 100(12): 7337 - 7342.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C.-M. Hogerkorp, S. Bilke, T. Breslin, S. Ingvarsson, and C. A. K. Borrebaeck
CD44-stimulated human B cells express transcripts specifically involved in immunomodulation and inflammation as analyzed by DNA microarrays
Blood, March 15, 2003; 101(6): 2307 - 2313.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Tosetti, T. Turner, Q. Lu, and K. Dunlap
Unique Isoform of Galpha -interacting Protein (RGS-GAIP) Selectively Discriminates between Two Go-mediated Pathways That Inhibit Ca2+ Channels
J. Biol. Chem., November 22, 2002; 277(48): 46001 - 46009.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Honczarenko, Y. Le, A. M. Glodek, M. Majka, J. J. Campbell, M. Z. Ratajczak, and L. E. Silberstein
CCR5-binding chemokines modulate CXCL12 (SDF-1)-induced responses of progenitor B cells in human bone marrow through heterologous desensitization of the CXCR4 chemokine receptor
Blood, September 18, 2002; 100(7): 2321 - 2329.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
W. Cladman and P. Chidiac
Characterization and Comparison of RGS2 and RGS4 as GTPase-Activating Proteins for m2 Muscarinic Receptor-Stimulated Gi
Mol. Pharmacol., September 1, 2002; 62(3): 654 - 659.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
S. Hollinger and J. R. Hepler
Cellular Regulation of RGS Proteins: Modulators and Integrators of G Protein Signaling
Pharmacol. Rev., September 1, 2002; 54(3): 527 - 559.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G.-X. Shi, K. Harrison, G. L. Wilson, C. Moratz, and J. H. Kehrl
RGS13 Regulates Germinal Center B Lymphocytes Responsiveness to CXC Chemokine Ligand (CXCL)12 and CXCL13
J. Immunol., September 1, 2002; 169(5): 2507 - 2515.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. J. McLeod, A. H. Y. Li, R. L. Lee, A. E. Burgess, and M. R. Gold
The Rap GTPases Regulate B Cell Migration Toward the Chemokine Stromal Cell-Derived Factor-1 (CXCL12): Potential Role for Rap2 in Promoting B Cell Migration
J. Immunol., August 1, 2002; 169(3): 1365 - 1371.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Liao, A.-K. Shirakawa, J. F. Foley, R. L. Rabin, and J. M. Farber
Human B Cells Become Highly Responsive to Macrophage-Inflammatory Protein-3{alpha}/CC Chemokine Ligand-20 After Cellular Activation Without Changes in CCR6 Expression or Ligand Binding
J. Immunol., May 15, 2002; 168(10): 4871 - 4880.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. N. Johnson and K. M. Druey
Functional Characterization of the G Protein Regulator RGS13
J. Biol. Chem., May 3, 2002; 277(19): 16768 - 16774.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Derrien and K. M. Druey
RGS16 Function Is Regulated by Epidermal Growth Factor Receptor-mediated Tyrosine Phosphorylation
J. Biol. Chem., December 14, 2001; 276(51): 48532 - 48538.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Ehrlich, K. L. Buchanan, F. Tsien, G. Jiang, B. Sun, W. Uicker, C. M.R. Weemaes, D. Smeets, K. Sperling, B. H. Belohradsky, et al.
DNA methyltransferase 3B mutations linked to the ICF syndrome cause dysregulation of lymphogenesis genes
Hum. Mol. Genet., December 1, 2001; 10(25): 2917 - 2931.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I.-K. Park, C. A. Klug, K. Li, L. Jerabek, L. Li, M. Nanamori, R. R. Neubig, L. Hood, I. L. Weissman, and M. F. Clarke
Molecular Cloning and Characterization of a Novel Regulator of G-protein Signaling from Mouse Hematopoietic Stem Cells
J. Biol. Chem., January 5, 2001; 276(2): 915 - 923.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-S. Shi, S. B. Lee, S. Sinnarajah, C. W. Dessauer, S. G. Rhee, and J. H. Kehrl
Regulator of G-protein Signaling 3 (RGS3) Inhibits Gbeta 1gamma 2-induced Inositol Phosphate Production, Mitogen-activated Protein Kinase Activation, and Akt Activation
J. Biol. Chem., June 22, 2001; 276(26): 24293 - 24300.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reif, K.
Right arrow Articles by Cyster, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reif, K.
Right arrow Articles by Cyster, J. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS