The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Farrell, A.-M.
Right arrow Articles by Mui, A. L.-F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Farrell, A.-M.
Right arrow Articles by Mui, A. L.-F.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*L-TYROSINE
The Journal of Immunology, 2000, 164: 4607-4615.
Copyright © 2000 by The American Association of Immunologists

Stat3-Dependent Induction of p19INK4D by IL-10 Contributes to Inhibition of Macrophage Proliferation1

Anne-Marie O’Farrell2,*, David A. Parry{dagger}, Frederique Zindy{ddagger}, Martine F. Roussel{ddagger}, Emma Lees{dagger}, Kevin W. Moore* and Alice L.-F. Mui3,*

Departments of * Molecular Biology and {dagger} Cell Signaling, DNAX Research Institute, Palo Alto, CA 94304; and {ddagger} Department of Tumor Cell Biology, St. Jude Children’s Research Hospital, Memphis, TN 38105


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have previously reported that IL-10 inhibits proliferation of normal bone marrow-derived macrophages and of the monocyte/macrophage cell line J774. Activation of Stat3 was shown to be necessary and sufficient to mediate inhibition of proliferation. To investigate further the mechanism of growth arrest, we examined the effect of IL-10 on expression of cell cycle inhibitors. We found that IL-10 treatment increases expression of the cyclin-dependent kinase inhibitors p19INK4D and p21CIP1 in macrophages. IL-10 cannot induce p19INK4D expression or block proliferation when Stat3 signaling is blocked by a dominant negative Stat3 or a mutant IL-10R{alpha} which does not recruit Stat3 in J774 cells, whereas p21CIP1 induction is not affected. An inducibly active Stat3 (coumermycin-dimerizable Stat3-Gyrase B), which suppresses J774 cell proliferation, also induced p19INK4D expression. Sequencing of the murine p19INK4D promoter revealed two candidate Stat3 binding sites, and IL-10 treatment activated a reporter gene controlled by this promoter. These data suggest that Stat3-dependent induction of p19INK4D mediates inhibition of proliferation. Enforced expression of murine p19INK4D cDNA J774 cells significantly reduced their proliferation. Use of antisense p19INK4D and analysis of p19INK4D-deficient macrophages confirmed that p19INK4D is required for optimal inhibition of proliferation by IL-10, and indicated that additional IL-10 signaling events contribute to this response. These data indicate that Stat3-dependent induction of p19INK4D and Stat3-independent induction of p21CIP1 are important components of the mechanism by which IL-10 blocks proliferation in macrophages.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-10 exhibits a wide range of biological effects on different cell types, ranging from costimulation of thymocytes, mast cells, and B cells to inhibition of macrophage, NK, dendritic, and T cell function, (for review, see Refs. 1, 2). Deactivation of activated macrophages by IL-10 is a key mechanism for limiting inflammation. IL-10 potently inhibits macrophage production of inflammatory mediators, including cytokines (3), chemokines, reactive oxygen, and nitrogen intermediates, and expression of surface Ags involved in Ag presentation (4, 5). In addition to these classical activities, we recently showed that IL-10 inhibits proliferation of bone marrow-derived macrophages and of the monocyte/macrophage cell line J774 (6).

Two components of the IL-10R complex have been identified, IL-10R{alpha} (7, 8) and CRF2–4 (9, 10), both members of the class II family of cytokine receptors. The primary ligand binding component, IL-10R{alpha}, binds IL-10 with high affinity and in the presence of IL-10 associates with the accessory subunit CRF2–4 (9). Both chains are required for signal transduction (9, 10), and like other members of the class II receptor family, such as IFN receptors, the two subunits interact with members of the Jak tyrosine kinase family; IL-10R{alpha} and CRF2–4 bind Jak1 and Tyk2, respectively (9, 11), in a ligand-independent manner. IL-10-induced heterodimerization leads to activation of the Jak kinases and phosphorylation of IL-10R{alpha} on cytoplasmic tyrosines (Tyr446 and Tyr496 in hIL-10R{alpha}) (12). These residues form docking sites for members of the STAT family of transcription factors. Stat3 is directly recruited to IL-10R{alpha} and becomes phosphorylated by receptor-associated Jak kinases. Stat1 is also activated by IL-10 in macrophages (13, 14, 15), but the mechanism of its recruitment to the IL-10R complex is unclear. Upon phosphorylation, Stat1 and Stat3 homo/hetero dimerize and translocate to the nucleus where they bind to specific promoter sequences and stimulate transcription of target genes.

We previously used tyrosine mutant forms of IL-10R{alpha} and modified Stat3 molecules to investigate the role of Stat3 in macrophage responses to IL-10. We found that the membrane distal tyrosines 446 and 496 of IL-10R{alpha} are required for inhibition of macrophage proliferation by IL-10. A dominant-negative Stat3 construct blocked the anti-proliferative effect of IL-10 (6). Furthermore, an inducibly active form of Stat3, STAT-Gyrase B (GyrB),4 a fusion of Stat3 and the dimerization domain of GyrB which is dimerizable by coumermycin, mimicked the ability of IL-10 to suppress proliferation (6). These studies implicated Stat3 and presumably Stat3-regulated gene(s) in inhibition of the macrophage cell cycle by IL-10. Subsequent studies in macrophages deficient in Stat3 confirmed the importance of the Stat3 pathway in the antiproliferative action of IL-10 (16). Use of Stat3-deficient macrophages implicated Stat3 in macrophage deactivation, although expression of a dominant-negative Stat3 in the J774 monocyte/macrophage cell line does not block these responses, suggesting that the residual Stat3 activity present is sufficient to mediate the anti-inflammatory activities of IL-10 (6). Recently, it has been shown that the anti-inflammatory functions of IL-10 also require a second signal mediated from a distinct region of the IL-10R C-terminal to the two tyrosines responsible for Stat3 activation (17).

Cell cycle progression through the first gap phase (G1) of the cell cycle into the DNA synthesis (S) phase requires the concerted action of G1 cyclins D and E and their catalytic partners cyclin-dependent kinases (cdks) (for review, see Ref. 18). Stimulation with mitogens induces expression of the D-type cyclins, which specifically associate with cdks 4 and 6. Phosphorylation of Retinoblastoma protein releases the E2F transcription factor, facilitating transcription of genes required for S phase (19). The activity of the cyclin D-cdk complex is however also subject to negative regulation by two families of cell cycle inhibitors, the INK4 family and the CIP/KIP family. The INK4 family, which includes p15INK4B, p16INK4A, p18INK4C, and p19INK4D, specifically binds to and inhibits only cdks 4 and 6 (20, 21, 22), thereby inhibiting D-type cyclin activity and preventing entry into S phase. Overexpression of members of the INK4 family is sufficient to block cell proliferation (21). The CIP/KIP family of cell cycle inhibitors, which includes p21CIP1 and p27KIP1 and p57KIP2, enter complexes with both cyclins A or E and cyclin D and have been shown to inhibit cyclins A- or E-associated cdk2 activity, but stabilize cyclin D-associated cdk4/6 activity (for review, see Ref. 23). The antiproliferative action of cytokines has been associated with increased expression of cell cycle inhibitors. For example, the antimitogenic effects of TGF-ß, IFN-{alpha}, IFN-{gamma}, and IL-6 have been associated with induction of p15INK4B and p21CIP1 (24, 25), p15INK4B and p19INK4D (26, 27), p21CIP1 (28), and p18INK4C (29), respectively.

In addition to macrophages, IL-10 inhibits proliferation of other cell types including T cells (30, 31) and normal and leukemic myeloid progenitor cells (32, 33, 34, 35). Although in some instances inhibition of autocrine growth factor production by IL-10 has been shown to contribute to its growth-suppressing activity, no evidence of an IL-10-regulated autocrine growth loop was found for J774 cells (6). We examined the ability of IL-10 to regulate expression of cell cycle inhibitors in macrophage cell types and found that IL-10 treatment specifically induced p19INK4D expression. Using J774 cell lines expressing either mutant IL-10R, dominant-negative Stat3, or inducibly active Stat3, we provide evidence that activation of Stat3 is required and sufficient to induce p19INK4D expression through specific promoter elements.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents

All reagents were obtained from Sigma (St. Louis, MO), unless otherwise described. Recombinant human (h) and murine (m) IL-10 were obtained as described previously (7) and macrophage CSF (M-CSF) was obtained from R&D Systems (Minneapolis, MN).

Antibodies

A rat anti-mIL-10R-blocking mAb (1B1.2, IgG1) has been described previously (6). For Abs raised against murine p18INK4C and murine p19INK4D, peptides corresponding to the C-terminal regions (CSLMEANGVGGATSLQ and CQNLMDILQGHMMIPM, respectively) were synthesized (Research Genetics, Huntsville, AL), coupled to keyhole limpet hemocyanin (Pierce, Rockford, IL), and injected into rabbits (Pocono Rabbit Farm, Canadensis, PA). Peptide antisera were affinity purified against cognate immunogen (Sulfolink; Pierce) and dialyzed against PBS/1 mM DTT plus 20% glycerol. Ab specificity was confirmed using specific in vitro translated products, immunoprecipitation, and V8 proteolytic analysis.

Cell culture and proliferation assays

J774 cells (American Type Culture Collection, Manassas, VA) were cultured in DMEM supplemented with 10% (v/v) FBS on tissue culture grade plates and passaged twice weekly. Mouse strains (C57BL/6 x 129Svj) deficient in p19INK4D were recently described (36). Macrophages were derived from murine normal bone marrow (NBM) by in vitro differentiation as described previously (6). All stimulations of J774 cells/NBM-derived macrophages were at 37°C. [3H]Thymidine incorporation by J774 cells or NBM-derived macrophages cultured on 96-well plates was measured as described previously (6). For all experiments, all cell populations were seeded at equal densities, and each condition was assayed in triplicate in multiple experiments.

Expression constructs

J774 cells expressing {Delta}Stat1, {Delta}Stat3, Stat3-GyrB, hIL-10R, and hIL-10R:TyrFF have been described previously (6). For all experiments with J774 cells expressing hIL-10R and hIL-10R:TyrFF, cells were treated with hIL-10 (100 ng/ml) in the presence of neutralizing Ab against mIL-10R{alpha} (1B1.2) which prevents signaling through endogenous mIL-10{alpha}. For parental J774, J774:{Delta}Stat3 cells, and J774:Stat3-GyrB, mIL-10 was used at 100 ng/ml. For J774:Stat3-GyrB, dimerization of STAT-GyrB was induced by addition of coumermycin A1 at concentrations of 0.1–100 µM. J774 cells expressing p19INK4D were generated by retroviral transduction as described elsewhere (6), with pMXpuro containing full-length murine p19INK4D, and selected in puromycin (5 µg/ml). Multiple independently derived clones were analyzed in all experiments.

Transient transfection assays

J774 cells were transfected by the LipofectAMINE method, as suggested by the manufacturer (Promega, Madison, WI). Briefly, cells were incubated in a DNA:LipofectAMINE mixture at 37°C in serum-free Opti-MEM (Life Technologies, Rockville, MD) for 4 h. An equal volume of RPMI 1640 containing 20% FBS was added, and, after a recovery period of 6–12 h, IL-10 or coumermycin was added for an additional 24 h, as indicated. Cytoplasmic extracts were prepared in reporter lysis buffer and assayed in triplicate for luciferase activity (Promega). As a control for transfection, efficiency cells were cotransfected with pMEß-Gal (1 µg) and assayed for ß-galactosidase activity (Tropix, Bedford, MA). Sense and antisense 25-mer phosphorothioate oligonucleotides spanning the translation start site of murine p19INK4D were obtained from Research Genetics and introduced into J774 cells by LipofectAMINE transfection. Antisense oligonucleotides decreased p19 INK4D protein expression by ~50%, whereas sense oligonucleotides had no effect.

Immunoprecipitation and Western blot analysis

Cells were washed twice with cold PBS and lysed at 4°C with 0.5% (v/v) Triton X-100 (Pierce) in lysis buffer (50 mM HEPES, 100 mM NaF, 10 mM NaPPi, 2 mM Na3V04, 4 mM EDTA, 2 mM pefabloc, 10 µg/ml aprotinin, and 2 µg/ml leupeptin; Boehringer Mannheim, Indianapolis, IN) for 40 min. Cell lysates were collected after centrifugation at 15,000 rpm for 15 min and stored at -70°C. Protein concentration was determined by the bicinchoninic acid protocol (Pierce), and 100 µg of each lysate was used for immunoprecipitation, performed as described elsewhere (37). Briefly, lysates were incubated with saturating concentrations of primary Ab (12.5 µg/ml) at 4°C for 4–6 h, and protein A beads (Santa Cruz Biotechnology, Santa Cruz, CA) were added for an additional 2 h. Beads were washed four times with lysis buffer containing 0.1% Nonidet P-40 and incubated for 10 min at room temperature in SDS sample buffer before loading on polyacrylamide-SDS gels. Protein transfer and Western blotting were performed as described previously(6), followed by detection using enhanced chemiluminescence. All experiments were performed at least three times and showed similar results.

RNA blot analysis

Cells were stimulated at 37°C for the time periods indicated, washed with PBS and collected by centrifugation. Total RNA was prepared by the RNeasy protocol (Qiagen, Valencia, CA), as instructed in kit protocol, and separated on 1.2% agarose-formaldehyde gels. RNA was transferred to nylon membranes and hybridized with 32P-labeled cDNA fragments, as described elsewhere (37). RNA concentration was estimated by OD determination, and equal gel loading and transfer to membranes was confirmed either by ethidium bromide staining or by hybridization of membranes with GAPDH cDNA (Clontech Laboratories, Palo Alto, CA).

Cloning and sequence analysis of the murine p19INK4D promoter

A bacteriophage library was prepared by ligation of EcoRI-digested EMBL3 phage arms with high m.w. DNA from embryonic cells (38) partially digested with MboI. A total of 1 x 106 phages was screened with a random primed 32P-labeled full-length murine p19INK4D cDNA probe. Positive plaques were isolated and genomic DNA inserts were characterized. The phage containing the genomic DNA encoding the first coding exon and 5 kb of the 5' flanking region was purified, and the genomic insert was subcloned into the pBluescript plasmid and sequenced by the Taq dideoxy method using an ABI 310 automated sequencer. The mutant p19INK4D promoter was constructed using a Stratagene (La Jolla, CA) Qwikchange mutagenesis kit and sense and antisense primers for the following sequence: GCTGATTGGCTGTTATCACCACCAGGCGGGACTAATGGAG, where the underlined letters denote bases in potential STAT binding sites mutated from TC to CA and G to C. The construct was confirmed by DNA sequencing.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-10 increases expression of p19INK4D mRNA and protein

We have recently shown that IL-10 inhibits proliferation of J774 cells (6), arresting cells in the G1 phase of the cell cycle. To further explore the mechanism of action of IL-10, we examined expression of the INK4 family which blocks progression through the G1 phase by inhibiting cdk4 and cdk6.

Addition of recombinant mIL-10 strongly induced p19INK4D mRNA in J774 cells (Fig. 1Goa). Addition of cycloheximide did not inhibit this induction, suggesting that protein synthesis is not required for this effect of IL-10. Immunoprecipitation (IP) experiments using Abs generated against p19INK4D confirmed that p19INK4D protein levels were increased at 3 and 10 h following the addition of IL-10 (Fig. 1Gob). We observed that J774 cells also express a second member of the INK4 family, p18INK4D, but its expression was not altered by IL-10 (Fig. 1Goc). p16INK4A was not detectably expressed in J774 cells, and p15INK4B was expressed but not up-regulated in response to IL-10 (D. A. Parry and A. M. O’Farrell, unpublished results). p19INK4D appears to be the only member of the INK4 family to be induced by IL-10 in the J774 cell type. As expected, increased p19INK4D expression in IL-10-treated cells was accompanied by increased amounts of cdk4 and cdk6 recovered in p19INK4D immunoprecipitates (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 1. Expression of p19INK4D and p18INK4C in response to IL-10. a, J774 cells were cultured for 1 h in the presence or absence of cycloheximide (CH, 2.5 µg/ml) and for an additional 3 h in the presence or absence of IL-10 (100 ng/ml), as indicated. RNA was isolated and Northern blot analysis was performed with 32P-labeled full-length murine p19INK4D probe. Ethidium bromide staining of the blot confirmed equal loading in all lanes. A representative of three experiments that showed similar results is shown. b, J774 cells were cultured in presence of IL-10 for 3 or 10 h or in the absence of IL-10. Total protein lysates were IP with anti-p19INK4D and Western blot analysis (W) was performed with anti-p19INK4D. A representative of four experiments that showed similar results is shown. c, J774 cells were cultured in the presence of IL-10 for 3 or 10 h or in the absence of IL-10. Total protein lysates were prepared and immunoprecipitated with anti-p18INK4C and Western blot analysis was performed with anti-p18INK4C.

 
To assess the role of IL-10 in a more physiological setting, primary cultures of murine NBM-derived macrophages were used, in which IL-10 inhibits M-CSF- dependent proliferation (6). Cells were stimulated with M-CSF in the presence and absence of IL-10. Analysis by IP/Western blot showed that addition of IL-10 alone induced p19INK4D after 6 h (Fig. 2Go). In the presence of M-CSF plus IL-10, p19INK4D expression was enhanced at 6 h and further enhanced at 18 h when inhibition of M-CSF-dependent proliferation by IL-10 can be detected (Fig. 2Go). M-CSF alone marginally increased p19INK4D expression. IL-10 also enhanced expression of p19INK4D mRNA in NBM-derived macrophages (data not shown). These data verify that the IL-10-induced expression of p19INK4D is seen in primary cultures as well as in the J774 cell line.



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 2. IL-10 induces expression of p19INK4D in NBM-derived macrophages. NBM-derived macrophages were cultured in the absence of cytokine or in the presence of M-CSF (50 ng/ml), IL-10 (100 ng/ml), or M-CSF plus IL-10 for 6 or 18 h as indicated. Total protein lysates were immunoprecipitated with anti-p19INK4D and Western blot analysis was performed. At least three experiments using independently derived NBM-derived macrophages were performed and showed similar results.

 
Induction of p19INK4D requires Stat3 and the membrane-distal tyrosines of IL-10R{alpha}

Growth arrest by IL-10 is Stat3-dependent and requires two membrane-distal tyrosines of the IL-10R{alpha}. We have previously described two modified J774 cell lines which are not growth inhibited by IL-10 (6). The first expresses a mutant hIL-10R{alpha} where the two membrane-distal tyrosines 446 and 496, which recruit Stat3, were mutated to phenylalanine (hIL-10R:TyrFF). In this mutant, Stat3 can no longer bind and become activated (12). In contrast, in J774 cells expressing the wild-type (WT) hIL-10R{alpha}, treatment with hIL-10 results in growth inhibition, as seen in parental cells (6). The second expresses a carboxyl-truncated dominant-negative form of Stat3 ({Delta}Stat3). We investigated the ability of IL-10 to induce p19INK4D in these cell lines. In hIL-10R{alpha} cells, hIL-10 increased p19INK4D mRNA expression (Fig. 3Goa, hIL10R:WT) to a level comparable to mIL-10 acting through the endogenous mIL-10R{alpha} (Fig. 3Goa, parental). In cells expressing the hIL-10R:TyrFF, IL-10 can no longer induce p19INK4D (Fig. 3Goa, hIL-10R:TyrFF). Consistent with recruitment of Stat3 to Tyr446 and Tyr496, IL-10 did not significantly induce p19INK4D in J774 cells transduced with {Delta}Stat3 (Fig. 3Goa, {Delta}Stat3). We consistently observe that the basal level of p19INK4D mRNA is lower in cells expressing hIL-10R than in parental cells. This is not due to clonal variation among cell lines because the hIL-10R:WT (and hIL-10R:TyrFF) cells used in these experiments are bulk populations isolated by flow cytometry based on hIL-10R expression. Rather, the difference may to be due to the presence of a neutralizing anti-mIL-10R{alpha} used in these experiments to block hIL-10 binding to endogenous mIL-10R{alpha}. The mechanism of this effect of the anti-mIL-10R Ab is not clear, and the possibility that it is blocking the action of an endogenously produced cytokine that signals through the mIL-10R is being investigated. IL-10 also activates Stat1 in J774 cells (A. M. O’Farrell, unpublished results). However, Stat1 is not directly recruited to IL-10R{alpha} and does not appear to mediate inhibition of proliferation by IL-10 (6). Accordingly, a dominant-negative Stat1 did not disrupt p19INK4D induction by IL-10 (Fig. 3Goa, {Delta}Stat1).



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 3. IL-10 does not induce expression of p19INK4D in J774:hIL-10RFF or J774:{Delta}Stat3 cells. a, Parental J774 and J774:{Delta}Stat3 cells were treated with mIL-10, and J774:hIL-10R, J774:hIL-10RFF cells were treated with hIL-10 in the presence of anti-mIL-10R (IBI.2) for the incubation times indicated. Total RNA was isolated and Northern blot analysis was performed with the full-length murine p19INK4D probe. Hybridization with a GAPDH probe shows equal RNA loading. b, Parental J774 and J774:{Delta}Stat3 cells were treated with mIL-10, and J774:hIL-10R and J774:hIL-10RFF cells were treated in the presence of anti-mIL-10R (IBI.2), with hIL-10, for 3 or 7 h. Total protein lysates were prepared and immunoprecipitated with anti-p19INK4D and Western blot analysis was performed with anti-p19INK4D (top panel). A representative of three experiments that showed similar results is shown.

 
The effect of IL-10 on p19INK4D protein levels corresponded to the observed changes in mRNA expression: p19INK4D was elevated by IL-10 at 3 and 7 h in parental and J774:hIL-10R cells (Fig. 3Gob, lanes 1–3 and 7–9, respectively). In cells expressing hIL-10R:TyrFF, IL-10 did not induce expression at 3 h, although expression was marginally increased at 7 h (Fig. 3Gob, lanes 10–12). Expression of {Delta}Stat3 blocked the ability of IL-10 to up-regulate p19INK4D. These data implicate p19INK4D as a target of Stat3-dependent signaling which is mediated via Tyr446 and Tyr496 of IL-10R{alpha}.

Inducible activation of Stat3-GyrB increases p19INK4D expression

To address whether Stat3 activation is sufficient to induce p19INK4D expression, we used Stat3-GyrB, an inducibly active form of Stat3 in which a full-length Stat3 is fused to the N-terminal, coumermycin-binding domain of bacterial GyrB. Addition of the small molecule drug coumermycin to cells expressing the fusion protein results in dimerization (39, 40), a process that can mimic activation of native Stats. J774 cells expressing Stat3-GyrB are growth inhibited by coumermycin by up to 40% in the absence of IL-10 (6), implying that activation of Stat3 is sufficient for inhibition of J774 proliferation. J774:Stat3-GyrB cells were treated with either coumermycin or IL-10, and p19INK4D levels were measured. Addition of coumermycin induced p19INK4D expression within 1 h and a further increase was apparent at 6 h, with a magnitude similar to that of IL-10 (Fig. 4Go). It should be noted that the levels of p19INK4D induced by IL-10 were more sustained than those induced by coumermycin (Fig. 4Go). These data show that activation of Stat3-GyrB by coumermycin is sufficient to induce p19INK4D expression.



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 4. Inducible dimerization of Stat-3:GyrB increases p19INK4 expression. J774:Stat3-GyrB cells were treated with either IL-10 or coumermycin (50 µM) for the indicated incubation times. RNA was isolated and used for Northern blot analysis with 32P-labeled p19INK4D cDNA probe. The intensity of p19INK4D relative to the control GAPDH signal, as quantitated by phosphor imager analysis, is presented in the bottom panel.

 
Expression of p19INK4D inhibits J774 cell proliferation

To address whether increased p19INK4D expression is sufficient to arrest growth, full-length p19INK4D was constitutively expressed in J774 cells by retroviral transduction. The cloning efficiency of J774 cells transduced with p19INK4D was at least 10-fold lower than that for the vector only control (data not shown), since a high level of constitutive p19INK4D expression blocks cells in G1 (21). However, sufficient numbers of clones for analysis did survive puromycin selection, and the levels of p19INK4D mRNA expressed in two independent clones of J774:p19INK4D cells and parental cells are shown in Fig. 5Goa. Endogenous and retrovirally expressed p19INK4D messages can clearly be distinguished by size. As anticipated, expression of endogenous p19INK4D was enhanced in response to IL-10, whereas retrovirally expressed p19INK4D was not regulated by IL-10. The increased expression of p19INK4D was sufficient to reduce proliferation of J774:p19INK4D clones (cultured in serum in the absence of IL-10) by 3- to 8-fold relative to control cells, an effect greater than that caused by IL-10 (Fig. 5Gob). It is noteworthy that addition of IL-10 further inhibited thymidine incorporation in J774:p19INK4D cells, perhaps suggesting a role for additional IL-10-activated pathways in inhibition of proliferation. These experiments indicate that ectopic constitutive expression of p19INK4D is sufficient to dramatically lower proliferation of J774 cells, but does not maximally inhibit proliferation.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 5. Overexpression of p19INK4D inhibits J774 cell proliferation. a, J774 cells expressing murine p19INK4D were generated by transduction of parental J774 cells with the retroviral vector pMXpuro-p19INK4D. Puromycin-resistant clones were treated with or without IL-10 for 6 h. RNA was isolated and used for Northern blot analysis with 32P-labeled p19INK4D (top panel). Hybridization with 32P-labeled GAPDH was performed to control for RNA loading (bottom panel). b, The proliferation capacity of J774 clones expressing p19INK4D described in a was assessed by measurement of [3H]thymidine incorporation. Each point is the mean ± SD of triplicate determinations for each condition.

 
The p19INK4D promoter is regulated by IL-10

To determine whether Stat3 might act directly on the p19INK4D promoter, we cloned and sequenced a 1637-bp fragment of the murine p19INK4D proximal promoter (GenBank accession no. AF098021). Two candidate STAT binding sites were identified, TTCCTTTAA and TTCCCAGCA, at nt -461 and -1151, respectively (Fig. 6Goa). A luciferase reporter controlled by the 1637-bp promoter fragment was generated and transiently transfected into J774 cells. Treatment of transfected cells with IL-10 up-regulated luciferase activity by ~3-fold relative to control cells (Fig. 6Gob), verifying that IL-10 acts transcriptionally on the p19INK4D promoter. Of the two potential STAT binding sites in the promoter, the site at -461 may be more likely to mediate STAT transactivation because of its proximity to the transcription initiation site. To assess its contribution to IL-10-mediated activation of the p19INK4D promoter, this site was mutated to TCACCACCA and the mutant analyzed for IL-10-induced transcriptional activity. As shown in Fig. 6Gob, the mutant promoter no longer responded to IL-10, indicating that IL-10 regulates promoter activity through Stat3.



View larger version (77K):
[in this window]
[in a new window]
 
FIGURE 6. The p19INK4D proximal promoter responds to IL-10. a, A 1637-bp fragment 5' of the first ATG (adenine of this codon designated base 1) in p19INK4D was sequenced. Two potential Stat3 binding sites identified by computer analysis at nt -461 and -1151, TTCCTTTAA and TTCCCAGCA, respectively, are boxed. The GenBank accession no. for the 1637-bp fragment is AF098021. b, The 1637-bp fragment was cloned into the pGL3 luciferase vector and transiently cotransfected with pME18S-LacZ control plasmid into J774 cells. Twelve hours after transfection, cells were split and treated either with or without IL-10, and luciferase and ß-galactosidase activity were measured after an additional 12 h. Similar analysis was performed with a p19INK4D promoter mutant in which the -461 site was mutated from TTCCCAGCA to TCACCACCA. Data are means of triplicate determinations and are presented as the means ± SD luciferase activity normalized by ß-galactosidase activity for each sample.

 
p19INK4D is required for optimal inhibition of proliferation by IL-10

To clarify the requirement for p19INK4D to inhibit proliferation, an antisense approach was used. Antisense oligonucleotides to p19 INK4D reduced the ability of IL-10 to inhibit proliferation in J774 cells by ~2-fold, whereas sense oligonucleotides did not (Fig. 7Goa). This suggests that p19 is required for optimal inhibition of proliferation by IL-10, and the observed inhibition of proliferation in the presence of antisense oligonucleotide may be mediated either by residual p19 INK4D, which is not blocked by antisense, or alternatively by other growth inhibitors. To further address this question, the ability of IL-10 to inhibit proliferation of macrophages generated from p19INK4D-deficient mice was investigated. The M-CSF-dependent proliferation of WT and p19 INK4D-deficient macrophages was similar, with proliferation above background first apparent at ~3 ng/ml M-CSF (Fig. 7Gob). IL-10 potently inhibited proliferation of WT macrophages, but was less efficient at inhibition of proliferation of p19 INK4D-deficient macrophages. For example, at 25 ng/ml M-CSF, IL-10 decreased proliferation by 3-fold in WT macrophages but only 1.9-fold in p19 INK4D-deficient macrophages. Statistical analysis by Student’s paired t test showed that the mean 1.80-fold inhibition of M-CSF (>3 ng/ml) stimulated proliferation in p19 INK4D-deficient macrophages was significantly different from the mean of 2.57-fold inhibition observed in WT macrophages (p < 0.05). This data clarifies that p19INK4D is required for full growth inhibitory responses to IL-10, and moreover suggests that additional mechanisms or pathways activated by IL-10 are involved.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 7. Use of antisense oligonucleotides and p19INK4D-deficient mice. a, Antisense or sense p19INK4D oligonucleotides were transfected into J774 cells, and each transfected population was cultured in the absence or presence of IL-10 for 48 h. Proliferation was measured by [3H]thymidine incorporation, and values represent the means ± SD of triplicate determinations for each condition. Control was cpm in the absence of IL-10. b, NBM-derived macrophages from WT (p19 +/+) or p19INK4D-deficient (p19-/-) mice were cultured in the presence of increasing concentrations of M-CSF as indicated, with or without IL-10, for 48 h. Proliferation was measured by [3H]thymidine incorporation, and values represent the means ± SD of triplicate determinations for each condition. Control was maximum proliferation observed in response to M-CSF alone for macrophages from WT or p19INK4D-deficient mice.

 
IL-10 induces expression of p21CIP1

IL-10 may induce additional cell cycle regulators which act in concert with p19INK4D to inhibit cell cycle progression, e.g., members of the CIP/KIP family. The expression of p21CIP1 was examined, and we found that IL-10 induced expression of p21CIP1 mRNA within 30 min, which increased at later time points (Fig. 8Go). To assess whether up-regulation of p21CIP1 was dependent on the membrane-distal tyrosines of hIL-10R{alpha} or Stat3, p21CIP1 expression was examined in the mutant J774 cell lines. In cells expressing WT hIL-10R:WT or hIL-10R:TyrFF, IL-10 induced p21CIP1 similar to that in control cells, suggesting that signaling from tyrosines 466 and 496 is not required to induce p21CIP1 expression. Consistent with this data, {Delta}Stat3 did not interfere with up-regulation of p21CIP1, implying that other pathways activated by the IL-10R complex are involved.



View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 8. IL-10 induces p21CIP1 expression. Parental J774 and J774:{Delta}Stat3 cells were treated with mIL-10, and J774:hIL-10R and J774:hIL-10RFF cells were treated with hIL-10 in the presence of anti-mIL-10R (IBI.2) for the incubation times indicated. Total RNA was isolated and Northern blot analysis was performed with the full-length murine p21CIP1 probe. Hybridization with a GAPDH probe shows equal RNA loading.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Negative regulation of cell cycle provides an important means of restricting cell proliferation and population size. Although a number of molecular inhibitors of cell cycle progression have been identified, such as the INK4 and CIP/KIP families, the signaling mechanisms by which growth inhibitory signals are transmitted from cytokine receptors are not well understood. In this work, we have investigated the mechanism by which IL-10 inhibits macrophage proliferation. We found that IL-10 specifically induces expression of the cdk inhibitors p19INK4D and p21CIP1 in monocyte/macrophage cells. Using a unique panel of J774-derived cell lines, we show that activation of Stat3 is necessary for optimal induction of p19INK4D but not for p21CIP1, and furthermore that inducible activation of Stat3 is sufficient for induction of p19INK4D. The involvement of Stat3 in the induction of p19INK4D by IL-10 is consistent not only with our studies which implicate Stat3 in mediating the antiproliferative actions of IL-10, but also with the presence of two response elements in the p19INK4D promoter, one of which was shown to be essential for mediating responsiveness to IL-10. Antisense experiments and use of macrophages generated from p19INK4D-deficient mice showed that p19INK4D is required for optimal inhibition of proliferation and also that IL-10 may induce additional target genes to regulate cell cycle progression.

cdk inhibitors act by binding to cyclin-cdk complexes and inhibiting their enzyme activity in a stoichiometric manner (23). Regulation of cdk inhibitor expression is one mechanism by which cytokines exert antiproliferative effects prevent cell cycle progression (24, 25, 26, 28, 29, 41). Our data suggest that IL-10 uses a similar mechanism to block macrophage proliferation. J774 cells express p18INK4C and p19INK4D, but only p19INK4D was up-regulated by IL-10. The kinetics of induction was similar to that described for IFN-{alpha}, which has been shown to induce p19INK4D expression in association with G1 growth arrest in the BAC1.2F5A macrophage (36) and in the ANBL-6 myeloma (27) cell lines. In addition to its role in causing G1 phase arrest, p19INK4D has been implicated in regulation of differentiation (42), although in J774 cells the growth suppressive effect of IL-10 does not appear to be associated with differentiation (6). p19INK4D may have additional roles in actively proliferating cells, since in a synchronized macrophage cell line (BAC1.2F5A) stimulated with M-CSF, p19INK4D mRNA expression peaks at S phase (21). This may account for the marginal increase in p19INK4D expression observed in NBM-derived macrophages stimulated with M-CSF alone (Fig. 2Go).

In the hIL-10R{alpha}-chain, membrane-distal tyrosines 446 and 496 are necessary to transduce an antiproliferative signal (6). We show that cells bearing receptors mutated at these tyrosines were found to be deficient in induction of p19INK4D, thus implicating p19 INK4D in mediating IL-10-induced growth suppression. Stat3 is directly recruited to these tyrosines, and Stat3 activation is essential for the antiproliferative response to IL-10 (6). In cells expressing {Delta}Stat3, the ability of IL-10 to induce p19INK4D expression was significantly reduced. We therefore propose that activation of Stat3 mediated by membrane-distal tyrosines of IL-10R{alpha} is a major pathway responsible for induction of p19INK4D. This observation is consistent with a recent finding that Stat3-dependent growth arrest of the M1 cell line in response to IL-6 is associated with induction of p19INK4D (43). It should be noted that in J774 cells expressing hIL-10R:TyrFF, a weak induction of p19 was observed at later time points (12 h), which may represent an additional pathway of p19INK4D induction mediated by the membrane-distal tyrosines, but not requiring Stat3. Since IL-10 growth inhibitory signals are not transduced by the double tyrosine mutant receptor, this late induction is either not sufficient to repress proliferation or serves an alternate purpose. We have tested the ability of single tyrosine mutations to transmit growth inhibitory signals and found that the presence of one intact tyrosine is sufficient to inhibit growth (A. M. O’Farrell and A. L.-F. Mui, unpublished results). This redundant function of the two tyrosines mirrors their equally interchangeable ability to recruit and activate Stat3.

We have previously shown that activation of Stat3-GyrB chimeras by coumermycin yields STAT oligomers which transactivate STAT-responsive reporter genes and inhibit J774 cell proliferation, mimicking the effect of IL-10. Since coumermycin induced p19INK4D expression in J774:Stat3-GyrB cells, we propose that suppression of proliferation by coumermycin is mediated by p19INK4D and furthermore that Stat3 activation alone is sufficient for p19INK4 induction. It should be noted that p19INK4D expression is slightly stronger and more sustained in response to IL-10 than coumermycin. This correlates with a generally more potent inhibition of proliferation by IL-10 (50–80%) than by coumermycin (40–60%), and there are a number of possible explanations for this trend. It is possible that additional Stat3 signaling events may not be recapitulated by Stat3-GyrB or that optimal inhibition of proliferation may require contributions of additional Stat3-independent signaling pathways (11, 17). The latter possibility is consistent with intact up-regulation of p21CIP1 in J774 cells expressing hIL-10R:TyrFF or {Delta}Stat3, suggesting that an as yet unidentified region of IL-10R which couples to a Stat3-independent pathway mediates this response. However, since dominant-negative Stat3 completely blocks growth arrest (6), it appears that p21CIP1 alone is insufficient to inhibit proliferation.

Sequence and functional analysis of the p19INK4D promoter revealed a candidate Stat3 binding site that was IL-10 responsive. Similarly, a Stat1 binding site in the p21CIP1 promoter is directly regulated by IFN-{gamma} and is essential for inhibition of proliferation (28). Although a number of Stat3 target genes have been identified, including Stat3 itself (44), tissue inhibitor of metalloproteinase-1 (45), JunB (46), and {alpha}2-macroglobulin (38), these have primarily been associated with the action of cytokines which signal via gp130. Database searches revealed that STAT binding sites exist also in the promoters of other cell cycle regulators including p27KIP1 (GenBank accession no. U77915: TTTCCTGAA) and p16INK4A (GenBank accession no. U47018: TTCTCAGAA). Despite the presence of potential Stat3 binding sites, IL-10 does not induce p27KIP1 in J774 cells (A. L-F. Mui, unpublished data).

Two complementary approaches, antisense oligonucleotides and p19INK4D-deficient mice, were used to assess the absolute requirement for p19INK4D to suppress macrophage proliferation. In both cases, data showed that in the absence of p19INK4D the ability of IL-10 to inhibit proliferation was significantly but not completely reduced. This is consistent with our observation that addition of IL-10 further decreased thymidine incorporation in J774 cells that ectopically express p19INK4D. It is likely therefore that IL-10 induces additional cell cycle inhibitors such as p21CIP1, which contribute to growth arrest, analogous to mechanisms proposed for growth arrest elicited by IFN-{alpha} (41) and TGF-ß (25). This hypothesis is consistent with the recent model for G1 phase progression where up-regulated p19INK4D displaces p21CIP1 from cyclin D-cdk4 complexes and inhibits cyclin D-cdk4 activity and p21CIP1 inhibits cyclin A/E-cdk2 activity, leading to a complete cooperative block in cell cycle progression (for review, see Refs. 23, 47, 48). However, there is a discrepancy between J774:{Delta}Stat3 and p19INK4D-deficient mouse data, since {Delta}Stat3 fully blocked growth arrest, but p19INK4D deficiency did not. Since the p21 CIP1 response should be intact in both cases, possible explanations are either that p19INK4D is not the only gene/pathway activated by Stat3 to mediate the observed inhibition of proliferation or that functional redundancy occurs in the INK4 family in p19INK4D-deficient mice.

In summary, we have identified p19INK4D and p21CIP1 as targets of IL-10 signaling which contribute to growth arrest and demonstrated that activation of Stat3 is necessary and sufficient for induction of p19INK4D. It will be interesting to determine whether this mechanism is also used in additional cell types which are growth inhibited by IL-10 and whether p19INK4D and p21CIP1 have functions in other IL-10 responses.


    Acknowledgments
 
We are very grateful to Gordon Peters and Fran Stott of the Imperial Cancer Research Fund for providing us with the murine p19INK4D cDNA. We thank Joseph Watson for technical assistance in cloning the p19INK4D promoter and members of the DNAX sequencing facility for sequencing the p19INK4D promoter. We acknowledge members of the Moore laboratory for useful discussion during this work.


    Footnotes
 
1 This work was supported in part by National Institutes of Health Grant POI-CA-76907 9 (to M.F.R.) and the American Lebanese Syrian Associated Charities of St. Judes Children’s Research Hospital. Back

2 Address correspondence and reprint requests to Dr. Ann Marie O’Farrell at her current address: Systemix, 3155 Porter Drive, Palo Alto, CA 94304. Back

3 Current address, Department of Surgery, University of British Columbia, Jack Bell Research Centre, 2660 Oak Street, Vancouver, British Columbia, Canada V6H 3Z6. Back

4 Abbreviations used in this paper: GyrB, Gyrase B; h, human; m, murine; cdk, cyclin-dependent kinase; NBM, normal bone marrow; WT, wild type; M-CSF, macrophage CSF; IP, immunoprecipitation. Back

Received for publication September 16, 1999. Accepted for publication February 24, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Borish, L.. 1998. IL-10: evolving concepts. J. Allergy Clin. Immunol. 101:293.[Medline]
  2. de Waal Malefyt, R., and K. W. Moore. 1998. Interleukin-10. In The Cytokine Handbook, 3rd Ed. Academic Press, New York, p. 332.
  3. de Waal Malefyt, R., J. Abrams, B. Bennett, C. G. Figdor, J. E. de Vries. 1991. Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J. Exp. Med. 174:1209.[Abstract/Free Full Text]
  4. Koppelman, B., J. J. Neefjes, J. E. de Vries, R. de Waal Malefyt. 1997. Interleukin-10 down-regulates MHC class II {alpha}ß peptide complexes at the plasma membrane of monocytes by affecting arrival and recycling. Immunity 7:861.[Medline]
  5. Song, S., H. Ling-Hu, K. A. Roebuck, M. F. Rabbi, R. P. Donnelly, A. Finnegan. 1997. Interleukin-10 inhibits interferon-{gamma}-induced intercellular adhesion molecule-1 gene transcription in human monocytes. Blood 89:4461.[Abstract/Free Full Text]
  6. O’Farrell, A. M., Y. Liu, K. W. Moore, A. L. Mui. 1998. IL-10 inhibits macrophage activation and proliferation by distinct signaling mechanisms: evidence for Stat3-dependent and -independent pathways. EMBO J. 17:1006.[Medline]
  7. Ho, A. S., Y. Liu, T. A. Khan, D. H. Hsu, J. F. Bazan, K. W. Moore. 1993. A receptor for interleukin 10 is related to interferon receptors. Proc. Natl. Acad. Sci. USA 90:11267.[Abstract/Free Full Text]
  8. Liu, Y., S. H. Wei, A. S. Ho, R. de Waal Malefyt, K. W. Moore. 1994. Expression cloning and characterization of a human IL-10 receptor. J. Immunol. 152:1821.[Abstract]
  9. Kotenko, S. V., C. D. Krause, L. S. Izotova, B. P. Pollack, W. Wu, S. Pestka. 1997. Identification and functional characterization of a second chain of the interleukin-10 receptor complex. EMBO J. 16:5894.[Medline]
  10. Spencer, S. D., F. Di Marco, J. Hooley, S. Pitts-Meek, M. Bauer, A. M. Ryan, B. Sordat, V. C. Gibbs, M. Aguet. 1998. The orphan receptor CRF2–4 is an essential subunit of the interleukin 10 receptor. J. Exp. Med. 187:571.[Abstract/Free Full Text]
  11. Ho, A. S., S. H. Wei, A. L. Mui, A. Miyajima, K. W. Moore. 1995. Functional regions of the mouse interleukin-10 receptor cytoplasmic domain. Mol. Cell. Biol. 15:5043.[Abstract]
  12. Weber-Nordt, R. M., J. K. Riley, A. C. Greenlund, K. W. Moore, J. E. Darnell, R. D. Schreiber. 1996. Stat3 recruitment by two distinct ligand-induced, tyrosine-phosphorylated docking sites in the interleukin-10 receptor intracellular domain. J. Biol. Chem. 271:27954.[Abstract/Free Full Text]
  13. Finbloom, D. S., K. D. Winestock. 1995. IL-10 induces the tyrosine phosphorylation of tyk2 and Jak1 and the differential assembly of STAT1{alpha} and STAT3 complexes in human T cells and monocytes. J. Immunol. 155:1079.[Abstract]
  14. Lai, C. F., J. Ripperger, K. K. Morella, J. Jurlander, T. S. Hawley, W. E. Carson, T. Kordula, M. A. Caligiuri, R. G. Hawley, G. H. Fey, H. Baumann. 1996. Receptors for interleukin (IL)-10 and IL-6-type cytokines use similar signaling mechanisms for inducing transcription through IL-6 response elements. J. Biol. Chem. 271:13968.[Abstract/Free Full Text]
  15. Wehinger, J., F. Gouilleux, B. Groner, J. Finke, R. Mertelsmann, R. M. Weber-Nordt. 1996. IL-10 induces DNA binding activity of three STAT proteins (Stat1, Stat3, and Stat5) and their distinct combinatorial assembly in the promoters of selected genes. FEBS Lett. 394:365.[Medline]
  16. Takeda, K., B. E. Clausen, T. Kaisho, T. Tsujimura, N. Terada, I. Forster, S. Akira. 1999. Enhanced Th1 activity and development of chronic enterocolitis in mice devoid of Stat3 in macrophages and neutrophils. Immunity 10:39.[Medline]
  17. Riley, J. K., K. Takeda, S. Akira, R. D. Schreiber. 1999. Interleukin-10 receptor signaling through the JAK-STAT pathway: requirement for two distinct receptor-derived signals for anti- inflammatory action. J. Biol. Chem. 274:16513.[Abstract/Free Full Text]
  18. Chellappan, S. P., A. Giordano, P. B. Fisher. 1998. Role of cyclin-dependent kinases and their inhibitors in cellular differentiation and development. Curr. Top. Microbiol. Immunol. 227:57.[Medline]
  19. Serrano, M., G. J. Hannon, D. Beach. 1993. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature 366:704.[Medline]
  20. Guan, K. L., C. W. Jenkins, Y. Li, M. A. Nichols, X. Wu, C. L. O’Keefe, A. G. Matera, Y. Xiong. 1994. Growth suppression by p18, a p16INK4/MTS1- and p14INK4B/MTS2-related CDK6 inhibitor, correlates with wild-type pRb function. Genes Dev. 8:2939.[Abstract/Free Full Text]
  21. Hirai, H., M. F. Roussel, J. Y. Kato, R. A. Ashmun, C. J. Sherr. 1995. Novel INK4 proteins, p19 and p18, are specific inhibitors of the cyclin D-dependent kinases CDK4 and CDK6. Mol. Cell. Biol. 15:2672.[Abstract]
  22. Brotherton, D. H., V. Dhanaraj, S. Wick, L. Brizuela, P. J. Domaille, E. Volyanik, X. Xu, E. Parisini, B. O. Smith, S. J. Archer, et al 1998. Crystal structure of the complex of the cyclin D-dependent kinase Cdk6 bound to the cell-cycle inhibitor p19INK4D. Nature 395:244.[Medline]
  23. Sherr, C. J., J. M. Roberts. 1999. CDK inhibitors: positive and negative regulators of G1 phase progression. Genes Dev. 13:1501.[Free Full Text]
  24. Hannon, G. J., D. Beach. 1994. p15INK4B is a potential effector of TGF-ß-induced cell cycle arrest. Nature 371:257.[Medline]
  25. Reynisdottir, I., K. Polyak, A. Iavarone, J. Massague. 1995. Kip/Cip and Ink4 Cdk inhibitors cooperate to induce cell cycle arrest in response to TGF-ß. Genes Dev. 9:1831.[Abstract/Free Full Text]
  26. Sangfelt, O., S. Erickson, S. Einhorn, D. Grander. 1997. Induction of Cip/Kip and Ink4 cyclin dependent kinase inhibitors by interferon-{alpha} in hematopoietic cell lines. Oncogene 14:415.[Medline]
  27. Arora, T., D. F. Jelinek. 1998. Differential myeloma cell responsiveness to interferon-alpha correlates with differential induction of p19 (INK4D) and cyclin D2 expression. J. Biol. Chem. 273:11799.[Abstract/Free Full Text]
  28. Chin, Y. E., M. Kitagawa, W. C. Su, Z. H. You, Y. Iwamoto, X. Y. Fu. 1996. Cell growth arrest and induction of cyclin-dependent kinase inhibitor p21 WAF1/CIP1 mediated by STAT1. Science 272:719.[Abstract]
  29. Morse, L., D. Chen, D. Franklin, Y. Xiong, S. Chen-Kiang. 1997. Induction of cell cycle arrest and B cell terminal differentiation by CDK inhibitor p18(INK4c) and IL-6. Immunity 6:47.[Medline]
  30. Taga, K., G. Tosato. 1992. IL-10 inhibits human T cell proliferation and IL-2 production. J. Immunol. 148:1143.[Abstract]
  31. de Waal Malefyt, R., H. Yssel, J. E. de Vries. 1993. Direct effects of IL-10 on subsets of human CD4+ T cell clones and resting T cells: specific inhibition of IL-2 production and proliferation. J. Immunol. 150:4754.[Abstract]
  32. Bruserud, O., B. Tore Gjertsen, O. Terje Brustugun, C. F. Bassoe, I. Nesthus, P. Espen Akselsen, H. J. Buhring, G. Pawelec. 1995. Effects of interleukin 10 on blast cells derived from patients with acute myelogenous leukemia. Leukemia 9:1910.[Medline]
  33. Geissler, K., L. Ohler, M. Fodinger, I. Virgolini, M. Leimer, E. Kabrna, M. Kollars, S. Skoupy, B. Bohle, M. Rogy, K. Lechner. 1996. Interleukin 10 inhibits growth and granulocyte/macrophage colony- stimulating factor production in chronic myelomonocytic leukemia cells. J. Exp. Med. 184:1377.[Abstract/Free Full Text]
  34. Oehler, L., M. Foedinger, M. Koeller, M. Kollars, E. Reiter, B. Bohle, S. Skoupy, G. Fritsch, K. Lechner, K. Geissler. 1997. Interleukin-10 inhibits spontaneous colony-forming unit-granulocyte-macrophage growth from human peripheral blood mononuclear cells by suppression of endogenous granulocyte-macrophage colony-stimulating factor release. Blood 89:1147.[Abstract/Free Full Text]
  35. Schibler, K. R., Y. Li, R. K. Ohls, N. C. Nye, M. C. Durham, W. White, K. W. Liechty, T. Le, R. D. Christensen. 1994. Possible mechanisms accounting for the growth factor independence of hematopoietic progenitors from umbilical cord blood. Blood 84:3679.[Abstract/Free Full Text]
  36. Zindy, F., J. J. Cunningham, C. J. Sherr, S. Jogal, R. J. Smeyne, M. F. Roussel. 1999. Postnatal neuronal proliferation in mice lacking ink4d and kip1 inhibitors of cyclin-dependent kinases. Proc. Natl. Acad. Sci. USA 963:13462.
