|
|
||||||||
24J
Q Invariant TCR Chain in the Lesions of Multiple Sclerosis and Chronic Inflammatory Demyelinating Polyneuropathy1


*
Department of Demyelinating Disease and Aging, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Ogawahigashi, Kodaira, Tokyo, Japan;
NeuroResource, Institute of Neurology, London, United Kingdom;
Department of Neurology, Faculty of Medicine, Kyoto University, Kyoto, Japan; and
§
Department of Immunology, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Tokyo, Japan
| Abstract |
|---|
|
|
|---|
24+ NK T cells are a unique subset of
lymphocytes expressing the V
24J
Q invariant TCR chain. Because
they can rapidly produce large amounts of regulatory cytokines, a
reduction of NK T cells may lead to the development of certain
autoimmune diseases. Using a single-strand conformation polymorphism
method, we demonstrate that a great reduction of V
24J
Q NK T cells
in the peripheral blood is an immunological hallmark of multiple
sclerosis, whereas it is not appreciable in other
autoimmune/inflammatory diseases such as chronic inflammatory
demyelinating polyneuropathy. The chronic inflammatory demyelinating
polyneuropathy lesions were often found to be infiltrated with
V
24J
Q NK T cells, but multiple sclerosis lesions only rarely
expressed the V
24J
Q TCR. It is therefore possible that the extent
of NK T cell alteration may be a critical factor which would define the
clinical and pathological features of autoimmune disease. Although the
mechanism underlying the NK T cell deletion remains largely unclear, a
remarkable contrast between the CNS and peripheral nervous system
diseases allows us to speculate a role of tissue-specific elements such
as the level of CD1d expression or differences in the CD1d-bound
glycolipid. | Introduction |
|---|
|
|
|---|
-J
TCR rearrangement (1, 2, 3, 4, 5, 6). Although expression of the
V
14J
281 canonical sequence characterizes rodent NK T cells
(1, 2), human NK T cells express a V
24J
Q invariant
chain which is highly homologous to the murine V
14J
281 sequence
(3, 4, 5, 6). Unlike conventional
ß T cells, both rodent
and human NK T cells are restricted by the CD1d molecule and can be
triggered by a CD1d-restricted glycolipid ligand (7, 8, 9).
NK T cells can produce large amounts of IL-4 and IFN-
within hours
of TCR engagement (1, 2, 10, 11, 12), and the potential to
produce IL-4 suggests their regulatory role in polarizing unprimed T
cells toward a Th2 population. Although a requirement of NK T cells for
a Th2 immune response is not absolute (13, 14),
accumulating evidence supports the role of NK T cells in the regulation
of autoimmune diseases (15, 16, 17, 18, 19, 20). It has recently been reported that NK T cells may be numerically or functionally altered in certain autoimmune diseases. A decreased number of NK T cells was demonstrated in human systemic sclerosis (15), insulin-dependent diabetes mellitus (16), and spontaneous autoimmune diseases in rodents (17, 18, 19). However, it is difficult to assess the role of NK T cells in some studies because the kinetics of the NK T cell reduction was not studied and because the status of NK T cells in disease controls was not examined with the same assay. Moreover, none of the studies have addressed whether NK T cells may participate in the local regulation of autoimmune diseases.
We initiated this study to clarify whether a reduction of V
24J
Q
NK T cells in the periphery may be seen in the relapsing/remitting type
of multiple sclerosis
(MS).4 To detect the
presence of NK T cells, we used a novel method relying on single-strand
conformation polymorphism (SSCP) of TCR nucleotide chains
(21, 22, 23). This is a simple and powerful method to examine
the presence of a particular TCR rearrangement in any sample that
allows detection of TCR genes. In this study, we amplified the V
24
TCR products in various samples by PCR, displayed these PCR products on
a SSCP gel after denaturation, and then visualized the presence of the
V
24J
Q invariant chain of NK T cells using the specific probe.
Utilizing the SSCP method, we were able to monitor the presence of the
V
24J
Q invariant chain along with the overall profile of
V
24+ T cell clonotypes.
First, we obtained evidence that V
24J
Q NK T cells are greatly
reduced in the peripheral blood of MS, particularly during clinical
remission. Interestingly, the NK T cell reduction was not appreciable
in control autoimmune/inflammatory diseases affecting muscles or
peripheral nerves, including chronic inflammatory demyelinating
polyneuropathy (CIDP) (24, 25, 26, 27). CIDP is pathologically
characterized by T cell infiltration with macrophage activation and
up-regulation of MHC class II expression within the peripheral nervous
system (PNS) (25), reminiscent of MS. We further explored
whether V
24J
Q NK T cells are engaged in the local pathology of
MS, CIDP, or control diseases. The invariant V
24J
Q TCR was not
detected in the control CNS or PNS samples and could be seen only
rarely in the CNS plaques of autopsied MS patients. In contrast, the
invariant TCR was detected in 6 of 10 biopsy lesions from CIDP. Based
on the collective data, we postulate that although V
24J
Q NK T
cells may not efficiently regulate MS because of their deficiency in
vivo, they may play a role in the local regulation of CIDP.
| Materials and Methods |
|---|
|
|
|---|
All of the MS patients fulfilled the diagnostic criteria for definite MS (28), and results of magnetic resonance imaging further assisted the diagnosis. No medication had been given to the patients for 3 mo before blood and/or cerebrospinal fluid (CSF) samples were obtained. In this study, we operationally defined "MS in remission" as those who have been clinically stable for more than 3 mo, and "MS in relapse" as those who have recently developed an apparent exacerbation. In the "relapse" patients, blood samples were obtained within 1 wk after the onset of exacerbation. Diagnosis of CIDP was based on the criteria of the American Academy of Neurology (24), and biopsy samples of sural nerves were obtained with a standard procedure (29). PBMC were isolated on a Ficoll density gradient. Autopsy samples of CNS tissues as well as the biopsy samples of sural nerves were snap-frozen and stored at -70°C until use. The histopathological characterization of the MS plaques was performed as described previously (30).
PCR and SSCP analysis
SSCP clonotype analysis (21, 22, 23) was applied to
identify the V
24J
Q TCR chain among PCR-amplified
V
24+ clonotypes. In brief, mRNA was isolated
from PBMC, CSF, CNS, or peripheral nerve samples with a QuickPrep Micro
mRNA purification kit (Pharmacia Biotech, Uppsala, Sweden) and
converted to cDNA by using a first-strand cDNA synthesis kit (Pharmacia
Biotech). One microliter of the diluted cDNA reaction was then mixed
with a V
24-specific sense primer (ACACAAAGTCGAACGGAAG) and a
C
-antisense primer (GATTTAGAGTCTCTCAGCTG) (30 pmol for each). PCR
was performed in 50-µl reactions containing 5 µl of 10x
ExTaqBuffer (Takara, Tokyo, Japan), 4 µl of dNTPs, and 2.5 U of ExTaq
DNA polymerase in a thermal cycler 480 (Takara). Although PBMC samples
were amplified for 35 cycles, CSF, CNS, and PNS samples were amplified
for 38 cycles (30 s at 94°C, 30 s at 60°C, and 1 min at
72°C). The PCR products were diluted in a denaturing solution (95%
formamide/10 mM EDTA/0.1% bromophenol blue/0.1% xylencyanol) and
incubated at 90°C for heat denaturation. The samples were then loaded
onto a nondenaturing 4% polyacrylamide gel containing 10% glycerol.
After electrophoresis, the DNA was transferred to Pall Biodyne nylon
membranes (Pall Biosupport, Port Washington, NY) and hybridized either
with a biotinylated C
-specific internal probe
(AAATATCCAGAACCCTGACCCTGCCGTGTACC) or with a biotinylated probe for
the invariant V
24J
Q sequence (TGTGTGGTGAGCGACAGAGGCTCAACCCTG).
The DNA was visualized by subsequent incubation with a chemiluminescent
substrate system (Phototope Star detection kit; New England Biolabs,
Beverly, MA). GAPDH was used as an internal control for all PCR
reactions (GAPDH primer set; Stratagene, La Jolla, CA). Under the same
conditions, cDNAs for human CD1d, IL-4, and IFN-
were amplified by
PCR with a set of primers: CD1d forward, GGTTTATCGAAGCAGCTTCAC and CD1d
reverse, CACTTGAATGGCCAAGTTTAC; IL-4 forward, ACTGCAAATCGACACCTATTA and
IL-4 reverse, ATGGTGGCTGTAGAACTGC; and IFN-
forward,
ATGTAGCGGATAATGGAACTC and IFN-
reverse, AACTTGACATTCATGTCTTCC.
| Results |
|---|
|
|
|---|
24J
Q sequence in peripheral blood
of healthy subjects
First, we examined PBMC samples obtained from healthy subjects
(HS). After PCR amplification with a set of the V
24 and C
primers, the amplified products were electrophoresed on the SSCP gel
and hybridized with the biotinylated C
probe. All of these samples
demonstrated multiple bands on a smear background or a dense smear
without appreciable bands, showing clonal heterogeneity of the
V
24+ T cells (Fig. 1
A, upper panel).
Of note, these samples appeared to share identical SSCP clonotypes as
they electrophoresed at the same positions. After removing the C
probe, the membrane was hybridized with the biotinylated probe specific
for the invariant V
24J
Q TCR. One of the bands shared in all the
samples apparently hybridized with this probe (Fig. 1
A,
lower panel; Table I
), showing
the presence for the V
24J
Q TCR. Furthermore, by sequencing the
TCR products eluted from corresponding areas of gels as reported
previously (23), we confirmed that they would correspond
to the invariant V
24J
Q TCR, a marker of human NK T cells (data
not shown).
|
|
24J
Q chain in MS patients in
remission vs relapse
Using the PBMC samples from HS as positive control, we studied
PBMC samples from MS patients in remission. The amplified
V
24+ TCR products (Fig. 1
B,
upper panel) tended to show more limited numbers of bands
and/or lesser degrees of smear density on SSCP gels as compared with
HS. Unlike the samples from HS, occurrence of oligoclonal expansion was
suggested in a proportion of these samples. More remarkably, none of
the samples would hybridize with the probe for the invariant
V
24J
Q (Fig. 1
B, lower panel; Table I
). It
was of note that not only samples expressing a few bands but those with
dense smears (such as those from patient 5, 6, 7, or 10) did not
hybridize with the V
24J
Q probe. Although the PCR-SSCP analysis is
not an absolute frequency measurement, these results indicate a great
reduction of V
24J
Q NK T cells along with a biased composition of
V
24+ T cells. In parallel, we analyzed PBMC
samples obtained from MS patients in relapse. Although the invariant
V
24J
Q was absent in the remission samples, 7 of the 26 relapse
samples expressed the invariant TCR (Fig. 1
C). This
indicates that V
24J
Q NK T cells could sometimes be repopulated
during relapse. Of note, a long-term follow-up of one patient (patient
2) suggested the probable association between the NK T cell
repopulation and clinical relapse (Table II
): although the invariant V
24J
Q
chain was absent in the two samples obtained during remission, three of
the four relapse samples expressed the invariant chain. In addition,
repopulation of NK T cells was suggested in one of the two relapses in
patient 13 (Table II
). We also examined PBMC samples of other
neurological diseases (ONDs, Table I
), including 7 with noninflammatory
CNS diseases, 11 with immune-mediated PNS or muscle diseases (including
6 with CIDP), and 2 noninflammatory PNS diseases (details described in
the footnotes to Table I
). Except for two samples from the
noninflammatory CNS diseases (Parkinson disease and hereditary ataxia),
the PBMC samples of the ONDs were all positive for the invariant TCR.
The presence of the invariant TCR in the immune-mediated diseases such
as CIDP and polymyositis indicates that a great reduction in NK T cells
is not a general feature of immunological/inflammatory diseases.
|
To know whether NK T cells may participate in the local regulation
for the immunopathology of MS, we next examined the presence of the
invariant V
24J
Q TCR in CSF samples obtained from MS patients in
relapse (Fig. 2
). Although the
V
24+ SSCP profiles were variable, the majority
of these samples were characterized by a limited number (1
10) of
bands without background smear. The invariant V
24J
Q chain was
detected in 11 of the 24 samples (Table I
) and this TCR chain was
usually a predominant one among the detectable clonotypes. We were able
to directly compare five blood-CSF pairs from MS (marked with asterisk
in Table II
). The pairs from patients 1 and 20 revealed the presence of
the invariant TCR in CSF but not in blood, whereas the other three
pairs were both positive for the invariant TCR (patient 2) or both
negative (patient 13 and 17). The invariant TCR was seen only in one of
nine CSF samples from ONDs (Table I
). These results indicate that NK T
cells would sometimes (but not consistently) appear in the CSF of some
MS patients, possibly owing to local clonal expansion.
|
We next examined MS plaques (11 acute, 6 subacute, and 8 chronic
plaques) from 10 autopsied cases, 6 CNS samples from 3 OND patients,
and 6 from 6 non-neurological disease (NND) (Table III
). V
24 TCR messages were detected
in 15 of the 25 MS plaques, showing no particular preference for acute,
subacute, or chronic plaques. The invariant V
24J
Q TCR was found
only in 1 subacute lesion of the 15
V
24+TCR-expressing plaques (Fig. 3
). Three of the six OND samples
expressed V
24+ TCR, but the invariant
V
24J
Q chain could not be detected in these samples. The NND
samples did not express any V
24+ TCR chain.
Furthermore, the V
24J
Q-expressing plaque and four randomly chosen
MS plaques were examined for the presence of IFN-
and IL-4 mRNA. The
V
24J
Q-expressing plaque did not express IFN-
mRNA, whereas the
other plaques were all positive for IFN-
(Table IV
, MS plaques). IL-4 was not detected in
any of the CNS lesions.
|
|
|
24J
Q (Fig. 4
mRNA appeared to be less consistent in
CIDP than MS. Of note, none of the OND nerve samples expressed the
invariant V
24J
Q, and IL-4 was detected less frequently in the OND
as compared with CIDP (Table IV
24J
Q NK T
cells.
|
|
| Discussion |
|---|
|
|
|---|
24J
Q TCR. The previous
studies (15, 16) evaluated the frequency of the
V
24J
Q NK T cells by isolating
CD4-CD8- T cells by flow
cytometry and cloning V
24+ TCR. Because it is
a laborious procedure, only a limited number of patient PBMC samples
(four systemic sclerosis and nine insulin-dependent diabetes mellitus)
were examined. In contrast, the SSCP method enables us to monitor the
V
24J
Q TCR along with the overall V
24 repertoire and to handle
a large number of samples from a variety of sources, including a minute
volume of frozen sample. In this study, we examined PBMC, CSF, and
inflammatory tissues obtained from MS and control diseases including
CIDP. As shown in Fig. 1
24J
Q probe always
detected the invariant TCR as a dominant band. Although one or two
additional bands were faintly detected in some samples, there was no
difficulty in identifying the major band for the invariant TCR in a
given sample by setting a positive control of HS PBMC. We conceive that
the additional bands most probably represent the invariant V
24J
Q
TCR with an alternative conformation (21, 22) because they
would migrate to the same positions (Fig. 1
24J
Q probe degeneracy was not a major concern, because
of the limited number of bands.
The first remarkable observation was that all of the PBMC samples of MS
in remission and three-quarters of the samples in relapse did not
express the V
24J
Q rearrangement (Table I
). In contrast, all of
the samples from HS and 90% of the OND samples expressed the invariant
TCR. The striking difference between MS and control groups implies that
V
24J
Q NK T cells are greatly reduced in MS. It was possible that
the reduction of V
24J
Q NK T cells in the periphery might be due
to recruitment of a large number of the cells into the site of
pathology. However, the detection frequency of NK T cells in the CSF
and CNS samples (Tables 1 and 3) was lower than the frequency of the
PBMC samples of MS in which NK T cells are greatly reduced.
Furthermore, examination of PBMC-CSF pairs (Table II
) showed that the
absence of V
24J
Q TCR in the PBMC is not necessarily associated
with its presence in the CSF. These results do not support the
idea that peripheral reduction of NK T cells may be secondary to
massive recruitment of the cells into the CNS.
Studies of mice (33, 34) indicate a role of IL-12 and TCR ligand in causing the apoptotic deletion of NK T cells in vivo. However, the reduction of NK T cells in MS was more pronounced in remission than relapse, excluding a correlation of IL-12 elevation and NK T cell reduction. Although some cytokines could be involved, it is likely that an additional molecule differentially expressed in MS and CIDP may play a key role in the selective reduction of NK T cells in MS. We would speculate that the differentially displayed molecule may be a TCR ligand (possibly glycolipid/CD1d) that could specifically delete NK T cells.
On the other hand, we also demonstrated that the greatly reduced
V
24J
Q NK T cells could appear again in the course of MS. A most
convincing evidence was obtained after a 2-year follow-up of patient 2
(Table II
), revealing that NK T cells could probably repopulate during
clinical exacerbation. It is currently recognized that NK T cells are
relatively resistant to glucocorticoid-induced apoptosis as compared
with conventional T cells (35). It was, therefore,
arguable that production of endogenous glucocorticoids during clinical
exacerbation may trigger the expansion of NK T cells by altering a
balance between conventional T cells and NK T cells. However, this is
unlikely since the repopulation of V
24J
Q NK T cells was
accompanied by the reappearance of other V
24+
clones (see the relapse samples from patient 2 in Fig. 1
C).
It is reported in mice that once deleted, NK T cells in liver and
spleen could rapidly repopulate via regeneration of the NK T cells in
bone marrow (33). If this observation can be extrapolated
to humans, the NK T cell repopulation seen in MS may be explained by
disruption of death signals and/or induction of survival (growth)
factors that might occur in association with clinical relapse.
Most notably, we demonstrate the presence of V
24J
Q NK T cells in
the autoimmune inflammatory lesions of CIDP. To our knowledge, this is
the first definitive proof for the local engagement of V
24J
Q NK T
cells. In contrast to CIDP, the invariant TCR was only rarely detected
in MS lesions (Fig. 3
and Table III
). This intriguing contrast can
probably be based on the difference in the total number of NK T cells
in vivo. However, differences in the local environment for the survival
of NK T cells may also underlie the immunopathological differences
between MS and CIDP.
At this moment, the role of the locally infiltrated NK T cells in CIDP
or MS is not clear. Because both murine and human NK T cells have the
potential to produce a large amount of IFN-
and IL-4 (1, 2, 10, 11, 12), it is possible that the Th1 cell-mediated CNS or PNS
inflammation may be up- or down-regulated by either IFN-
or IL-4
locally produced by NK T cells. To obtain some insight, we evaluated
expression of the cytokine messages in the CNS and PNS samples (Table IV
). The results revealed significant differences in the cytokine
milieu among the CNS and PNS diseases. To know whether the NK T cell
infiltration may account for the differential expression of the
cytokines, we need to perform cytokine analysis on a single-cell basis
in the future.
In summary, we demonstrate that a great reduction of V
24J
Q NK T
cells in the peripheral blood is an immunological hallmark of MS,
whereas it is not appreciable in CIDP. The CIDP lesions were found to
be often infiltrated with V
24J
Q NK T cells, but MS lesions only
rarely expressed the V
24J
Q TCR. It is therefore possible that the
extent of NK T cell alteration may be a critical factor which would
define the clinical and pathological features of the autoimmune
diseases. Finally, although the mechanism underlying the NK T cell
deletion remains largely unclear, a remarkable contrast between the CNS
and PNS diseases allows us to speculate a role of tissue-specific
elements such as the level of CD1d expression or differences in the
CD1d-bound glycolipid. Namely, it is possible that interaction of NK T
cells with the CNS APC strongly expressing CD1d or recognition of
CD1d-associated ligand restricted to the CNS by NK T cells may lead to
deletion of NK T cells via TCR engagement. This postulate could be
verified in the future by analyzing the alteration of NK T cells in a
wider range of tissue-specific autoimmune diseases.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Z.I. and T.K. have contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Takashi Yamamura, Department of Immunology, National Institute of Neuroscience, National Center of Neurology and Psychiatry, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187-8502, Japan. E-mail address: ![]()
4 Abbreviations used in this paper: MS, multiple sclerosis; CIDP, chronic inflammatory demyelinating polyneuropathy; CSF, cerebrospinal fluid; HS, healthy subject; NND, non-neurological disease; OND, other neurological disease; PNS, peripheral nervous system; SSCP, single-strand conformation polymorphism. ![]()
Received for publication October 12, 1999. Accepted for publication February 2, 2000.
| References |
|---|
|
|
|---|
/ß T cells demonstrates preferential use of several Vß genes and an invariant TCR
chain. J. Exp. Med. 178:1.
24-J
Q/Vß11 T cell receptor is expressed in all individuals by clonally expanded CD4-8- T cells. J. Exp. Med. 180:1171.
24+ CD4-CD8- T cells. J. Exp. Med. 186:109.
24 and Vß11 coexpression defines a human NK1 T cell analog containing a unique Th0 subpopulation. J. Immunol. 159:5862.[Abstract]
14 NK T cells by glycosylceramides. Science 278:1626.
-galactosylceramide by natural killer T cells is highly conserved through mammalian evolution. J. Exp. Med. 188:1521.
production by natural killer (NK) cells and NK1.1+ T cells upon NKR-P1 cross-linking. J. Exp. Med. 183:2391.
upon activation by anti-CD3 or CD1. J. Immunol. 159:2240.
24J
Q antigen receptor in patients with systemic sclerosis. J. Exp. Med. 182:1163.
24J
Q T cells in type 1 diabetes. Nature 391:177.[Medline]
14+ NK T cells associated with disease development in autoimmune-prone mice. J. Immunol. 156:4035.[Abstract]
ß TCR+CD4-CD8- T-cell deficiency and IDDM in NOD/Lt mice. Diabetes 46:572.[Abstract]
/ß-T cell receptor (TCR)+CD4-CD8- (NK T) thymocytes prevent insulin-dependent diabetes mellitus in nonobese diabetic (NOD)/Lt mice by the influence of interleukin (IL)-4 and/or IL-10. J. Exp. Med. 187:1047.
- or IL-12-treated mice: a major role for bone marrow in NK T cell homeostasis. Immunity 9:345.[Medline]
This article has been cited by other articles:
![]() |
M Podbielska and E. Hogan Molecular and immunogenic features of myelin lipids: incitants or modulators of multiple sclerosis? Multiple Sclerosis, September 1, 2009; 15(9): 1011 - 1029. [Abstract] [PDF] |
||||
![]() |
H. C. Lehmann, G. Meyer zu Horste, B. C. Kieseier, and H.-P. Hartung Review: Pathogenesis and treatment of immune-mediated neuropathies Therapeutic Advances in Neurological Disorders, July 1, 2009; 2(4): 261 - 281. [Abstract] [PDF] |
||||
![]() |
A. Peterfalvi, E. Gomori, T. Magyarlaki, J. Pal, M. Banati, A. Javorhazy, J. Szekeres-Bartho, L. Szereday, and Z. Illes Invariant V{alpha}7.2-J{alpha}33 TCR is expressed in human kidney and brain tumors indicating infiltration by mucosal-associated invariant T (MAIT) cells Int. Immunol., December 1, 2008; 20(12): 1517 - 1525. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Tsunoda, T. Tanaka, and R. S. Fujinami Regulatory Role of CD1d in Neurotropic Virus Infection J. Virol., October 15, 2008; 82(20): 10279 - 10289. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Diao, K. Iwabuchi, L. Li, K. Onoe, L. Van Kaer, S. Kon, Y. Saito, J. Morimoto, D. T. Denhardt, S. Rittling, et al. Osteopontin regulates development and function of invariant natural killer T cells PNAS, October 14, 2008; 105(41): 15884 - 15889. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. T. Mars, A.-S. Gautron, J. Novak, L. Beaudoin, J. Diana, R. S. Liblau, and A. Lehuen Invariant NKT Cells Regulate Experimental Autoimmune Encephalomyelitis and Infiltrate the Central Nervous System in a CD1d-Independent Manner J. Immunol., August 15, 2008; 181(4): 2321 - 2329. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. V. Baev, S. Caielli, F. Ronchi, M. Coccia, F. Facciotti, K. E. Nichols, and M. Falcone Impaired SLAM-SLAM Homotypic Interaction between Invariant NKT Cells and Dendritic Cells Affects Differentiation of IL-4/IL-10-Secreting NKT2 Cells in Nonobese Diabetic Mice J. Immunol., July 15, 2008; 181(2): 869 - 877. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yamaura, C. Hotta, M. Nakazawa, L. Van Kaer, and M. Minami Human invariant V{alpha}24+ natural killer T cells acquire regulatory functions by interacting with IL-10-treated dendritic cells Blood, April 15, 2008; 111(8): 4254 - 4263. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tsukamoto, M. Ohtsuji, W. Shiroiwa, Q. Lin, K. Nakamura, H. Tsurui, Y. Jiang, K. Sudo, H. Nishimura, T. Shirai, et al. Aberrant Genetic Control of Invariant TCR-Bearing NKT Cell Function in New Zealand Mouse Strains: Possible Involvement in Systemic Lupus Erythematosus Pathogenesis J. Immunol., April 1, 2008; 180(7): 4530 - 4539. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vasan, M. A. Poles, A. Horowitz, E. E. Siladji, M. Markowitz, and M. Tsuji Function of NKT cells, potential anti-HIV effector cells, are improved by beginning HAART during acute HIV-1 infection Int. Immunol., August 16, 2007; (2007) dxm055v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
R H Grose, A G Cummins, and F M Thompson Deficiency of invariant natural killer T cells in coeliac disease Gut, June 1, 2007; 56(6): 790 - 795. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wiethe, M. Schiemann, D. Busch, L. Haeberle, M. Kopf, G. Schuler, and M. B. Lutz Interdependency of MHC Class II/Self-Peptide and CD1d/Self-Glycolipid Presentation by TNF-Matured Dendritic Cells for Protection from Autoimmunity J. Immunol., April 15, 2007; 178(8): 4908 - 4916. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Im, N. Tapinos, G.-T. Chae, P. A. Illarionov, G. S. Besra, G. H. DeVries, R. L. Modlin, P. A. Sieling, A. Rambukkana, and S. A. Porcelli Expression of CD1d Molecules by Human Schwann Cells and Potential Interactions with Immunoregulatory Invariant NK T Cells J. Immunol., October 15, 2006; 177(8): 5226 - 5235. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Kent, Y. Chen, S. M. Clemmings, V. Viglietta, N. S. Kenyon, C. Ricordi, B. Hering, and D. A. Hafler Loss of IL-4 Secretion from Human Type 1a Diabetic Pancreatic Draining Lymph Node NKT Cells J. Immunol., October 1, 2005; 175(7): 4458 - 4464. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Minami, Y. Yanagawa, K. Iwabuchi, N. Shinohara, T. Harabayashi, K. Nonomura, and K. Onoe Negative feedback regulation of T helper type 1 (Th1)/Th2 cytokine balance via dendritic cell and natural killer T cell interactions Blood, September 1, 2005; 106(5): 1685 - 1693. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Forestier, A. Molano, J. S. Im, Y. Dutronc, B. Diamond, A. Davidson, P. A. Illarionov, G. S. Besra, and S. A. Porcelli Expansion and Hyperactivity of CD1d-Restricted NKT Cells during the Progression of Systemic Lupus Erythematosus in (New Zealand Black x New Zealand White)F1 Mice J. Immunol., July 15, 2005; 175(2): 763 - 770. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Koller, B. C. Kieseier, S. Jander, and H.-P. Hartung Chronic Inflammatory Demyelinating Polyneuropathy N. Engl. J. Med., March 31, 2005; 352(13): 1343 - 1356. [Full Text] [PDF] |
||||
![]() |
J. Feng, T. Misu, K. Fujihara, S. Sakoda, Y. Nakatsuji, H. Fukaura, S. Kikuchi, K. Tashiro, A. Suzumura, N. Ishii, et al. Ibudilast, a nonselective phosphodiesterase inhibitor, regulates Th1/Th2 balance and NKT cell subset in multiple sclerosis Multiple Sclerosis, October 1, 2004; 10(5): 494 - 498. [Abstract] [PDF] |
||||
![]() |
Y. Nagayama, K. Watanabe, M. Niwa, S. M. McLachlan, and B. Rapoport Schistosoma mansoni and {alpha}-Galactosylceramide: Prophylactic Effect of Th1 Immune Suppression in a Mouse Model of Graves' Hyperthyroidism J. Immunol., August 1, 2004; 173(3): 2167 - 2173. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Roelofs-Haarhuis, X. Wu, and E. Gleichmann Oral Tolerance to Nickel Requires CD4+ Invariant NKT Cells for the Infectious Spread of Tolerance and the Induction of Specific Regulatory T Cells J. Immunol., July 15, 2004; 173(2): 1043 - 1050. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-P. Ho, B. C. Urban, L. Jones, G. S. Ogg, and A. J. McMichael CD4-CD8{alpha}{alpha} Subset of CD1d-Restricted NKT Cells Controls T Cell Expansion J. Immunol., June 15, 2004; 172(12): 7350 - 7358. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Falcone, F. Facciotti, N. Ghidoli, P. Monti, S. Olivieri, L. Zaccagnino, E. Bonifacio, G. Casorati, F. Sanvito, and N. Sarvetnick Up-Regulation of CD1d Expression Restores the Immunoregulatory Function of NKT Cells and Prevents Autoimmune Diabetes in Nonobese Diabetic Mice J. Immunol., May 15, 2004; 172(10): 5908 - 5916. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Sandberg, C. A. Stoddart, F. Brilot, K. A. Jordan, and D. F. Nixon Development of innate CD4+ {alpha}-chain variable gene segment 24 (V{alpha}24) natural killer T cells in the early human fetal thymus is regulated by IL-7 PNAS, May 4, 2004; 101(18): 7058 - 7063. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Illes, M. Shimamura, J. Newcombe, N. Oka, and T. Yamamura Accumulation of V{alpha}7.2-J{alpha}33 invariant T cells in human autoimmune inflammatory lesions in the nervous system Int. Immunol., February 1, 2004; 16(2): 223 - 230. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Im, K. O. A. Yu, P. A. Illarionov, K. P. LeClair, J. R. Storey, M. W. Kennedy, G. S. Besra, and S. A. Porcelli Direct Measurement of Antigen Binding Properties of CD1 Proteins Using Fluorescent Lipid Probes J. Biol. Chem., January 2, 2004; 279(1): 299 - 310. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Esteban, T. Tsoutsman, M. A. Jordan, D. Roach, L. D. Poulton, A. Brooks, O. V. Naidenko, S. Sidobre, D. I. Godfrey, and A. G. Baxter Genetic Control of NKT Cell Numbers Maps to Major Diabetes and Lupus Loci J. Immunol., September 15, 2003; 171(6): 2873 - 2878. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Matsuda, L. Gapin, J. L. Baron, S. Sidobre, D. B. Stetson, M. Mohrs, R. M. Locksley, and M. Kronenberg Mouse V{alpha}14i natural killer T cells are resistant to cytokine polarization in vivo PNAS, July 8, 2003; 100(14): 8395 - 8400. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Araki, T. Kondo, J. E. Gumperz, M. B. Brenner, S. Miyake, and T. Yamamura Th2 bias of CD4+ NKT cells derived from multiple sclerosis in remission Int. Immunol., February 1, 2003; 15(2): 279 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Kieseier, M. C. Dalakas, and H.-P. Hartung Immune mechanisms in chronic inflammatory demyelinating neuropathy Neurology, December 24, 2002; 59(90126): S7 - 12. [Abstract] [Full Text] |
||||
![]() |
J. K. Sandberg, N. M. Fast, E. H. Palacios, G. Fennelly, J. Dobroszycki, P. Palumbo, A. Wiznia, R. M. Grant, N. Bhardwaj, M. G. Rosenberg, et al. Selective Loss of Innate CD4+ V{alpha}24 Natural Killer T Cells in Human Immunodeficiency Virus Infection J. Virol., June 27, 2002; 76(15): 7528 - 7534. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. T. Mars, V. Laloux, K. Goude, S. Desbois, A. Saoudi, L. Van Kaer, H. Lassmann, A. Herbelin, A. Lehuen, and R. S. Liblau Cutting Edge: V{alpha}14-J{alpha}281 NKT Cells Naturally Regulate Experimental Autoimmune Encephalomyelitis in Nonobese Diabetic Mice J. Immunol., June 15, 2002; 168(12): 6007 - 6011. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Gumperz, S. Miyake, T. Yamamura, and M. B. Brenner Functionally Distinct Subsets of CD1d-restricted Natural Killer T Cells Revealed by CD1d Tetramer Staining J. Exp. Med., March 4, 2002; 195(5): 625 - 636. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. T. Lee, K. Benlagha, L. Teyton, and A. Bendelac Distinct Functional Lineages of Human V{alpha}24 Natural Killer T Cells J. Exp. Med., March 4, 2002; 195(5): 637 - 641. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Jahng, I. Maricic, B. Pedersen, N. Burdin, O. Naidenko, M. Kronenberg, Y. Koezuka, and V. Kumar Activation of Natural Killer T Cells Potentiates or Prevents Experimental Autoimmune Encephalomyelitis J. Exp. Med., December 17, 2001; 194(12): 1789 - 1799. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Singh, M. T. Wilson, S. Hong, D. Olivares-Villagomez, C. Du, A. K. Stanic, S. Joyce, S. Sriram, Y. Koezuka, and L. Van Kaer Natural Killer T Cell Activation Protects Mice Against Experimental Autoimmune Encephalomyelitis J. Exp. Med., December 17, 2001; 194(12): 1801 - 1811. [Abstract] [Full Text] [PDF] |
||||
![]() |
D Baeten, N Van Damme, F Van den Bosch, E Kruithof, M De Vos, H Mielants, E M Veys, and F De Keyser Impaired Th1 cytokine production in spondyloarthropathy is restored by anti-TNF{alpha} Ann Rheum Dis, August 1, 2001; 60(8): 750 - 755. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yamazaki, Y. Ohsawa, and H. Yoshie Elevated Proportion of Natural Killer T Cells in Periodontitis Lesions : A Common Feature of Chronic Inflammatory Diseases Am. J. Pathol., April 1, 2001; 158(4): 1391 - 1398. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Pal, T. Tabira, T. Kawano, M. Taniguchi, S. Miyake, and T. Yamamura Costimulation-Dependent Modulation of Experimental Autoimmune Encephalomyelitis by Ligand Stimulation of V{{alpha}}14 NK T Cells J. Immunol., January 1, 2001; 166(1): 662 - 668. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |