|
|
||||||||




Departments of
*
Molecular Biology and
Cell Signaling, DNAX Research Institute, Palo Alto, CA 94304; and
Department of Tumor Cell Biology, St. Jude Childrens Research Hospital, Memphis, TN 38105
| Abstract |
|---|
|
|
|---|
which does not recruit Stat3 in J774 cells, whereas
p21CIP1 induction is not affected. An inducibly active
Stat3 (coumermycin-dimerizable Stat3-Gyrase B), which suppresses J774
cell proliferation, also induced p19INK4D expression.
Sequencing of the murine p19INK4D promoter revealed two
candidate Stat3 binding sites, and IL-10 treatment activated a reporter
gene controlled by this promoter. These data suggest that
Stat3-dependent induction of p19INK4D mediates inhibition
of proliferation. Enforced expression of murine p19INK4D
cDNA J774 cells significantly reduced their proliferation. Use of
antisense p19INK4D and analysis of
p19INK4D-deficient macrophages confirmed that
p19INK4D is required for optimal inhibition of
proliferation by IL-10, and indicated that additional IL-10 signaling
events contribute to this response. These data indicate that
Stat3-dependent induction of p19INK4D and Stat3-independent
induction of p21CIP1 are important components of the
mechanism by which IL-10 blocks proliferation in
macrophages. | Introduction |
|---|
|
|
|---|
Two components of the IL-10R complex have been identified, IL-10R
(7, 8) and CRF24 (9, 10), both members of
the class II family of cytokine receptors. The primary ligand binding
component, IL-10R
, binds IL-10 with high affinity and in the
presence of IL-10 associates with the accessory subunit CRF24
(9). Both chains are required for signal transduction
(9, 10), and like other members of the class II receptor
family, such as IFN receptors, the two subunits interact with members
of the Jak tyrosine kinase family; IL-10R
and CRF24 bind Jak1 and
Tyk2, respectively (9, 11), in a ligand-independent
manner. IL-10-induced heterodimerization leads to activation of the Jak
kinases and phosphorylation of IL-10R
on cytoplasmic tyrosines
(Tyr446 and Tyr496 in
hIL-10R
) (12). These residues form docking sites for
members of the STAT family of transcription factors. Stat3 is directly
recruited to IL-10R
and becomes phosphorylated by
receptor-associated Jak kinases. Stat1 is also activated by IL-10 in
macrophages (13, 14, 15), but the mechanism of its recruitment
to the IL-10R complex is unclear. Upon phosphorylation, Stat1 and Stat3
homo/hetero dimerize and translocate to the nucleus where they bind to
specific promoter sequences and stimulate transcription of target
genes.
We previously used tyrosine mutant forms of IL-10R
and modified
Stat3 molecules to investigate the role of Stat3 in macrophage
responses to IL-10. We found that the membrane distal tyrosines 446 and
496 of IL-10R
are required for inhibition of macrophage
proliferation by IL-10. A dominant-negative Stat3 construct blocked the
anti-proliferative effect of IL-10 (6). Furthermore,
an inducibly active form of Stat3, STAT-Gyrase B
(GyrB),4 a fusion of
Stat3 and the dimerization domain of GyrB which is dimerizable by
coumermycin, mimicked the ability of IL-10 to suppress proliferation
(6). These studies implicated Stat3 and presumably
Stat3-regulated gene(s) in inhibition of the macrophage cell cycle by
IL-10. Subsequent studies in macrophages deficient in Stat3 confirmed
the importance of the Stat3 pathway in the antiproliferative action of
IL-10 (16). Use of Stat3-deficient macrophages implicated
Stat3 in macrophage deactivation, although expression of a
dominant-negative Stat3 in the J774 monocyte/macrophage cell line does
not block these responses, suggesting that the residual Stat3 activity
present is sufficient to mediate the anti-inflammatory activities
of IL-10 (6). Recently, it has been shown that the
anti-inflammatory functions of IL-10 also require a second signal
mediated from a distinct region of the IL-10R C-terminal to the two
tyrosines responsible for Stat3 activation (17).
Cell cycle progression through the first gap phase
(G1) of the cell cycle into the DNA synthesis (S)
phase requires the concerted action of G1 cyclins
D and E and their catalytic partners cyclin-dependent kinases (cdks)
(for review, see Ref. 18). Stimulation with mitogens
induces expression of the D-type cyclins, which specifically associate
with cdks 4 and 6. Phosphorylation of Retinoblastoma protein releases
the E2F transcription factor, facilitating transcription of genes
required for S phase (19). The activity of the cyclin
D-cdk complex is however also subject to negative regulation by two
families of cell cycle inhibitors, the INK4 family and the CIP/KIP
family. The INK4 family, which includes p15INK4B,
p16INK4A, p18INK4C, and
p19INK4D, specifically binds to and inhibits only
cdks 4 and 6 (20, 21, 22), thereby inhibiting D-type cyclin
activity and preventing entry into S phase. Overexpression of members
of the INK4 family is sufficient to block cell proliferation
(21). The CIP/KIP family of cell cycle inhibitors, which
includes p21CIP1 and
p27KIP1 and p57KIP2, enter
complexes with both cyclins A or E and cyclin D and have been shown to
inhibit cyclins A- or E-associated cdk2 activity, but stabilize cyclin
D-associated cdk4/6 activity (for review, see Ref. 23).
The antiproliferative action of cytokines has been associated with
increased expression of cell cycle inhibitors. For example, the
antimitogenic effects of TGF-ß, IFN-
, IFN-
, and IL-6 have been
associated with induction of p15INK4B and
p21CIP1 (24, 25),
p15INK4B and p19INK4D
(26, 27), p21CIP1 (28),
and p18INK4C (29), respectively.
In addition to macrophages, IL-10 inhibits proliferation of other cell types including T cells (30, 31) and normal and leukemic myeloid progenitor cells (32, 33, 34, 35). Although in some instances inhibition of autocrine growth factor production by IL-10 has been shown to contribute to its growth-suppressing activity, no evidence of an IL-10-regulated autocrine growth loop was found for J774 cells (6). We examined the ability of IL-10 to regulate expression of cell cycle inhibitors in macrophage cell types and found that IL-10 treatment specifically induced p19INK4D expression. Using J774 cell lines expressing either mutant IL-10R, dominant-negative Stat3, or inducibly active Stat3, we provide evidence that activation of Stat3 is required and sufficient to induce p19INK4D expression through specific promoter elements.
| Materials and Methods |
|---|
|
|
|---|
All reagents were obtained from Sigma (St. Louis, MO), unless otherwise described. Recombinant human (h) and murine (m) IL-10 were obtained as described previously (7) and macrophage CSF (M-CSF) was obtained from R&D Systems (Minneapolis, MN).
Antibodies
A rat anti-mIL-10R-blocking mAb (1B1.2, IgG1) has been described previously (6). For Abs raised against murine p18INK4C and murine p19INK4D, peptides corresponding to the C-terminal regions (CSLMEANGVGGATSLQ and CQNLMDILQGHMMIPM, respectively) were synthesized (Research Genetics, Huntsville, AL), coupled to keyhole limpet hemocyanin (Pierce, Rockford, IL), and injected into rabbits (Pocono Rabbit Farm, Canadensis, PA). Peptide antisera were affinity purified against cognate immunogen (Sulfolink; Pierce) and dialyzed against PBS/1 mM DTT plus 20% glycerol. Ab specificity was confirmed using specific in vitro translated products, immunoprecipitation, and V8 proteolytic analysis.
Cell culture and proliferation assays
J774 cells (American Type Culture Collection, Manassas, VA) were cultured in DMEM supplemented with 10% (v/v) FBS on tissue culture grade plates and passaged twice weekly. Mouse strains (C57BL/6 x 129Svj) deficient in p19INK4D were recently described (36). Macrophages were derived from murine normal bone marrow (NBM) by in vitro differentiation as described previously (6). All stimulations of J774 cells/NBM-derived macrophages were at 37°C. [3H]Thymidine incorporation by J774 cells or NBM-derived macrophages cultured on 96-well plates was measured as described previously (6). For all experiments, all cell populations were seeded at equal densities, and each condition was assayed in triplicate in multiple experiments.
Expression constructs
J774 cells expressing
Stat1,
Stat3, Stat3-GyrB, hIL-10R,
and hIL-10R:TyrFF have been described previously
(6). For all experiments with J774 cells expressing
hIL-10R and hIL-10R:TyrFF, cells were treated
with hIL-10 (100 ng/ml) in the presence of neutralizing Ab against
mIL-10R
(1B1.2) which prevents signaling through endogenous
mIL-10
. For parental J774, J774:
Stat3 cells, and J774:Stat3-GyrB,
mIL-10 was used at 100 ng/ml. For J774:Stat3-GyrB, dimerization of
STAT-GyrB was induced by addition of coumermycin A1 at concentrations
of 0.1100 µM. J774 cells expressing p19INK4D
were generated by retroviral transduction as described elsewhere
(6), with pMXpuro containing full-length murine
p19INK4D, and selected in puromycin (5 µg/ml).
Multiple independently derived clones were analyzed in all
experiments.
Transient transfection assays
J774 cells were transfected by the LipofectAMINE method, as
suggested by the manufacturer (Promega, Madison, WI). Briefly, cells
were incubated in a DNA:LipofectAMINE mixture at 37°C in serum-free
Opti-MEM (Life Technologies, Rockville, MD) for 4 h. An equal
volume of RPMI 1640 containing 20% FBS was added, and, after a
recovery period of 612 h, IL-10 or coumermycin was added for an
additional 24 h, as indicated. Cytoplasmic extracts were prepared
in reporter lysis buffer and assayed in triplicate for luciferase
activity (Promega). As a control for transfection, efficiency cells
were cotransfected with pMEß-Gal (1 µg) and assayed for
ß-galactosidase activity (Tropix, Bedford, MA). Sense and antisense
25-mer phosphorothioate oligonucleotides spanning the translation start
site of murine p19INK4D were obtained from
Research Genetics and introduced into J774 cells by LipofectAMINE
transfection. Antisense oligonucleotides decreased p19
INK4D protein expression by
50%, whereas
sense oligonucleotides had no effect.
Immunoprecipitation and Western blot analysis
Cells were washed twice with cold PBS and lysed at 4°C with 0.5% (v/v) Triton X-100 (Pierce) in lysis buffer (50 mM HEPES, 100 mM NaF, 10 mM NaPPi, 2 mM Na3V04, 4 mM EDTA, 2 mM pefabloc, 10 µg/ml aprotinin, and 2 µg/ml leupeptin; Boehringer Mannheim, Indianapolis, IN) for 40 min. Cell lysates were collected after centrifugation at 15,000 rpm for 15 min and stored at -70°C. Protein concentration was determined by the bicinchoninic acid protocol (Pierce), and 100 µg of each lysate was used for immunoprecipitation, performed as described elsewhere (37). Briefly, lysates were incubated with saturating concentrations of primary Ab (12.5 µg/ml) at 4°C for 46 h, and protein A beads (Santa Cruz Biotechnology, Santa Cruz, CA) were added for an additional 2 h. Beads were washed four times with lysis buffer containing 0.1% Nonidet P-40 and incubated for 10 min at room temperature in SDS sample buffer before loading on polyacrylamide-SDS gels. Protein transfer and Western blotting were performed as described previously(6), followed by detection using enhanced chemiluminescence. All experiments were performed at least three times and showed similar results.
RNA blot analysis
Cells were stimulated at 37°C for the time periods indicated, washed with PBS and collected by centrifugation. Total RNA was prepared by the RNeasy protocol (Qiagen, Valencia, CA), as instructed in kit protocol, and separated on 1.2% agarose-formaldehyde gels. RNA was transferred to nylon membranes and hybridized with 32P-labeled cDNA fragments, as described elsewhere (37). RNA concentration was estimated by OD determination, and equal gel loading and transfer to membranes was confirmed either by ethidium bromide staining or by hybridization of membranes with GAPDH cDNA (Clontech Laboratories, Palo Alto, CA).
Cloning and sequence analysis of the murine p19INK4D promoter
A bacteriophage library was prepared by ligation of EcoRI-digested EMBL3 phage arms with high m.w. DNA from embryonic cells (38) partially digested with MboI. A total of 1 x 106 phages was screened with a random primed 32P-labeled full-length murine p19INK4D cDNA probe. Positive plaques were isolated and genomic DNA inserts were characterized. The phage containing the genomic DNA encoding the first coding exon and 5 kb of the 5' flanking region was purified, and the genomic insert was subcloned into the pBluescript plasmid and sequenced by the Taq dideoxy method using an ABI 310 automated sequencer. The mutant p19INK4D promoter was constructed using a Stratagene (La Jolla, CA) Qwikchange mutagenesis kit and sense and antisense primers for the following sequence: GCTGATTGGCTGTTATCACCACCAGGCGGGACTAATGGAG, where the underlined letters denote bases in potential STAT binding sites mutated from TC to CA and G to C. The construct was confirmed by DNA sequencing.
| Results |
|---|
|
|
|---|
We have recently shown that IL-10 inhibits proliferation of J774 cells (6), arresting cells in the G1 phase of the cell cycle. To further explore the mechanism of action of IL-10, we examined expression of the INK4 family which blocks progression through the G1 phase by inhibiting cdk4 and cdk6.
Addition of recombinant mIL-10 strongly induced
p19INK4D mRNA in J774 cells (Fig. 1
a). Addition of cycloheximide
did not inhibit this induction, suggesting that protein synthesis is
not required for this effect of IL-10. Immunoprecipitation (IP)
experiments using Abs generated against p19INK4D
confirmed that p19INK4D protein levels were
increased at 3 and 10 h following the addition of IL-10 (Fig. 1
b). We observed that J774 cells also express a second
member of the INK4 family, p18INK4D, but its
expression was not altered by IL-10 (Fig. 1
c).
p16INK4A was not detectably expressed in J774
cells, and p15INK4B was expressed but not
up-regulated in response to IL-10 (D. A. Parry and A. M.
OFarrell, unpublished results). p19INK4D
appears to be the only member of the INK4 family to be induced by IL-10
in the J774 cell type. As expected, increased p19INK4D
expression in IL-10-treated cells was accompanied by increased amounts
of cdk4 and cdk6 recovered in p19INK4D immunoprecipitates
(data not shown).
|
|

Growth arrest by IL-10 is Stat3-dependent and requires two
membrane-distal tyrosines of the IL-10R
. We have previously
described two modified J774 cell lines which are not growth inhibited
by IL-10 (6). The first expresses a mutant hIL-10R
where the two membrane-distal tyrosines 446 and 496, which recruit
Stat3, were mutated to phenylalanine
(hIL-10R:TyrFF). In this mutant, Stat3 can no
longer bind and become activated (12). In contrast, in
J774 cells expressing the wild-type (WT) hIL-10R
, treatment with
hIL-10 results in growth inhibition, as seen in parental cells
(6). The second expresses a carboxyl-truncated
dominant-negative form of Stat3 (
Stat3). We investigated the ability
of IL-10 to induce p19INK4D in these cell lines.
In hIL-10R
cells, hIL-10 increased p19INK4D
mRNA expression (Fig. 3
a,
hIL10R:WT) to a level comparable to mIL-10 acting through the
endogenous mIL-10R
(Fig. 3
a, parental). In cells
expressing the hIL-10R:TyrFF, IL-10 can no longer
induce p19INK4D (Fig. 3
a,
hIL-10R:TyrFF). Consistent with recruitment of
Stat3 to Tyr446 and Tyr496,
IL-10 did not significantly induce p19INK4D in
J774 cells transduced with
Stat3 (Fig. 3
a,
Stat3). We
consistently observe that the basal level of
p19INK4D mRNA is lower in cells expressing
hIL-10R than in parental cells. This is not due to clonal variation
among cell lines because the hIL-10R:WT (and
hIL-10R:TyrFF) cells used in these experiments
are bulk populations isolated by flow cytometry based on hIL-10R
expression. Rather, the difference may to be due to the presence of a
neutralizing anti-mIL-10R
used in these experiments to block
hIL-10 binding to endogenous mIL-10R
. The mechanism of this effect
of the anti-mIL-10R Ab is not clear, and the possibility that it is
blocking the action of an endogenously produced cytokine that signals
through the mIL-10R is being investigated. IL-10 also activates Stat1
in J774 cells (A. M. OFarrell, unpublished results). However,
Stat1 is not directly recruited to IL-10R
and does not appear to
mediate inhibition of proliferation by IL-10 (6).
Accordingly, a dominant-negative Stat1 did not disrupt
p19INK4D induction by IL-10 (Fig. 3
a,
Stat1).
|
Stat3
blocked the ability of IL-10 to up-regulate
p19INK4D. These data implicate
p19INK4D as a target of Stat3-dependent signaling
which is mediated via Tyr446 and
Tyr496 of IL-10R
. Inducible activation of Stat3-GyrB increases p19INK4D expression
To address whether Stat3 activation is sufficient to induce
p19INK4D expression, we used Stat3-GyrB, an
inducibly active form of Stat3 in which a full-length Stat3 is fused to
the N-terminal, coumermycin-binding domain of bacterial GyrB. Addition
of the small molecule drug coumermycin to cells expressing the fusion
protein results in dimerization (39, 40), a process that
can mimic activation of native Stats. J774 cells expressing Stat3-GyrB
are growth inhibited by coumermycin by up to 40% in the absence of
IL-10 (6), implying that activation of Stat3 is sufficient
for inhibition of J774 proliferation. J774:Stat3-GyrB cells were
treated with either coumermycin or IL-10, and
p19INK4D levels were measured. Addition of
coumermycin induced p19INK4D expression within
1 h and a further increase was apparent at 6 h, with a
magnitude similar to that of IL-10 (Fig. 4
). It should be noted that the levels of
p19INK4D induced by IL-10 were more sustained
than those induced by coumermycin (Fig. 4
). These data show that
activation of Stat3-GyrB by coumermycin is sufficient to induce
p19INK4D expression.
|
To address whether increased p19INK4D
expression is sufficient to arrest growth, full-length
p19INK4D was constitutively expressed in J774
cells by retroviral transduction. The cloning efficiency of J774 cells
transduced with p19INK4D was at least 10-fold
lower than that for the vector only control (data not shown), since a
high level of constitutive p19INK4D expression
blocks cells in G1 (21). However,
sufficient numbers of clones for analysis did survive puromycin
selection, and the levels of p19INK4D mRNA
expressed in two independent clones of
J774:p19INK4D cells and parental cells are shown
in Fig. 5
a. Endogenous and
retrovirally expressed p19INK4D messages can
clearly be distinguished by size. As anticipated, expression of
endogenous p19INK4D was enhanced in response to
IL-10, whereas retrovirally expressed p19INK4D
was not regulated by IL-10. The increased expression of
p19INK4D was sufficient to reduce proliferation
of J774:p19INK4D clones (cultured in serum in the
absence of IL-10) by 3- to 8-fold relative to control cells, an effect
greater than that caused by IL-10 (Fig. 5
b). It is
noteworthy that addition of IL-10 further inhibited thymidine
incorporation in J774:p19INK4D cells, perhaps
suggesting a role for additional IL-10-activated pathways in inhibition
of proliferation. These experiments indicate that ectopic constitutive
expression of p19INK4D is sufficient to
dramatically lower proliferation of J774 cells, but does not maximally
inhibit proliferation.
|
To determine whether Stat3 might act directly on the
p19INK4D promoter, we cloned and sequenced a
1637-bp fragment of the murine p19INK4D proximal
promoter (GenBank accession no. AF098021). Two candidate STAT binding
sites were identified, TTCCTTTAA and TTCCCAGCA, at nt -461 and -1151,
respectively (Fig. 6
a). A
luciferase reporter controlled by the 1637-bp promoter fragment was
generated and transiently transfected into J774 cells. Treatment of
transfected cells with IL-10 up-regulated luciferase activity by
3-fold relative to control cells (Fig. 6
b), verifying
that IL-10 acts transcriptionally on the p19INK4D
promoter. Of the two potential STAT binding sites in the promoter, the
site at -461 may be more likely to mediate STAT transactivation
because of its proximity to the transcription initiation site. To
assess its contribution to IL-10-mediated activation of the
p19INK4D promoter, this site was mutated to
TCACCACCA and the mutant analyzed for
IL-10-induced transcriptional activity. As shown in Fig. 6
b,
the mutant promoter no longer responded to IL-10, indicating that IL-10
regulates promoter activity through Stat3.
|
To clarify the requirement for
p19INK4D to inhibit proliferation, an antisense
approach was used. Antisense oligonucleotides to p19
INK4D reduced the ability of IL-10 to inhibit
proliferation in J774 cells by
2-fold, whereas sense
oligonucleotides did not (Fig. 7
a). This suggests that p19 is
required for optimal inhibition of proliferation by IL-10, and the
observed inhibition of proliferation in the presence of antisense
oligonucleotide may be mediated either by residual p19
INK4D, which is not blocked by antisense, or
alternatively by other growth inhibitors. To further address this
question, the ability of IL-10 to inhibit proliferation of macrophages
generated from p19INK4D-deficient mice was
investigated. The M-CSF-dependent proliferation of WT and p19
INK4D-deficient macrophages was similar, with
proliferation above background first apparent at
3 ng/ml M-CSF (Fig. 7
b). IL-10 potently inhibited proliferation of WT
macrophages, but was less efficient at inhibition of proliferation of
p19 INK4D-deficient macrophages. For example, at
25 ng/ml M-CSF, IL-10 decreased proliferation by 3-fold in WT
macrophages but only 1.9-fold in p19
INK4D-deficient macrophages. Statistical analysis
by Students paired t test showed that the mean 1.80-fold
inhibition of M-CSF (>3 ng/ml) stimulated proliferation in p19
INK4D-deficient macrophages was significantly
different from the mean of 2.57-fold inhibition observed in WT
macrophages (p < 0.05). This data clarifies
that p19INK4D is required for full growth
inhibitory responses to IL-10, and moreover suggests that additional
mechanisms or pathways activated by IL-10 are involved.
|
IL-10 may induce additional cell cycle regulators which act in
concert with p19INK4D to inhibit cell cycle
progression, e.g., members of the CIP/KIP family. The expression of
p21CIP1 was examined, and we found that IL-10
induced expression of p21CIP1 mRNA within 30 min,
which increased at later time points (Fig. 8
). To assess whether up-regulation of
p21CIP1 was dependent on the membrane-distal
tyrosines of hIL-10R
or Stat3, p21CIP1
expression was examined in the mutant J774 cell lines. In cells
expressing WT hIL-10R:WT or hIL-10R:TyrFF, IL-10
induced p21CIP1 similar to that in control cells,
suggesting that signaling from tyrosines 466 and 496 is not required to
induce p21CIP1 expression. Consistent with this
data,
Stat3 did not interfere with up-regulation of
p21CIP1, implying that other pathways activated
by the IL-10R complex are involved.
|
| Discussion |
|---|
|
|
|---|
cdk inhibitors act by binding to cyclin-cdk complexes and inhibiting
their enzyme activity in a stoichiometric manner (23).
Regulation of cdk inhibitor expression is one mechanism by which
cytokines exert antiproliferative effects prevent cell cycle
progression (24, 25, 26, 28, 29, 41). Our data suggest that
IL-10 uses a similar mechanism to block macrophage proliferation. J774
cells express p18INK4C and
p19INK4D, but only p19INK4D
was up-regulated by IL-10. The kinetics of induction was similar to
that described for IFN-
, which has been shown to induce
p19INK4D expression in association with
G1 growth arrest in the BAC1.2F5A macrophage
(36) and in the ANBL-6 myeloma (27) cell
lines. In addition to its role in causing G1
phase arrest, p19INK4D has been implicated in
regulation of differentiation (42), although in J774 cells
the growth suppressive effect of IL-10 does not appear to be associated
with differentiation (6). p19INK4D
may have additional roles in actively proliferating cells, since in a
synchronized macrophage cell line (BAC1.2F5A) stimulated with M-CSF,
p19INK4D mRNA expression peaks at S phase
(21). This may account for the marginal increase in
p19INK4D expression observed in NBM-derived
macrophages stimulated with M-CSF alone (Fig. 2
).
In the hIL-10R
-chain, membrane-distal tyrosines 446 and 496 are
necessary to transduce an antiproliferative signal (6). We
show that cells bearing receptors mutated at these tyrosines were found
to be deficient in induction of p19INK4D,
thus implicating p19 INK4D in mediating
IL-10-induced growth suppression. Stat3 is directly recruited to these
tyrosines, and Stat3 activation is essential for the antiproliferative
response to IL-10 (6). In cells expressing
Stat3, the
ability of IL-10 to induce p19INK4D expression
was significantly reduced. We therefore propose that activation of
Stat3 mediated by membrane-distal tyrosines of IL-10R
is a major
pathway responsible for induction of p19INK4D.
This observation is consistent with a recent finding that
Stat3-dependent growth arrest of the M1 cell line in response to IL-6
is associated with induction of p19INK4D
(43). It should be noted that in J774 cells expressing
hIL-10R:TyrFF, a weak induction of p19 was
observed at later time points (12 h), which may represent an additional
pathway of p19INK4D induction mediated by the
membrane-distal tyrosines, but not requiring Stat3. Since IL-10 growth
inhibitory signals are not transduced by the double tyrosine mutant
receptor, this late induction is either not sufficient to repress
proliferation or serves an alternate purpose. We have tested the
ability of single tyrosine mutations to transmit growth inhibitory
signals and found that the presence of one intact tyrosine is
sufficient to inhibit growth (A. M. OFarrell and A. L.-F.
Mui, unpublished results). This redundant function of the two tyrosines
mirrors their equally interchangeable ability to recruit and activate
Stat3.
We have previously shown that activation of Stat3-GyrB chimeras by
coumermycin yields STAT oligomers which transactivate STAT-responsive
reporter genes and inhibit J774 cell proliferation, mimicking the
effect of IL-10. Since coumermycin induced
p19INK4D expression in J774:Stat3-GyrB cells, we
propose that suppression of proliferation by coumermycin is mediated by
p19INK4D and furthermore that Stat3 activation
alone is sufficient for p19INK4 induction. It
should be noted that p19INK4D expression is
slightly stronger and more sustained in response to IL-10 than
coumermycin. This correlates with a generally more potent inhibition of
proliferation by IL-10 (5080%) than by coumermycin (4060%), and
there are a number of possible explanations for this trend. It is
possible that additional Stat3 signaling events may not be
recapitulated by Stat3-GyrB or that optimal inhibition of proliferation
may require contributions of additional Stat3-independent signaling
pathways (11, 17). The latter possibility is consistent
with intact up-regulation of p21CIP1 in J774
cells expressing hIL-10R:TyrFF or
Stat3,
suggesting that an as yet unidentified region of IL-10R which couples
to a Stat3-independent pathway mediates this response. However, since
dominant-negative Stat3 completely blocks growth arrest
(6), it appears that p21CIP1 alone
is insufficient to inhibit proliferation.
Sequence and functional analysis of the p19INK4D
promoter revealed a candidate Stat3 binding site that was IL-10
responsive. Similarly, a Stat1 binding site in the
p21CIP1 promoter is directly regulated by IFN-
and is essential for inhibition of proliferation (28).
Although a number of Stat3 target genes have been identified, including
Stat3 itself (44), tissue inhibitor of metalloproteinase-1
(45), JunB (46), and
2-macroglobulin (38), these have
primarily been associated with the action of cytokines which signal via
gp130. Database searches revealed that STAT binding sites exist also in
the promoters of other cell cycle regulators including
p27KIP1 (GenBank accession no. U77915: TTTCCTGAA)
and p16INK4A (GenBank accession no. U47018:
TTCTCAGAA). Despite the presence of potential Stat3 binding sites,
IL-10 does not induce p27KIP1 in J774 cells (A.
L-F. Mui, unpublished data).
Two complementary approaches, antisense oligonucleotides and
p19INK4D-deficient mice, were used to assess the
absolute requirement for p19INK4D to suppress
macrophage proliferation. In both cases, data showed that in the
absence of p19INK4D the ability of IL-10 to
inhibit proliferation was significantly but not completely reduced.
This is consistent with our observation that addition of IL-10 further
decreased thymidine incorporation in J774 cells that ectopically
express p19INK4D. It is likely therefore that
IL-10 induces additional cell cycle inhibitors such as
p21CIP1, which contribute to growth arrest,
analogous to mechanisms proposed for growth arrest elicited by IFN-
(41) and TGF-ß (25). This hypothesis is
consistent with the recent model for G1 phase
progression where up-regulated p19INK4D displaces
p21CIP1 from cyclin D-cdk4 complexes and inhibits
cyclin D-cdk4 activity and p21CIP1 inhibits
cyclin A/E-cdk2 activity, leading to a complete cooperative block in
cell cycle progression (for review, see Refs. 23, 47, 48). However, there is a discrepancy between
J774:
Stat3 and p19INK4D-deficient mouse
data, since
Stat3 fully blocked growth arrest, but
p19INK4D deficiency did not. Since the p21
CIP1 response should be intact in both cases,
possible explanations are either that p19INK4D is
not the only gene/pathway activated by Stat3 to mediate the observed
inhibition of proliferation or that functional redundancy occurs in the
INK4 family in p19INK4D-deficient mice.
In summary, we have identified p19INK4D and p21CIP1 as targets of IL-10 signaling which contribute to growth arrest and demonstrated that activation of Stat3 is necessary and sufficient for induction of p19INK4D. It will be interesting to determine whether this mechanism is also used in additional cell types which are growth inhibited by IL-10 and whether p19INK4D and p21CIP1 have functions in other IL-10 responses.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Ann Marie OFarrell at her current address: Systemix, 3155 Porter Drive, Palo Alto, CA 94304. ![]()
3 Current address, Department of Surgery, University of British Columbia, Jack Bell Research Centre, 2660 Oak Street, Vancouver, British Columbia, Canada V6H 3Z6. ![]()
4 Abbreviations used in this paper: GyrB, Gyrase B; h, human; m, murine; cdk, cyclin-dependent kinase; NBM, normal bone marrow; WT, wild type; M-CSF, macrophage CSF; IP, immunoprecipitation. ![]()
Received for publication September 16, 1999. Accepted for publication February 24, 2000.
| References |
|---|
|
|
|---|
ß peptide complexes at the plasma membrane of monocytes by affecting arrival and recycling. Immunity 7:861.[Medline]
-induced intercellular adhesion molecule-1 gene transcription in human monocytes. Blood 89:4461.
and STAT3 complexes in human T cells and monocytes. J. Immunol. 155:1079.[Abstract]
in hematopoietic cell lines. Oncogene 14:415.[Medline]
B on an overlapping DNA binding site. Biochem. Biophys. Res. Commun. 237:90.[Medline]
-induced G1 phase arrest through up-regulated expression of CDK inhibitors, p19INK4D and p21Cip1 in mouse macrophages. Oncogene 16:2075.[Medline]
This article has been cited by other articles:
![]() |
L. Gilles, R. Guieze, D. Bluteau, V. Cordette-Lagarde, C. Lacout, R. Favier, F. Larbret, N. Debili, W. Vainchenker, and H. Raslova P19INK4D links endomitotic arrest and megakaryocyte maturation and is regulated by AML-1 Blood, April 15, 2008; 111(8): 4081 - 4091. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wise, C. McCaughan, C. K. Tan, A. A. Mercer, and S. B. Fleming Orf virus interleukin-10 inhibits cytokine synthesis in activated human THP-1 monocytes, but only partially impairs their proliferation J. Gen. Virol., June 1, 2007; 88(6): 1677 - 1682. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Peterson, D. T. Nardelli, T. F. Warner, S. M. Callister, J. R. Torrealba, and R. F. Schell Anti-p19 Antibody Treatment Exacerbates Lyme Arthritis and Enhances Borreliacidal Activity Clin. Vaccine Immunol., May 1, 2007; 14(5): 510 - 517. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jewett, C. Head, and N.A. Cacalano Emerging Mechanisms of Immunosuppression in Oral Cancers. J. Dent. Res., December 1, 2006; 85(12): 1061 - 1073. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Bailey, M. Kashyap, L. A. Bouton, P. J. Murray, and J. J. Ryan Interleukin-10 induces apoptosis in developing mast cells and macrophages J. Leukoc. Biol., September 1, 2006; 80(3): 581 - 589. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Qasimi, A. Ming-Lum, A. Ghanipour, C. J. Ong, M. E. Cox, J. Ihle, N. Cacalano, A. Yoshimura, and A. L-F. Mui Divergent Mechanisms Utilized by SOCS3 to Mediate Interleukin-10 Inhibition of Tumor Necrosis Factor {alpha} and Nitric Oxide Production by Macrophages J. Biol. Chem., March 10, 2006; 281(10): 6316 - 6324. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. R. Rahimi, K. Gee, S. Mishra, W. Lim, and A. Kumar STAT-1 Mediates the Stimulatory Effect of IL-10 on CD14 Expression in Human Monocytic Cells J. Immunol., June 15, 2005; 174(12): 7823 - 7832. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chen, M. H. Kapturczak, C. Wasserfall, O. Y. Glushakova, M. Campbell-Thompson, J. S. Deshane, R. Joseph, P. E. |