HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Viret, C. Articles by Janeway, C. A. Search for Related Content PubMed PubMed Citation Articles by Viret, C. Articles by Janeway, C. A., Jr.

Functional and Phenotypic Evidence for Presentation of E_52–68 Structurally Related Self-Peptide(s) in I-E-Deficient Mice¹

Section of Immunobiology and Howard Hughes Medical Institute, Yale University School of Medicine, New Haven, CT 06510

	Abstract

Top Abstract Introduction Materials and Methods Results and Discussion References

 
The Y-Ae mAb and the 1H3.1 TCR-ß (V1/Vß6) are two immune receptors specific for I-A^b MHC class II molecules complexed to the 52–68 fragment of the -chain of I-E class II molecules (the E_52–68 peptide). A profound intrathymic negative selection occurs in 1H3.1 TCR transgenic mice in the presence of an I-E transgene. The administration of mAbs to 1H3.1/I-E double-transgenic newborn mice reveals that Y-Ae, but not the isotype-matched anti-I-E Y17 mAb, rescues a significant number of mature (Vß6^highCD4⁺CD8^-) thymocytes and allows the detection of E_52–68-reactive T cells in the periphery. These observations indicate that deletion of autoreactive T cells can be specifically inhibited in vivo by an mAb specific for the deleting self-peptide:self-MHC class II complex. Similar inhibition experiments indicate that C57BL/6 (I-A^b+/I-E^-) mice constitutively express an E-independent, Y-Ae-recognizable epitope(s). This finding is confirmed by the phenotypic analysis of mature (MHC class II high) C57BL/6 bone marrow-derived dendritic cells. Collectively, these observations further illustrate the peptide specificity of negative selection and demonstrate that MHC class II-positive cells from unmanipulated C57BL/6 mice that lack a functional I-E gene can assemble one or more self-peptide:I-A^b complexes recognizable by the E_52–68:I-A^b complex-specific Y-Ae mAb.

	Introduction

Top Abstract Introduction Materials and Methods Results and Discussion References

 
The T cell Ag receptor repertoire of mature ß T lymphocytes is shaped during development in the thymus through a combination of two selection events (1, 2). Positive selection allows TCR^lowCD4⁺CD8⁺ immature thymocytes able to interact with self-peptide:self-MHC complexes to survive and differentiate into mature CD4⁺ or CD8⁺ single-positive TCR^high thymocytes (3). Concomitantly, by inducing apoptosis, negative selection physically eliminates most thymocytes expressing TCRs with potentially harmful reactivity to self-peptide:self-MHC complexes (4, 5). This intrathymic process is a major mechanism for the establishment of T cell tolerance.

Ag expression by cells having a hemopoietic origin is sufficient to drive negative selection because transfer of bone marrow (BM)³-derived cells from male transgenic (Tg) mice expressing a TCR specific for the male Ag into irradiated female recipients leads to effective deletion of thymocytes regardless of the MHC haplotype of the recipient (6). Intrathymic clonal deletion affects immature as well as semimature (CD4⁺CD8^-, HSA^high) thymocytes (7) and seems to require engagement of both TCR and costimulatory molecule receptors such as CD28 (5, 8, 9). The thymic medulla is rich in BM-derived cells expressing various costimulatory molecules and, therefore, is a very efficient site of negative selection. For instance, circulating Ag or endogenous superantigen (SAg), which are dominantly expressed by BM-derived cells (10), cause massive deletion in the medulla (11, 12, 13, 14). In addition, autoreactive CD4⁺ T cells are detected in mice expressing MHC class II only in the thymic epithelium (the K14-A_ß^b Tg mice), presumably as a result of a lack of negative selection by BM-derived cells in the medulla (15). Negative selection has also been observed at the cortico-medullary junction (16) as well as the CD4⁺CD8⁺ stage (i.e., cortical thymocytes) in systems (6, 17) where deletion was not complicated by toxic soluble factors induced upon activation of mature T cells (18).

It was previously reported that a pan-specific mAb directed at MHC class II molecules could inhibit the process of positive selection (19, 20). Here, we report that an mAb directed at the complex of a self-peptide bound to self-MHC class II molecules can specifically interfere with the process of intrathymic negative selection in vivo. We used C57BL/6 mice with transgenic expression of I-E, and therefore of the E_52–68 peptide, directed by the Ig gene enhancer and promoter (Ig-E Tg). The E_52–68:I-A^b complex is specifically recognized, in a competitive fashion, by two distinct immune receptors: the 1H3.1 TCR-ß and the Y-Ae mAb. Monoclonal Ab interference with intrathymic negative selection also revealed that unmanipulated C57BL/6 (I-A^b+/I-E-deficient) mice express one or more E_52–68-independent Y-Ae-recognizable epitope(s) as shown by the detection of autoreactive T cells in Y-Ae-treated neonatal C57BL/6 mice.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Animals

Mice used were 4–7 wk old and were housed in the Yale Immunobiology Mouse Unit. C57BL/6 (B6), B10.BR, AKR, and B10.A (5R) were obtained from The Jackson Laboratory (Bar Harbor, ME). The B6 Ig-E Tg mice with I-E expression on most B cells, a large number of dendritic cells, and some thymic medullary epithelial cells, were generated by Dr. R. A. Flavell (21). The H-2M-deficient (H-2M^-/-) mice (B6-129 mixed background) were provided by Dr. L. Van Kaer (Howard Hughes Medical Institute, Nashville, TN).

Cloning of 1H3.1 TCR-ß genes and generation of transgenic mice

The TCR - and ß-chains of the 1H3.1 T cell hybrid (22) were identified by immunofluorescence using variable region-specific Abs and RT-PCR with a panel of V and C segment-specific primers. Sequencing of PCR products revealed the V1-J21 and Vß6-Dß2.1-Jß2.6 combinations. To produce the TCR and ß transgenes, the rearranged V(D)J genes were amplified by PCR with the Pfu polymerase (Stratagene, La Jolla, CA) using genomic DNA from the 1H3.1 T cell hybrid as template and the following oligonucleotides to introduce appropriate restriction sites (all 5'-3'): Vß6-L sense, AATGCCCGGTACCAAAGAAAGTCGACCCAAACTATGAACAAGTGGGTCTC; Jß2.6 3' intron antisense, TTTCCCTCCCATCGATTCCCTAACCCTGGTCTACTC; V1-L sense, GGAACCCGGGACTCGAGATGAAATCCTTGAGTGTTTTACTA; and J21 intron antisense, TTTTTTTGCGGCCGCAGGAAAGAACATTAATAAAGAGCC (underlining indicates restriction sites). PCR products were cloned into Bluescript vector (Stratagene) for sequencing and, using the XbaI/NotI and XhoI/ClaI restriction sites, respectively, were inserted in the pT and pTß cassette vectors, which contain the proximal promoters, enhancer, and transcriptional initiation sites of the and ß loci (23) to ensure a normal timing and regulation of expression. The transgenes were tested in vitro for expression and functionality by transfecting a TCR^-ß^- T cell hybrid (4G4) along with the pcDNA3 expression vector (Invitrogen, San Diego, CA) containing the mouse CD4 cDNA and the neomycin resistance marker by electroporation. Clonal Vß6⁺CD4⁺ transfectants were tested for IL-2 production in response to the E_52–68 peptide presented by irradiated B6 splenocytes. Linearized and ß transgenes, devoid of prokaryotic sequences (SalI and partial KpnI digests, respectively), were comicroinjected into (B6 x SJL)F2 oocytes (Comparative Medicine Transgenic Facility, Yale University, New Haven, CT). Transgene integration was tested by PCR on tail genomic DNA. Founders carrying both transgenes were backcrossed to B6 animals in a specific pathogen-free environment. Screening of TCR Tg animals was performed using a PCR reaction detecting the rearranged L-V(D)J fragments of - and ß-chains.

Immunostaining and flow cytometry

Depending on the experiment, thymus, spleen, and lymph nodes (axillary, lateral axillary, superficial inguinal, and mesenteric) were removed, and cell suspensions were prepared. Splenic RBC were lysed using Tris-buffered ammonium chloride. Fluorescent-labeled mAbs were used for multicolor staining. Briefly, 0.2 x 10⁶ cells were incubated in microtiter U-bottom plates with a saturating concentration of labeled mAb in 20 µl for 30 min on ice. Cells were washed twice and analyzed immediately. For two-step staining, cells were incubated first with purified mAbs in PBS 2% FCS/0.1% NaN₃, followed by a F(ab')₂ of goat anti-mouse Ig-FITC conjugate (Sigma, St. Louis, MO). The mAbs used were anti-Vß6-FITC (clone RR4-7), anti-Cß-PE (H57-597), anti-V2,3.2,8,11-FITC (B20.1, RR3-16, B21.14, RR8-1), anti-CD45R/B220-PE (RA3-6B2), and anti-CD86/B7-2-biotin (GL1) from PharMingen (San Diego, CA); anti-CD8-PE/FITC (53-6.7) from Life Technologies (Grand Island, NY); and anti-CD4-quantum red (H129.19) from Sigma. The Y3JP (mouse IgG2a, anti-I-A^b), 25-9-17 (mouse IgG2a, anti-I-A^b), Y-Ae (mouse IgG2b, anti-A^b+E_52–68), 14.4.4 S and Y17 (mouse IgG2a and _2b, anti-I-E), 2.4G2 (rat IgG2b, anti CD16/CD32), GK1.5 (rat IgG2b, anti CD4), TIB 105, and TIB 210 (both rat IgG2b, anti CD8) mAbs were affinity purified from hybridoma supernatants using standard procedures. LPS blasts were obtained by treating freshly isolated splenocytes with LPS (Sigma) for 2 days in culture. A FACScan flow cytometer and CellQuest software from Becton Dickinson (Mountain View, CA) were used to collect and analyze the data. Nonviable cells were excluded using forward and side scatter electronic gating or propidium iodide.

Functional assays

For T cell proliferation assays, T cells were isolated from lymph nodes and cultured in U-bottom 96-well plates (Becton Dickinson, Lincoln Park, NJ) for 3–4 days at 37°C in Click’s EHAA medium (Irvine Scientific, Santa Ana, CA) supplemented with 5% heat-inactivated FCS (Intergen, Purchase, NY), 5 x 10^-5 M 2-ME (Bio-Rad, Richmond, CA), 2 mM L-glutamine, and 50 µg/ml gentamicin (Life Technologies). In some cases, transgenic T cells were sorted for the absence of MHC class II and CD8 expression using magnetic beads and the Y3P, TIB 105, and TIB 210 mAbs. Depending on the experiment, T cells (30–50 x 10³/well) were stimulated using graded numbers of irradiated (2000 rad) splenocytes of different types (3 x 10⁵ or less/well) or splenocytes plus serial dilutions of synthetic E_52–68 peptide (ASFEAQGALANIAVDKA; single-letter amino acid code) or anti-CD3 mAb (YCD3-1) in a total volume of 150 µl. The cells were incubated in duplicate wells, and 1 µCi of [³H]thymidine/well was added to the culture for the last 12 h. The plates were then harvested and counts per minute were determined using liquid scintillation counting. For inhibition experiments, purified mAbs were sterile-filtered and added to microcultures.

mAb treatment of newborn mice

(1H3.1 TCR Tg x I-E Tg)F₁ newborn mice were screened for transgene by PCR on day 1 using genomic DNA. Starting on day 2, TCR/I-E double-Tg animals were i.p. injected with 25 µg of purified Y17 or Y-Ae mAb diluted in 50 µl of normal saline every 2 days for about 2 wk. On days 13–15, mice were sacrificed, the thymus and spleen were removed, and single-cell suspensions were prepared for immunofluorescence analysis. Normal C57BL6 (B6) newborn mice were i.p. injected with 20 µg of purified Y-Ae, Y3JP, or 25-9-17 mAb diluted in 50 µl of PBS every 2 days for 2 wk and were used at 3 wk of age for an MLR experiment: mononuclear cells were isolated from spleen using lymphocyte separation medium and washed three times with complete medium, and 0.3 x 10⁶ cells were stimulated in vitro with 0.5 x 10⁶ syngeneic (B6) or allogeneic (B10.BR, H2^k) irradiated splenocytes in 150 µl of complete medium. After 3–4 days of incubation, microcultures were pulsed with [³H]thymidine for 12 h and harvested.

Derivation of dendritic cells from BM progenitors

Dendritic cells were generated from T and B cell-depleted bone marrow cultured using RPMI medium complemented with 5% FCS, 50 µM 2-ME, 20 µg/ml gentamicin, and 1% recombinant GM-CSF in 24-well plates as previously described (24). Medium was replaced every 2 days. Abundant clusters of immature (early) dendritic cells were present on days 5–6, whereas highly immunostimulatory mature (late) dendritic cells dominated on days 7–8.

	Results and Discussion

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Tg mice expressing the 1H3.1 T cell specificity

1H3.1 is an I-A^b-restricted CD4⁺ T hybridoma (V1/Vß6) derived from a C57BL/6 mouse immunized with a peptide corresponding to residues 52–68 of the -chain of the I-E MHC class II molecule (E_52–68) (22, 25). The E_52–68:I-A^b complex is also specifically recognized by the Y-Ae mAb (26, 27) and is naturally expressed by APCs from B10.A(5R) mice, but not from C57BL/6 mice, which lack a functional I-E gene (28). TCR transgenic mice were generated to study the development of the 1H3.1 specificity. Vß6 staining revealed that H-2^b TCR Tg animals have a dominant expression of the ß-chain transgene in thymocytes, splenocytes, and lymph node (LN) cells. Fig. 1 shows that mature thymocytes are largely skewed toward expression of CD4 (upper panels). This bias is reflected in peripheral T cells when looking at the CD4/CD8 ratio (lower panels). However, like others (29), we detect a subset of TCR^highCD8⁺ thymocytes (5–10%) that is exported into the periphery, where the Vß6⁺CD8⁺ cells represent a substantial population. The frequency of Vß6⁺ LN cells is >98% among CD4⁺ cells and >96% among CD8⁺ cells. Additionally, (1H3.1 TCR Tg x AKR)F₁ animals have <2% of ß T cells in the periphery as a result of deletion of the Vß6⁺ T cells by the endogenous SAg Mls-1^a (not shown). These observations show that strong allelic exclusion occurs at the ß locus. The expression of the transgene is evidenced by the strong proliferative response (Fig. 2, A and B) as well as IL-2 production (not shown) obtained when challenging the TCR Tg LN cells in vitro with C57BL/6 APCs plus E_52–68 peptide or with B10.A (5R) APCs alone. The response is abrogated by Y-Ae (Fig. 2C) as well as the anti I-A^b Y3JP mAb (30) (data not shown), but not by the Y17 and 14.4.4 S anti-I-E mAbs or the 25-9-17 mAb (31) (Fig. 2C), which interacts with many peptide/I-A^b complexes but not with the Y-Ae epitope (32). In addition, the Tg LN cells behave identically to the parental hybrid cells when stimulated with E_52–68 mutants carrying single mutations at positions that contact the 1H3.1 TCR (data not shown), indicating that the fine specificity of the TCR is intact in the transgenic animals.

View larger version (45K): [in this window] [in a new window]   FIGURE 1. Mature T cells from 1H3.1 TCR Tg mice are skewed toward expression of the CD4 coreceptor. Flow cytometric analysis of lymphoid organs from 8-wk-old 1H3.1 TCR Tg and Tg-negative mice. Thymic (top) and splenic (bottom) single-cell suspensions were triple stained for CD4, CD8, and Vß6 molecules. Vß6 expression is shown as a histogram (x-axis, log fluorescence intensity; y-axis, cell number). CD4/CD8 distributions are represented as a dot plot without (left) and with (right) electronic gating on Vß6high thymocytes or Vß6+ peripheral T cells. Quadrant statistics are indicated.

View larger version (12K): [in this window] [in a new window]   FIGURE 2. Naive 1H3.1 TCR Tg LN cells specifically proliferate in response to the Y-Ae epitope in vitro. A, Irradiated splenocytes were used as APCs. Various amounts of E52–68 peptide were loaded on C57BL/6 splenocytes. B, B10.A (5R) (noted 5R) and C57BL/6 (noted B6) splenocytes were titrated in parallel. C, Dose-dependent abrogation of the response to I-Ab+/I-E+ splenocytes using Y-Ae and anti-MHC class II-specific mAbs (25-9-17, anti-I-Ab and Y17; 14.4.4.S, anti-I-E). Results are representative of three (A) and two (B and C) independent experiments.

Intrathymic negative selection imposed by the Y-Ae epitope in Ig-E Tg mice

To analyze intrathymic negative selection imposed by the E_52–68:I-A ^b complex, 1H3.1 TCR Tg mice were bred to mice that express an I-E^d transgene on B lymphocytes, dendritic cells, and some thymic medullary, but not cortical, epithelial cells (Ig-E Tg) (21). The use of heterozygous Ig-E Tg allowed us to generate and analyze simultaneously TCR Tg littermate animals that differ only in the I-E^d transgene. The reactivity of 1H3.1 TCR Tg LN cells to C57BL/6 Ig-E Tg splenocytes (Y-Ae⁺, Y3JP⁺, Y17⁺, and 14.4.4 S⁺) is blocked by Y-Ae, but not by anti-I-E, mAbs (Y17, 14-4-4 S; data not shown). This demonstrates that the 1H3.1 TCR Tg T cells react to the Y-Ae epitope, but ignore surface expression of I-E^d/E_ß^b heterodimers as well as presentation of endogenous SAgs possibly presented together with such complexes (i.e., Mtv 3, 8, 9, 17, 31, and 42). At 4–6 wk of age, (TCR Tg x I-E Tg)F₁ mice were sacrificed, and the thymus, spleen, or LN were processed to prepare cell suspensions. TCR/I-E double-Tg animals showed a drastic reduction of thymic cellularity. Three-color staining of the cell suspensions are presented in Fig. 3. A constant feature, reminiscent of MHC class I-restricted T cell systems (6, 17), was the dramatic reduction of the absolute number of CD4⁺CD8⁺ thymocytes (presumably cortical thymocytes) from 55–60 x 10⁶ to 2–3 x 10⁶. Mature thymocytes were also massively deleted: from 54–59 x 10⁶ to 0.1–1 x 10⁶ for CD4⁺ cells and from 5–8 x 10⁶ to 0.05–1.7 x 10⁶ for CD8⁺ cells. The drastic reduction of the CD4⁺CD8⁺ thymocyte number when the TCR ligand was not expressed on thymic cortical epithelial cells (21) implies that the few BM-derived cells present in the cortical compartment are fully capable of driving clonal deletion. This is consistent with the observation that very few BM-derived APCs are required to induce maximal deletion of TCR Tg thymocytes in reaggregation thymic organ cultures (33). Indeed, a single dendritic cell is able to activate 100-3000 T cells in a mixed lymphocyte reaction (34), and it is known that interactions involved in negative selection are less stringent than those involved in activation of mature T cells (35, 36). Thus, the deletion of CD4⁺CD8⁺ thymocytes supports the idea that in addition to the thymocyte-APC interaction avidity (37), clonal deletion depends on the accessibility of the MHC/peptide complex independent of where it is expressed within the thymus. We observed the presence of Vß6⁺ cells in the periphery of TCR⁺/I-E⁺ mice (Fig. 3, lower panels). This fraction consistently contained a substantial subset of CD4^-CD8^- cells. The CD4⁺ LN cells derived from TCR Tg⁺/I-E⁺ mice did not show a reduced level of TCR or CD4 coreceptor expression. To perform functional analysis, CD4⁺ LN cells from a TCR/I-E double-Tg mouse were purified. Stimulation using irradiated Y-Ae⁺-APCs showed that no detectable proliferation occurred, whereas identically treated LN cells from a TCR Tg⁺/I-E^- littermate showed a dose-dependent response (data not shown).

View larger version (49K): [in this window] [in a new window]   FIGURE 3. Severe intrathymic deletion of immature 1H3.1 TCR Tg T cells by the Y-Ae epitope in B6 Ig I-E/1H3.1 TCR double-Tg mice. Flow cytometric analysis of lymphoid organs from 5- to 6-wk-old (1H3.1 TCR Tg x I-Ed Tg)F1 animals. CD4/CD8 distribution (dot plot) and Vß6 expression (histogram) by thymic (top panels) and lymph nodes (bottom panels) cell suspensions are represented. A representative age-matched TCR Tg+/I-E- littermate is shown as the control. Quadrant statistics are indicated. In the displayed experiment, the absolute numbers of thymocytes were TCR+/I-E-, 128.3 x 106; and TCR+/I-E+, 6.9 x 106. Profiles are representative of three animals analyzed.

Pioneering experiments using injection of anti-MHC class II mAbs into neonatal mice revealed that the development of MHC class II-restricted T cells requires their interaction with MHC class II-positive cells in the thymus, and interference with this process has profound effects on T cell development (19). In these mice the lymphoid organs were devoid of CD8^-CD4⁺ T cells, whereas the development of CD8⁺CD4^- T cells proceeded normally (20).

Because the 1H3.1 TCR-ß and the Y-Ae mAb recognize the same self-peptide:self-MHC class II complex, we hypothesized that the introduction of Y-Ae in the thymic microenvironment might interfere with the process of intrathymic negative selection in the TCR/I-E double-Tg mice. For this experiment, we used repeated i.p. injection of purified Y-Ae into newborn TCR/I-E double-Tg mice. Lymphoid organs were analyzed after 12–15 days of treatment. The I-E-specific Y17 mAb was the appropriate control because the Y17 isotype matches the Y-Ae isotype (IgG2b), and in the I-E Tg mice, Y17 binds to the same cells as Y-Ae, because expression of the I-E molecule directs expression of the Y-Ae epitope. We observed that the injection of Y-Ae effectively reduced intrathymic negative selection of 1H3.1 TCR Tg thymocytes; a higher fraction of Vß6^highCD4⁺ single positive thymocytes was seen in the Y-Ae-treated mice (Fig. 4A, left panels) than in littermates treated with the isotype-matched control Ab Y17. Thymic size and cellularity were also greatly increased in Y-Ae-injected mice. Finally, the Y-Ae-treated mice display a significant fraction of Vß6⁺ CD4⁺ cells in the spleen, which is not seen in the spleen of Y17-treated mice, and a reduced fraction of Vß6⁺ CD4^-CD8^- cells (Fig. 4A, right panel). This suggests that thymocytes that have been rescued from intrathymic negative selection are also protected from peripheral deletion in the presence of Y-Ae. Because the Y17 and the Y-Ae epitopes are expressed on the surface of the same cells, the lack of effect of the Y17 mAb shows that the rescue of 1H3.1 TCR Tg mature thymocytes by Y-Ae is due to a reduced access to the Y-Ae epitope, presumably caused by competition between the two immune receptors. It cannot be due to mAb-mediated depletion of Y-Ae⁺ stromal cells, as it would have occurred with Y-17. An assay performed to examine the specificity of the splenocytes from Y-Ae-treated mice revealed a specific response to E_52–68 (Fig. 4B). These data indicate that negative selection of thymocytes expressing the 1H3.1 specificity is partially, but specifically, reversed in vivo by a soluble synonymous immune receptor.

View larger version (26K): [in this window] [in a new window]   FIGURE 4. Specific in vivo inhibition of negative selection of 1H3.1 Tg thymocytes by the Y-Ae mAb in 1H3.1 TCR/I-E double-Tg mice. A, Three-color immunofluorescence analysis of lymphoid organs from 1H3.1 TCR/I-E double-Tg mice after 2 wk of treatment with the E52–68:I-Ab complex-specific Y-Ae mAb, the isotype-matched I-E-specific Y17 mAb, or the vehicle. Single-cell suspensions were stained with anti-Vß6, anti-CD4, and anti-CD8 mAbs. The CD4/CD8 expression is shown after electronic gating on the Vß6high thymocyte (left panels) and Vß6-positive splenocyte (right panels) populations. Quadrant statistics are indicated. In the depicted experiment, thymic cellularity was 7.1 x 106 for the Y17-treated mouse, 6.4 x 106 for the saline-treated mouse, 27.75 x 106 for the Y-Ae-treated mouse, and 33.75 x 106 for the unmanipulated normal TCR Tg control littermate. Profiles are representative of three experiments. B, Splenocytes from a Y-Ae-treated mouse specifically react to the E52–68 peptide presented by irradiated C57BL/6 (B6) APCs (E52–68 was used at 3 µg/ml, Y-Ae and Y-17 were used at 5 µg/ml).

Evidence for the constitutive expression of E_52–68-independent, Y-Ae-recognizable self-peptide:MHC class II complex(es) in C57BL/6 (B6) mice

Although C57BL/6 mice do not have a functional I-E gene (28) and their splenocytes do not show detectable Y-Ae staining by indirect immunofluorescence and FACS analysis (26, 27), it has been repeatedly observed that LPS-treated C57BL/6 splenic B lymphocytes acquire a clear Y-Ae⁺ phenotype (S. Rath, A. Y. Rudensky, and C. A. Janeway, Jr., unpublished observations, and Ref. 38). This phenomenon is not observed when the experiment is conducted using splenocytes from H-2M^-/- mice, which lack the MHC class II peptide exchange factor H-2M (39, 40, 41) (Fig. 5A). This demonstrates that the Y-Ae-positive staining of activated C57BL/6 B cells corresponds to the recognition of a peptide:I-A^b complex(es) and not to cross-reactivity to a surface protein induced on B cells upon activation. Such an induced complex(es) is clearly not recognized by 1H3.1 TCR Tg T cells (Fig. 5B). Additionally, a concomitant RT-PCR analysis of C57BL/6 LPS blasts failed to detect any part of the transcript region encoding E_52–68 (data not shown). These two observations indicate that synthesis of the E_52–68 peptide itself is not restored upon LPS stimulation. Thus, in C57BL/6 mice, one (or more) protein fragment can be produced and assembled with I-A^b molecules in an H-2M-dependent fashion to form complexes recognizable by Y-Ae. Whether such a peptide(s) is only expressed upon activation of B cells or is constitutively expressed at a low level by untreated C57BL/6 MHC class II-positive cells is unknown.

View larger version (16K): [in this window] [in a new window]   FIGURE 5. Activation-induced and constitutive surface expression of a Y-Ae-recognizable epitope(s) by MHC class II-positive cells from normal C57BL/6 mice. A, H-2M-dependent formation of a Y-Ae-recognizable epitope(s) by C57BL/6 B lymphocytes upon LPS-induced activation in vitro. Freshly isolated total splenocytes from C57BL/6 (I-Ab+/I-E-), H-2M-/- (I-Ab+/I-E-), and B10. A (5R) (I-Ab+/I-E+) mice were exposed to 10 µg/ml LPS for 72 h and stained using Y-Ae and FITC-F(ab')2 of goat anti-mouse Ig. Dark line histograms, secondary reagent; gray histograms, Y-Ae. Histograms represent B220-positive cells (x-axis, log fluorescence intensity; y-axis, cell number). B, Y-Ae-positive C57BL/6 B cell blasts do not cause detectable proliferation of 1H3.1 TCR Tg-purified naive T cells. The irradiated B cell blasts shown in A were used to stimulate 1H3.1 TCR Tg splenocytes depleted of MHC class II+ and CD8+ cells. The cultures were also negative for IL-2 production, as judged by a standard CTLL assay (data not shown). C, Intraperitoneal injection of purified mAbs into newborn mice reveals the constitutive expression of one or more E52–68-independent, Y-Ae-recognizable epitope(s) by MHC class II-positive cells derived from unmanipulated C57BL/6 mice. Autoreactive T cells are detected among splenocytes from C57BL/6 (B6) mice treated with Y-Ae. MLR experiments were performed using total splenocytes after 2 wk of in vivo treatment. B10. BR (H-2k) irradiated splenocytes were used as a positive control for proliferation (PBS, n = 3 mice; Y3JP, n = 4; Y-Ae, n = 4). Consistent results were obtained with another group of 10 newborn mice (not shown). The specificity of the reactivity to C57BL/6 APCs is shown by the inhibition observed in the presence of Y-Ae, but not Y17 (D).

Together, the negative Y-Ae staining of C57BL/6 B220⁺ splenocytes and the in vitro detection of autoreactivity after Y-Ae treatment in vivo suggest a limitation of the cytometry-coupled immunofluorescence analysis in detecting the expression of Y-Ae-recognizable epitope(s) on the surface of freshly isolated MHC class II-positive cells. We directly tested this possibility by creating the Y-Ae epitope in vitro and performing a flow cytometry/T cell activation comparative analysis. We found that when E_52–68 is titrated on C57BL/6 splenocytes, naive 1H3.1 TCR Tg T cells can be induced to produce IL-2 even at peptide doses that do not generate a detectable Y-Ae signal after immunostaining and flow cytometric analysis (data not shown). These data demonstrate that the lack of detectable Y-Ae signal observed after cytometry-coupled immunofluorescence does not rule out surface expression of a Y-Ae-recognizable epitope(s) able to be recognized by T cells.

Direct visualization of Y-Ae recognizable epitope(s) on BM-derived C57BL/6 mature dendritic cells

In the course of a separate study we came across an observation that directly supports the conclusion that a Y-Ae-recognizable epitope(s) can be assembled in C57BL/6 mice. We found that C57BL/6 (I-A^b+, I-E^-), but not B10.BR (I-A^b-, I-E⁺), dendritic cells prepared from bone marrow progenitors in vitro stain positively for Y-Ae, while they remain negative for the isotype-matched anti-I-E Y17 mAb (Fig. 6). This was consistently observed on days 7–8 of culture, when dendritic cells are known to be mature; they express a high level of CD80/B7-1, CD86/B7-2, CD40, CD54, and CD58 and have virtually all their MHC class II molecules on the plasma membrane. At the mature stage, MHC class II molecules are also known to have a prolonged half-life (34, 42, 43). The Y-Ae signal was not detected at the immature stage (days 5–6) by flow cytometry. This may be due to the fact that the appropriate peptide(s) is not abundantly expressed at this stage or to the fact that immature dendritic cells are known to express a low level of MHC class II molecules characterized by a short half-life (34, 42, 43). Both immature and mature dendritic cells were unable to activate 1H3.1 TCR Tg T cells (data not shown). The Y-Ae signal observed on mature C57BL/6 dendritic cells does not result from the processing and presentation of FCS Ag-derived epitope, because Y-Ae staining is also seen when the culture is performed with mouse serum (not shown).

View larger version (32K): [in this window] [in a new window]   FIGURE 6. BM-derived C57BL/6 mature (MHC II high, B7-2 high) dendritic cells are Y-Ae positive. A, Cytometry-coupled immunofluorescence analysis of GM-CSF-driven BM culture on days 7–8. Cells were double stained for CD86/B7-2 and Y-Ae. Controls for Y-Ae staining were B10. A (5R) (I-Ab+/I-E+) and B10.BR (I-Ab-/I-E+) cultures (left panels). Control staining for C57BL/6 (I-Ab+/I-E-) cells included the isotype-matched anti-I-E Y17 and the anti-I-Ab Y3JP mAbs. Stainings are representative of three independent experiments. B, Histogram representation of C57BL/6 BM culture stained on days 7–8. Histograms were plotted after electronic gating on B7-2+ cells.

Concluding remark

Here, we report that neonatal injection of an mAb (Y-Ae) specific for a self-peptide:self-MHC class II complex (E_52–68:I-A^b) can partially, but specifically, interfere with the process of negative selection of thymocytes carrying a synonymous TCR-ß (1H3.1). This effect further illustrates peptide specificity in negative selection. Similar inhibition experiments conducted with unmanipulated C57BL/6 (I-A^b+/I-E^-) newborn mice revealed that Y-Ae cross-reacts with a constitutively expressed, E_52–68-independent, self-peptide:MHC class II complex(es). This conclusion is supported by the fact that fully mature (MHC class II high) dendritic cells derived from BM progenitors stain positively for Y-Ae. Thus, the data provide functional and phenotypic evidence for presentation of E_52–68 structurally related self-peptide(s) in I-E-deficient mice.

	Acknowledgments

 
The Ig-I-E^d Tg mice were originally generated in the laboratory of Dr. R. A. Flavell (Yale University). The H-2M^-/- mice (B6-129 mixed background) were a gift from Dr. L. Van Kaer (Howard Hughes Medical Institute, Nashville, TN). We also thank Dr. S. J. Turley (Yale University) for advice with bone marrow culture, and Drs. C. Benoist and D. Mathis (Institut Nationale de la Santé et de la Recherche Médicale-Centre Nationale de la Recherche, Strasbourg, France) for providing the pT and pTß cassette DNA. C.A.J. is an investigator with Howard Hughes Medical Institute.

	Footnotes

 
¹ This work was supported in part by Howard Hughes Medical Institute and Grant AI14579 (to C.A.J.).

² Address correspondence and reprint requests to Dr. Charles A. Janeway, Jr., Section of Immunobiology, LH 416, Yale University School of Medicine, 310 Cedar Street, New Haven, CT 06520-8011.

³ Abbreviations used in this paper: BM, bone marrow; Tg, transgenic; SAg, superantigen; LN, lymph node.

Received for publication October 19, 1999. Accepted for publication February 24, 2000.

	References

Top Abstract Introduction Materials and Methods Results and Discussion References

 

1. Robey, E., B. J. Fowlkes. 1994. Selective events in T cell development. Annu. Rev. Immunol. 12:675.[Medline]
2. Jr Janeway, C. A.. 1994. Thymic selection: two pathways to life and two to death. Immunity 1:3.[Medline]
3. von Boehmer, H.. 1994. Positive selection of lymphocytes. Cell 76:219.[Medline]
4. Nossal, G. J.. 1994. Negative selection of lymphocytes. Cell 76:229.[Medline]
5. Sprent, J., S. R. Webb. 1995. Intrathymic and extrathymic clonal deletion of T cells. Curr. Opin. Immunol. 7:196.[Medline]
6. Kisielow, P., H. S. Teh, H. Bluthmann, H. von Boehmer. 1988. Positive selection of antigen-specific T cells in thymus by restricting MHC molecules. Nature 335:730.[Medline]
7. Kishimoto, H., J. Sprent. 1997. Negative selection in the thymus includes semimature T cells. J. Exp. Med. 185:263.[Abstract/Free Full Text]
8. Page, D. M., L. P. Kane, J. P. Allison, Hedrick S. M.. 1994. Two signals are required for negative selection of CD4⁺8⁺ thymocytes. J. Immunol. 151:1868.[Abstract]
9. Aiba, Y., O. Mazda, M. M. Davis, S. Muramatsu, Y. Katsura. 1994. Requirement of a second signal from antigen presenting cells in the clonal deletion of immature T cells. Int. Immunol. 6:1475.[Abstract/Free Full Text]
10. Moore, N. C., G. Anderson, D. E. McLoughlin, J. J. Owen, E. J. Jenkinson. 1994. Differential expression of Mtv loci in MHC class II-positive thymic stromal cells. J. Immunol. 152:4826.[Abstract]
11. Zal, T., A. Volkmann, B. Stockinger. 1994. Mechanisms of tolerance induction in major histocompatibility complex class II-restricted T cells specific for a blood-borne self-antigen. J. Exp. Med. 180:2089.[Abstract/Free Full Text]
12. Surh, C. D., J. Sprent. 1994. T-cell apoptosis detected in situ during positive and negative selection in the thymus. Nature 372:100.[Medline]
13. Punt, J. A., B. A. Osborne, Y. Takahama, S. O. Sharrow, A. Singer. 1994. Negative selection of CD4⁺8⁺ thymocytes by T cell receptor-induced apoptosis requires a costimulatory signal that can be provided by CD28. J. Exp. Med. 179:709.[Abstract/Free Full Text]
14. Douek, D. C., K. T. T. Corley, T. Zal, A. Mellor, J. Dyson, D. M. Altmann. 1996. Negative selection by endogenous antigen and superantigen occurs at multiple thymic sites. Int. Immunol. 9:1413.
15. Laufer, T. M., J. DeKoning, J. S. Markowitz, D. Lo, L. H. Glimcher. 1996. Unopposed positive selection and autoreactivity in mice expressing class II MHC only on thymic cortex. Nature 383:81.[Medline]
16. Wack, A., H. M. Ladyman, O. Williams, K. Roderick, M. A. Ritter, D. Kioussis. 1996. Direct visualisation of thymocytes apoptosis in neglect, acute and steady-state negative selection. Int. Immunol. 10:1537.
17. Pircher, H., K. Burki, R. Lang, H. Hengartner, R. M. Zinkernagel. 1989. Tolerance induction in double specific T-cell receptor transgenic mice varies with antigen. Nature 342:559.[Medline]
18. Martin, S., M. J. Bevan. 1997. Antigen-specific and nonspecific deletion of immature cortical thymocytes caused by antigen injection. Eur. J. Immunol. 27:2726.[Medline]
19. Kruisbeek, A. M., M. J. Fultz, S. O. Sharrow, A. Singer, J. J. Mond. 1983. Early development of the T cell repertoire: in vivo treatment of neonatal mice with anti-Ia antibodies interferes with differentiation of I-restricted T cells but not K/D-restricted T cells. J. Exp. Med. 157:1932.[Abstract/Free Full Text]
20. Kruisbeek, A. M., J. J. Mond, B. J. Fowlkes, J. A. Carmen, S. Bridges, D. L. Longo. 1985. Absence of the Lyt-2^-, L3T4⁺ lineage of T cells in mice treated neonatally with anti-I-A correlates with absence of intrathymic I-A-bearing antigen-presenting cell function. J. Exp. Med. 161:1029.[Abstract/Free Full Text]
21. Burkly, L. C., S. Degermann, J. Longley, J. Hagman, R. L. Brinster, D. Lo, R. A. Flavell. 1993. Clonal deletion of Vß5⁺ T cells by transgenic I-E restricted to thymic medullary epithelium. J. Immunol. 151:3954.[Abstract]
22. Rudensky, A. Y., S. Rath, P. Preston-Hurlburt, D. B. Murphy, Jr C. A. Janeway. 1991. On the complexity of self. Nature 353:660.[Medline]
23. Kouskoff, V., K. Signorelli, C. Benoist, D. Mathis. 1995. Cassette vectors directing expression of T cell receptor genes in transgenic mice. J. Immunol. Methods 180:273.[Medline]
24. Inaba, K., M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu, R. M. Steinman. 1992. Generation of large numbers of dendritic cells from mouse bone marrow culture supplemented with granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 176:1693.[Abstract/Free Full Text]
25. Rudensky, A. Y., P. Preston-Hurlburt, S. C. Hong, A. Barlow, Jr C. A. Janeway. 1991. Sequence analysis of peptides bound to MHC class II molecules. Nature 353:622.[Medline]
26. Murphy, D. B., S. Rath, E. Pizzo, A. Y. Rudensky, A. George, J. K. Larson, Jr C. A. Janeway. 1992. Monoclonal antibody detection of a major self peptide. MHC class II complex. J. Immunol. 148:3483.[Abstract]
27. Murphy, D. B., D. Lo, S. Rath, R. L. Brinster, R. A. Flavell, A. Slanetz, Jr C. A. Janeway. 1989. A novel MHC class II epitope expressed in thymic medulla but not cortex. Nature 338:765.[Medline]
28. Mathis, D., C. Benoist, V. E. Williams, M. Kanter, H. O. McDevitt. 1983. Several mechanisms can account for defective E gene expression in different mouse haplotypes. Proc. Natl. Acad. Sci. USA 80:273.[Abstract/Free Full Text]
29. Kirberg, J., A. Baron, S. Jakob, A. Rolink, K. Karjalainen, H. von Boehmer. 1994. Thymic selection of CD8⁺ single positive cells with a class II major histocompatibility complex-restricted receptor. J. Exp. Med. 180:25.[Abstract/Free Full Text]
30. Jr Janeway, C. A., P. J. Conrad, E. A. Lerner, J. Babich, P. Wettstein, D. B. Murphy. 1984. Monoclonal antibodies specific for Ia glycoproteins raised by immunization with activated T cells: possible role of T cell bound Ia antigens as targets of immunoregulatory T cells. J. Immunol. 132:662.[Abstract]
31. Ozato, K., N. Mayer, D. H. Sachs. 1980. Hybridoma cell lines secreting monoclonal antibodies to mouse H-2 and Ia antigens. J. Immunol. 124:533.[Abstract]
32. Chervonsky, A. V., R. M. Medzhitov, L. K. Denzin, A. K. Barlow, A. Y. Rudensky, Jr C. A. Janeway. 1998. Subtle conformational changes induced in major histocompatibility complex class II molecules by binding peptides. Proc. Natl. Acad. Sci. USA 95:10094.[Abstract/Free Full Text]
33. Merkenschlager, M., C. Benoist, D. Mathis. 1994. Evidence for a single-niche model of positive selection. Proc. Nat. Acad. Sci. USA 91:11694.[Abstract/Free Full Text]
34. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
35. Yagi, J., Jr C. A. Janeway. 1990. Ligand thresholds at different stages of T cell development. Int. Immunol. 2:83.[Abstract/Free Full Text]
36. Pircher, H., U. H. Rohrer, D. Moskophidis, R. M. Zinkernagel, H. Hengartner. 1991. Lower receptor avidity required for thymic clonal deletion than for effector T-cell function. Nature 351:482.[Medline]
37. Oehen, S., L. Feng, Y. Xia, C. D. Surh, S. M. Hedrick. 1996. Antigen compartmentation and T helper cell tolerance induction. J. Exp. Med. 183:2617.[Abstract/Free Full Text]
38. Rudensky, A. Y.. 1995. Endogenous peptides associated with MHC class II and selection of CD4 T cells. Semin. Immunol. 7:399.[Medline]
39. Martin, W. D., G. G. Hicks, S. K. Mendiratta, H. I. Leva, E. H. Ruley, L. Van Kaer. 1996. H-2^m mutant mice are defective in the peptide loading of class II molecules, antigen presentation, and T cell repertoire selection. Cell 84:543.[Medline]
40. Miyazaki, T., P. Wolf, S. Tourne, C. Waltzinger, A. Dierich, N. Barois, H. Ploegh, C. Benoist, D. Mathis. 1996. Mice lacking H2-M complexes, enigmatic elements of the MHC class Ii peptide loading pathway. Cell 84:531.[Medline]
41. Fung-Leung, W. P., C. D. Surh, M. Liljedahl, J. Pang, D. Leturcq, P. A. Peterson, S. R. Webb, L. Karlsson. 1996. Antigen presentation and T cell development in H2-M deficient mice. Science 271:1278.[Abstract]
42. Pierre, P., S. J. Turley, E. Gatti, M. Hull, J. Meltzer, A. Mirza, K. Inaba, R. M. Steinman, I. Mellman. 1997. Developmental regulation of MHC class II transport in mouse dendritic cells. Nature 388:787.[Medline]
43. Turley, S. J. 1999. Dynamics of the MHC class II pathway in developing dendritic cells. Doctoral dissertation. Yale University, New Haven, CT.

This article has been cited by other articles:

				K. A. Markey, T. Banovic, R. D. Kuns, S. D. Olver, A. L. J. Don, N. C. Raffelt, Y. A. Wilson, L. J. Raggatt, A. R. Pettit, J. S. Bromberg, et al. Conventional dendritic cells are the critical donor APC presenting alloantigen after experimental bone marrow transplantation Blood, May 28, 2009; 113(22): 5644 - 5649. [Abstract] [Full Text] [PDF]

				A. Montecalvo, W. J. Shufesky, D. Beer Stolz, M. G. Sullivan, Z. Wang, S. J. Divito, G. D. Papworth, S. C. Watkins, P. D. Robbins, A. T. Larregina, et al. Exosomes As a Short-Range Mechanism to Spread Alloantigen between Dendritic Cells during T Cell Allorecognition J. Immunol., March 1, 2008; 180(5): 3081 - 3090. [Abstract] [Full Text] [PDF]

				D. A. Blair and L. Lefrancois Increased competition for antigen during priming negatively impacts the generation of memory CD4 T cells PNAS, September 18, 2007; 104(38): 15045 - 15050. [Abstract] [Full Text] [PDF]

				M. J. Perone, A. T. Larregina, W. J. Shufesky, G. D. Papworth, M. L. G. Sullivan, A. F. Zahorchak, D. B. Stolz, L. G. Baum, S. C. Watkins, A. W. Thomson, et al. Transgenic galectin-1 induces maturation of dendritic cells that elicit contrasting responses in naive and activated T cells. J. Immunol., June 15, 2006; 176(12): 7207 - 7220. [Abstract] [Full Text] [PDF]

				A. E. Morelli, A. T. Larregina, W. J. Shufesky, M. L. G. Sullivan, D. B. Stolz, G. D. Papworth, A. F. Zahorchak, A. J. Logar, Z. Wang, S. C. Watkins, et al. Endocytosis, intracellular sorting, and processing of exosomes by dendritic cells Blood, November 15, 2004; 104(10): 3257 - 3266. [Abstract] [Full Text] [PDF]

				C. Viret, X. He, and C. A. Janeway Jr. Altered positive selection due to corecognition of floppy peptide/MHC II conformers supports an integrative model of thymic selection PNAS, April 29, 2003; 100(9): 5354 - 5359. [Abstract] [Full Text] [PDF]

				S. B. Lovitch, J. J. Walters, M. L. Gross, and E. R. Unanue APCs Present A{beta}k-Derived Peptides That Are Autoantigenic to Type B T Cells J. Immunol., April 15, 2003; 170(8): 4155 - 4160. [Abstract] [Full Text] [PDF]

				C. Viret and C. A. Janeway Jr. Self-Specific MHC Class II-Restricted CD4-CD8- T Cells That Escape Deletion and Lack Regulatory Activity J. Immunol., January 1, 2003; 170(1): 201 - 209. [Abstract] [Full Text] [PDF]

				C. Viret, X. He, and C. A. Janeway Jr. Paradoxical intrathymic positive selection in mice with only a covalently presented agonist peptide PNAS, July 19, 2001; (2001) 161274698. [Abstract] [Full Text] [PDF]

				C. Viret, D. B. Sant'Angelo, X. He, H. Ramaswamy, and C. A. Janeway Jr. A Role for Accessibility to Self-Peptide-Self-MHC Complexes in Intrathymic Negative Selection J. Immunol., April 1, 2001; 166(7): 4429 - 4437. [Abstract] [Full Text] [PDF]

				C. Viret, X. He, and C. A. Janeway Jr. On the Self-Referential Nature of Naive MHC Class II-Restricted T Cells J. Immunol., December 1, 2000; 165(11): 6183 - 6192. [Abstract] [Full Text] [PDF]

				C. Viret, X. He, and C. A. Janeway Jr. Paradoxical intrathymic positive selection in mice with only a covalently presented agonist peptide PNAS, July 31, 2001; 98(16): 9243 - 9248. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Viret, C. Articles by Janeway, C. A. Search for Related Content PubMed PubMed Citation Articles by Viret, C. Articles by Janeway, C. A., Jr.