  37. O’Farrell, A. M., M. Ichihara, A. L. Mui, A. Miyajima. 1996. Signaling pathways activated in a unique mast cell line where interleukin-3 supports survival and stem cell factor is required for a proliferative response. Blood 87:3655.[Abstract/Free Full Text]
  38. Zhang, Z., G. M. Fuller. 1997. The competitive binding of STAT3 and NF-{kappa}B on an overlapping DNA binding site. Biochem. Biophys. Res. Commun. 237:90.[Medline]
  39. Ali, J. A., A. P. Jackson, A. J. Howells, A. Maxwell. 1993. The 43-kilodalton N-terminal fragment of the DNA gyrase B protein hydrolyzes ATP and binds coumarin drugs. Biochemistry 32:2717.[Medline]
  40. Farrar, M. A., Alberol-Ila, and R. M. Perlmutter. 1996. Activation of the Raf-1 kinase cascade by coumermycin-induced dimerization. Nature 383:178.
  41. Matsuoka, M., K. Tani, S. Asano. 1998. Interferon-{alpha}-induced G1 phase arrest through up-regulated expression of CDK inhibitors, p19INK4D and p21Cip1 in mouse macrophages. Oncogene 16:2075.[Medline]
  42. Adachi, M., M. F. Roussel, K. Havenith, C. J. Sherr. 1997. Features of macrophage differentiation induced by p19INK4D, a specific inhibitor of cyclin D-dependent kinases. Blood 90:126.[Abstract/Free Full Text]
  43. Narimatsu, M., K. Nakajima, M. Ichiba, T. Hirano. 1997. Association of Stat3-dependent transcriptional activation of p19INK4D with IL-6-induced growth arrest. Biochem. Biophys. Res. Commun. 238:764.[Medline]
  44. Ichiba, M., K. Nakajima, Y. Yamanaka, N. Kiuchi, T. Hirano. 1998. Autoregulation of the Stat3 gene through cooperation with a cAMP- responsive element-binding protein. J. Biol. Chem. 273:6132.[Abstract/Free Full Text]
  45. Richards, C. D., C. Kerr, M. Tanaka, T. Hara, A. Miyajima, D. Pennica, F. Botelho, C. M. Langdon. 1997. Regulation of tissue inhibitor of metalloproteinase-1 in fibroblasts and acute phase proteins in hepatocytes in vitro by mouse oncostatin M, cardiotrophin-1, and IL-6. J. Immunol. 159:2431.[Abstract/Free Full Text]
  46. Kojima, H., K. Nakajima, T. Hirano. 1996. IL-6-inducible complexes on an IL-6 response element of the junB promoter contain Stat3 and 36 kDa CRE-like site binding protein(s). Oncogene 12:547.[Medline]
  47. Parry, D. A., D. Mahony, K. Wills, E. Lees. 1999. Cyclin D-CDK subunit arrangement is dependent on the availability of competing INK4 and p21 class inhibitors. Mol. Cell. Biol. 19:1775.[Abstract/Free Full Text]
  48. McConnell, B.B., F.J. Gregory, F.J. Stott, E. Hara, G. Peters. 1999. Induced expression of p16INK4a inhibits both CDK4- and CDK2-associated kinase activity by reassortment of cyclin-CDK-inhibitor complexes. Mol. Cell. Biol. 19:1981.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
BloodHome page
L. Gilles, R. Guieze, D. Bluteau, V. Cordette-Lagarde, C. Lacout, R. Favier, F. Larbret, N. Debili, W. Vainchenker, and H. Raslova
P19INK4D links endomitotic arrest and megakaryocyte maturation and is regulated by AML-1
Blood, April 15, 2008; 111(8): 4081 - 4091.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
L. Wise, C. McCaughan, C. K. Tan, A. A. Mercer, and S. B. Fleming
Orf virus interleukin-10 inhibits cytokine synthesis in activated human THP-1 monocytes, but only partially impairs their proliferation
J. Gen. Virol., June 1, 2007; 88(6): 1677 - 1682.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
S. H. Peterson, D. T. Nardelli, T. F. Warner, S. M. Callister, J. R. Torrealba, and R. F. Schell
Anti-p19 Antibody Treatment Exacerbates Lyme Arthritis and Enhances Borreliacidal Activity
Clin. Vaccine Immunol., May 1, 2007; 14(5): 510 - 517.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
A. Jewett, C. Head, and N.A. Cacalano
Emerging Mechanisms of Immunosuppression in Oral Cancers
Journal of Dental Research, December 1, 2006; 85(12): 1061 - 1073.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. P. Bailey, M. Kashyap, L. A. Bouton, P. J. Murray, and J. J. Ryan
Interleukin-10 induces apoptosis in developing mast cells and macrophages
J. Leukoc. Biol., September 1, 2006; 80(3): 581 - 589.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Qasimi, A. Ming-Lum, A. Ghanipour, C. J. Ong, M. E. Cox, J. Ihle, N. Cacalano, A. Yoshimura, and A. L-F. Mui
Divergent Mechanisms Utilized by SOCS3 to Mediate Interleukin-10 Inhibition of Tumor Necrosis Factor {alpha} and Nitric Oxide Production by Macrophages
J. Biol. Chem., March 10, 2006; 281(10): 6316 - 6324.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. A. R. Rahimi, K. Gee, S. Mishra, W. Lim, and A. Kumar
STAT-1 Mediates the Stimulatory Effect of IL-10 on CD14 Expression in Human Monocytic Cells
J. Immunol., June 15, 2005; 174(12): 7823 - 7832.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Chen, M. H. Kapturczak, C. Wasserfall, O. Y. Glushakova, M. Campbell-Thompson, J. S. Deshane, R. Joseph, P. E. Cruz, W. W. Hauswirth, K. M. Madsen, et al.
Interleukin 10 attenuates neointimal proliferation and inflammation in aortic allografts by a heme oxygenase-dependent pathway
PNAS, May 17, 2005; 102(20): 7251 - 7256.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. A. Ricchetti, L. M. Williams, and B. M. J. Foxwell
Heme oxygenase 1 expression induced by IL-10 requires STAT-3 and phosphoinositol-3 kinase and is inhibited by lipopolysaccharide
J. Leukoc. Biol., September 1, 2004; 76(3): 719 - 726.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Kuwata, Y. Watanabe, H. Miyoshi, M. Yamamoto, T. Kaisho, K. Takeda, and S. Akira
IL-10-inducible Bcl-3 negatively regulates LPS-induced TNF-{alpha} production in macrophages
Blood, December 1, 2003; 102(12): 4123 - 4129.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Gee, M. Kozlowski, and A. Kumar
Tumor Necrosis Factor-{alpha} Induces Functionally Active Hyaluronan-adhesive CD44 by Activating Sialidase through p38 Mitogen-activated Protein Kinase in Lipopolysaccharide-stimulated Human Monocytic Cells
J. Biol. Chem., September 26, 2003; 278(39): 37275 - 37287.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
M. P. Fischbein, J. Yun, H. Laks, Y. Irie, L. Oslund-Pinderski, M. C. Fishbein, B. Bonavida, and A. Ardehali
Regulated interleukin-10 expression prevents chronic rejection of transplanted hearts
J. Thorac. Cardiovasc. Surg., July 1, 2003; 126(1): 216 - 223.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Gee, W. Lim, W. Ma, D. Nandan, F. Diaz-Mitoma, M. Kozlowski, and A. Kumar
Differential Regulation of CD44 Expression by Lipopolysaccharide (LPS) and TNF-{alpha} in Human Monocytic Cells: Distinct Involvement of c-Jun N-Terminal Kinase in LPS-Induced CD44 Expression
J. Immunol., November 15, 2002; 169(10): 5660 - 5672.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Torbenson, S. Q. Yang, H. Z. Liu, J. Huang, W. Gage, and A. M. Diehl
STAT-3 Overexpression and p21 Up-Regulation Accompany Impaired Regeneration of Fatty Livers
Am. J. Pathol., July 1, 2002; 161(1): 155 - 161.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. Lim, W. Ma, K. Gee, S. Aucoin, D. Nandan, F. Diaz-Mitoma, M. Kozlowski, and A. Kumar
Distinct Role of p38 and c-Jun N-Terminal Kinases in IL-10-Dependent and IL-10-Independent Regulation of the Costimulatory Molecule B7.2 in Lipopolysaccharide-Stimulated Human Monocytic Cells
J. Immunol., February 15, 2002; 168(4): 1759 - 1769.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Aznar, P. F. Valeron, S. V. del Rincon, L. F. Perez, R. Perona, and J. C. Lacal
Simultaneous Tyrosine and Serine Phosphorylation of STAT3 Transcription Factor Is Involved in Rho A GTPase Oncogenic Transformation
Mol. Biol. Cell, October 1, 2001; 12(10): 3282 - 3294.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
J.-B. Demoulin, J. Van Snick, and J.-C. Renauld
Interleukin-9 (IL-9) Induces Cell Growth Arrest Associated with Sustained Signal Transducer and Activator of Transcription Activation in Lymphoma Cells Overexpressing the IL-9 Receptor
Cell Growth Differ., March 1, 2001; 12(3): 169 - 174.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
T. Senga, T. Iwamoto, T. Kitamura, Y. Miyake, and M. Hamaguchi
JAK/STAT3-dependent Activation of the RalGDS/Ral Pathway in M1 Mouse Myeloid Leukemia Cells
J. Biol. Chem., August 24, 2001; 276(35): 32678 - 32681.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Farrell, A.-M.
Right arrow Articles by Mui, A. L.-F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Farrell, A.-M.
Right arrow Articles by Mui, A. L.-F.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*L-TYROSINE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS