The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Illés, Z.
Right arrow Articles by Yamamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Illés, Z.
Right arrow Articles by Yamamura, T.
The Journal of Immunology, 2000, 164: 4375-4381.
Copyright © 2000 by The American Association of Immunologists

Differential Expression of NK T Cell V{alpha}24J{alpha}Q Invariant TCR Chain in the Lesions of Multiple Sclerosis and Chronic Inflammatory Demyelinating Polyneuropathy1

Zsolt Illés2,*, Takayuki Kondo2,*, Jia Newcombe{dagger}, Nobuyuki Oka{ddagger}, Takeshi Tabira* and Takashi Yamamura3,*

* Department of Demyelinating Disease and Aging, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Ogawahigashi, Kodaira, Tokyo, Japan; {dagger} NeuroResource, Institute of Neurology, London, United Kingdom; {ddagger} Department of Neurology, Faculty of Medicine, Kyoto University, Kyoto, Japan; and § Department of Immunology, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Tokyo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human V{alpha}24+ NK T cells are a unique subset of lymphocytes expressing the V{alpha}24J{alpha}Q invariant TCR chain. Because they can rapidly produce large amounts of regulatory cytokines, a reduction of NK T cells may lead to the development of certain autoimmune diseases. Using a single-strand conformation polymorphism method, we demonstrate that a great reduction of V{alpha}24J{alpha}Q NK T cells in the peripheral blood is an immunological hallmark of multiple sclerosis, whereas it is not appreciable in other autoimmune/inflammatory diseases such as chronic inflammatory demyelinating polyneuropathy. The chronic inflammatory demyelinating polyneuropathy lesions were often found to be infiltrated with V{alpha}24J{alpha}Q NK T cells, but multiple sclerosis lesions only rarely expressed the V{alpha}24J{alpha}Q TCR. It is therefore possible that the extent of NK T cell alteration may be a critical factor which would define the clinical and pathological features of autoimmune disease. Although the mechanism underlying the NK T cell deletion remains largely unclear, a remarkable contrast between the CNS and peripheral nervous system diseases allows us to speculate a role of tissue-specific elements such as the level of CD1d expression or differences in the CD1d-bound glycolipid.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Natural killer T cells are a unique lymphocyte population characterized by the expression of markers common to NK cells and the canonical V{alpha}-J{alpha} TCR rearrangement (1, 2, 3, 4, 5, 6). Although expression of the V{alpha}14J{alpha}281 canonical sequence characterizes rodent NK T cells (1, 2), human NK T cells express a V{alpha}24J{alpha}Q invariant chain which is highly homologous to the murine V{alpha}14J{alpha}281 sequence (3, 4, 5, 6). Unlike conventional {alpha}ß T cells, both rodent and human NK T cells are restricted by the CD1d molecule and can be triggered by a CD1d-restricted glycolipid ligand (7, 8, 9). NK T cells can produce large amounts of IL-4 and IFN-{gamma} within hours of TCR engagement (1, 2, 10, 11, 12), and the potential to produce IL-4 suggests their regulatory role in polarizing unprimed T cells toward a Th2 population. Although a requirement of NK T cells for a Th2 immune response is not absolute (13, 14), accumulating evidence supports the role of NK T cells in the regulation of autoimmune diseases (15, 16, 17, 18, 19, 20).

It has recently been reported that NK T cells may be numerically or functionally altered in certain autoimmune diseases. A decreased number of NK T cells was demonstrated in human systemic sclerosis (15), insulin-dependent diabetes mellitus (16), and spontaneous autoimmune diseases in rodents (17, 18, 19). However, it is difficult to assess the role of NK T cells in some studies because the kinetics of the NK T cell reduction was not studied and because the status of NK T cells in disease controls was not examined with the same assay. Moreover, none of the studies have addressed whether NK T cells may participate in the local regulation of autoimmune diseases.

We initiated this study to clarify whether a reduction of V{alpha}24J{alpha}Q NK T cells in the periphery may be seen in the relapsing/remitting type of multiple sclerosis (MS).4 To detect the presence of NK T cells, we used a novel method relying on single-strand conformation polymorphism (SSCP) of TCR nucleotide chains (21, 22, 23). This is a simple and powerful method to examine the presence of a particular TCR rearrangement in any sample that allows detection of TCR genes. In this study, we amplified the V{alpha}24 TCR products in various samples by PCR, displayed these PCR products on a SSCP gel after denaturation, and then visualized the presence of the V{alpha}24J{alpha}Q invariant chain of NK T cells using the specific probe. Utilizing the SSCP method, we were able to monitor the presence of the V{alpha}24J{alpha}Q invariant chain along with the overall profile of V{alpha}24+ T cell clonotypes.

First, we obtained evidence that V{alpha}24J{alpha}Q NK T cells are greatly reduced in the peripheral blood of MS, particularly during clinical remission. Interestingly, the NK T cell reduction was not appreciable in control autoimmune/inflammatory diseases affecting muscles or peripheral nerves, including chronic inflammatory demyelinating polyneuropathy (CIDP) (24, 25, 26, 27). CIDP is pathologically characterized by T cell infiltration with macrophage activation and up-regulation of MHC class II expression within the peripheral nervous system (PNS) (25), reminiscent of MS. We further explored whether V{alpha}24J{alpha}Q NK T cells are engaged in the local pathology of MS, CIDP, or control diseases. The invariant V{alpha}24J{alpha}Q TCR was not detected in the control CNS or PNS samples and could be seen only rarely in the CNS plaques of autopsied MS patients. In contrast, the invariant TCR was detected in 6 of 10 biopsy lesions from CIDP. Based on the collective data, we postulate that although V{alpha}24J{alpha}Q NK T cells may not efficiently regulate MS because of their deficiency in vivo, they may play a role in the local regulation of CIDP.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Subjects and samples

All of the MS patients fulfilled the diagnostic criteria for definite MS (28), and results of magnetic resonance imaging further assisted the diagnosis. No medication had been given to the patients for 3 mo before blood and/or cerebrospinal fluid (CSF) samples were obtained. In this study, we operationally defined "MS in remission" as those who have been clinically stable for more than 3 mo, and "MS in relapse" as those who have recently developed an apparent exacerbation. In the "relapse" patients, blood samples were obtained within 1 wk after the onset of exacerbation. Diagnosis of CIDP was based on the criteria of the American Academy of Neurology (24), and biopsy samples of sural nerves were obtained with a standard procedure (29). PBMC were isolated on a Ficoll density gradient. Autopsy samples of CNS tissues as well as the biopsy samples of sural nerves were snap-frozen and stored at -70°C until use. The histopathological characterization of the MS plaques was performed as described previously (30).

PCR and SSCP analysis

SSCP clonotype analysis (21, 22, 23) was applied to identify the V{alpha}24J{alpha}Q TCR chain among PCR-amplified V{alpha}24+ clonotypes. In brief, mRNA was isolated from PBMC, CSF, CNS, or peripheral nerve samples with a QuickPrep Micro mRNA purification kit (Pharmacia Biotech, Uppsala, Sweden) and converted to cDNA by using a first-strand cDNA synthesis kit (Pharmacia Biotech). One microliter of the diluted cDNA reaction was then mixed with a V{alpha}24-specific sense primer (ACACAAAGTCGAACGGAAG) and a C{alpha}-antisense primer (GATTTAGAGTCTCTCAGCTG) (30 pmol for each). PCR was performed in 50-µl reactions containing 5 µl of 10x ExTaqBuffer (Takara, Tokyo, Japan), 4 µl of dNTPs, and 2.5 U of ExTaq DNA polymerase in a thermal cycler 480 (Takara). Although PBMC samples were amplified for 35 cycles, CSF, CNS, and PNS samples were amplified for 38 cycles (30 s at 94°C, 30 s at 60°C, and 1 min at 72°C). The PCR products were diluted in a denaturing solution (95% formamide/10 mM EDTA/0.1% bromophenol blue/0.1% xylencyanol) and incubated at 90°C for heat denaturation. The samples were then loaded onto a nondenaturing 4% polyacrylamide gel containing 10% glycerol. After electrophoresis, the DNA was transferred to Pall Biodyne nylon membranes (Pall Biosupport, Port Washington, NY) and hybridized either with a biotinylated C{alpha}-specific internal probe (AAATATCCAGAACCCTGACCCTGCCGTGTACC) or with a biotinylated probe for the invariant V{alpha}24J{alpha}Q sequence (TGTGTGGTGAGCGACAGAGGCTCAACCCTG). The DNA was visualized by subsequent incubation with a chemiluminescent substrate system (Phototope Star detection kit; New England Biolabs, Beverly, MA). GAPDH was used as an internal control for all PCR reactions (GAPDH primer set; Stratagene, La Jolla, CA). Under the same conditions, cDNAs for human CD1d, IL-4, and IFN-{gamma} were amplified by PCR with a set of primers: CD1d forward, GGTTTATCGAAGCAGCTTCAC and CD1d reverse, CACTTGAATGGCCAAGTTTAC; IL-4 forward, ACTGCAAATCGACACCTATTA and IL-4 reverse, ATGGTGGCTGTAGAACTGC; and IFN-{gamma} forward, ATGTAGCGGATAATGGAACTC and IFN-{gamma} reverse, AACTTGACATTCATGTCTTCC.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Detection of the invariant V{alpha}24J{alpha}Q sequence in peripheral blood of healthy subjects

First, we examined PBMC samples obtained from healthy subjects (HS). After PCR amplification with a set of the V{alpha}24 and C{alpha} primers, the amplified products were electrophoresed on the SSCP gel and hybridized with the biotinylated C{alpha} probe. All of these samples demonstrated multiple bands on a smear background or a dense smear without appreciable bands, showing clonal heterogeneity of the V{alpha}24+ T cells (Fig. 1GoA, upper panel). Of note, these samples appeared to share identical SSCP clonotypes as they electrophoresed at the same positions. After removing the C{alpha} probe, the membrane was hybridized with the biotinylated probe specific for the invariant V{alpha}24J{alpha}Q TCR. One of the bands shared in all the samples apparently hybridized with this probe (Fig. 1GoA, lower panel; Table IGo), showing the presence for the V{alpha}24J{alpha}Q TCR. Furthermore, by sequencing the TCR products eluted from corresponding areas of gels as reported previously (23), we confirmed that they would correspond to the invariant V{alpha}24J{alpha}Q TCR, a marker of human NK T cells (data not shown).



View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 1. Demonstration of the V{alpha}24+ TCR rearrangement and the invariant V{alpha}24J{alpha}Q TCR in PBMC. PBMC samples from HS (A), MS in remission (B), and MS in relapse (C) were examined with the SSCP technique described in Materials and Methods. The SSCP profiles of the total V{alpha}24+ TCR products are shown in the upper panels, whereas the same SSCP samples hybridized with the biotinylated probe for the V{alpha}24J{alpha}Q TCR are demonstrated in the lower panels. Arrows indicate the position for the invariant TCR. Results of representative experiments are shown here. See also Table IGo summarizing the pooled data. A, Analysis of HS. Fourteen PBMC samples from 12 HS were examined in this experiment. The numerical code shown in the middle corresponds to each subject, implying that blood samples were taken from subjects 9 and 10 at two different time points. B, Analysis of MS in remission. Fifteen PBMC samples from 12 MS patients in remission were examined in this experiment. The numerical code shown in the middle corresponds to each patient, implying that blood samples were taken from patients 1, 2, and 4 at two different time points in remission. HS indicates a lane for a PBMC sample from HS, illustrating the position of the invariant V{alpha}24J{alpha}Q band. C, Analysis of MS in relapse. Here, we examined 18 PBMC samples from 10 MS patients in relapse. The numerical code corresponds to each patient (the same codes are used in B and C). The relapse samples were obtained twice from patients 13, 14, 15, and 17, and four times from patient 2. HS indicates a PBMC sample from HS to illustrate the position of the invariant V{alpha}24J{alpha}Q band.

 

View this table:
[in this window]
[in a new window]
 
Table I. Detection frequency of the V{alpha}24+TCR and the invariant V{alpha}24J{alpha} Q in blood and CSF samples

This table summarizes the results of all of the SSCP experiments for PBMC and CSF (see also Figs. 1Go and 2Go).

 
Analysis of the invariant V{alpha}24J{alpha}Q chain in MS patients in remission vs relapse

Using the PBMC samples from HS as positive control, we studied PBMC samples from MS patients in remission. The amplified V{alpha}24+ TCR products (Fig. 1GoB, upper panel) tended to show more limited numbers of bands and/or lesser degrees of smear density on SSCP gels as compared with HS. Unlike the samples from HS, occurrence of oligoclonal expansion was suggested in a proportion of these samples. More remarkably, none of the samples would hybridize with the probe for the invariant V{alpha}24J{alpha}Q (Fig. 1GoB, lower panel; Table IGo). It was of note that not only samples expressing a few bands but those with dense smears (such as those from patient 5, 6, 7, or 10) did not hybridize with the V{alpha}24J{alpha}Q probe. Although the PCR-SSCP analysis is not an absolute frequency measurement, these results indicate a great reduction of V{alpha}24J{alpha}Q NK T cells along with a biased composition of V{alpha}24+ T cells. In parallel, we analyzed PBMC samples obtained from MS patients in relapse. Although the invariant V{alpha}24J{alpha}Q was absent in the remission samples, 7 of the 26 relapse samples expressed the invariant TCR (Fig. 1GoC). This indicates that V{alpha}24J{alpha}Q NK T cells could sometimes be repopulated during relapse. Of note, a long-term follow-up of one patient (patient 2) suggested the probable association between the NK T cell repopulation and clinical relapse (Table IIGo): although the invariant V{alpha}24J{alpha}Q chain was absent in the two samples obtained during remission, three of the four relapse samples expressed the invariant chain. In addition, repopulation of NK T cells was suggested in one of the two relapses in patient 13 (Table IIGo). We also examined PBMC samples of other neurological diseases (ONDs, Table IGo), including 7 with noninflammatory CNS diseases, 11 with immune-mediated PNS or muscle diseases (including 6 with CIDP), and 2 noninflammatory PNS diseases (details described in the footnotes to Table IGo). Except for two samples from the noninflammatory CNS diseases (Parkinson disease and hereditary ataxia), the PBMC samples of the ONDs were all positive for the invariant TCR. The presence of the invariant TCR in the immune-mediated diseases such as CIDP and polymyositis indicates that a great reduction in NK T cells is not a general feature of immunological/inflammatory diseases.


View this table:
[in this window]
[in a new window]
 
Table II. Temporal profiles for the appearance of V{alpha}24J{alpha}Q TCR in the PBMC and CSF

 
Appearance of NK T cells in CSF

To know whether NK T cells may participate in the local regulation for the immunopathology of MS, we next examined the presence of the invariant V{alpha}24J{alpha}Q TCR in CSF samples obtained from MS patients in relapse (Fig. 2Go). Although the V{alpha}24+ SSCP profiles were variable, the majority of these samples were characterized by a limited number (1~10) of bands without background smear. The invariant V{alpha}24J{alpha}Q chain was detected in 11 of the 24 samples (Table IGo) and this TCR chain was usually a predominant one among the detectable clonotypes. We were able to directly compare five blood-CSF pairs from MS (marked with asterisk in Table IIGo). The pairs from patients 1 and 20 revealed the presence of the invariant TCR in CSF but not in blood, whereas the other three pairs were both positive for the invariant TCR (patient 2) or both negative (patient 13 and 17). The invariant TCR was seen only in one of nine CSF samples from ONDs (Table IGo). These results indicate that NK T cells would sometimes (but not consistently) appear in the CSF of some MS patients, possibly owing to local clonal expansion.



View larger version (78K):
[in this window]
[in a new window]
 
FIGURE 2. Demonstration of the V{alpha}24+ TCR rearrangement and the invariant V{alpha}24J{alpha}Q TCR in CSF of MS. CSF samples were collected from MS patients in relapse and processed for SSCP analysis. The upper and lower panels show the total V{alpha}24+ SSCP profiles and the invariant V{alpha}24J{alpha}Q band, respectively. The arrows indicate the position for the invariant V{alpha}24J{alpha}Q band. Each numerical or small letter code corresponds to each patient. The numerical codes (1, 2, 13, 17, and 20) indicate the MS patients from whom PBMC samples could be also obtained at the same time or at different times. The same numerical codes are used in Fig. 1Go, B and C, here, and Table IIGo. The small letter codes (a–r) indicate the patients in whom only CSF samples could be examined.

 
Analysis of CNS and PNS lesions

We next examined MS plaques (11 acute, 6 subacute, and 8 chronic plaques) from 10 autopsied cases, 6 CNS samples from 3 OND patients, and 6 from 6 non-neurological disease (NND) (Table IIIGo). V{alpha}24 TCR messages were detected in 15 of the 25 MS plaques, showing no particular preference for acute, subacute, or chronic plaques. The invariant V{alpha}24J{alpha}Q TCR was found only in 1 subacute lesion of the 15 V{alpha}24+TCR-expressing plaques (Fig. 3Go). Three of the six OND samples expressed V{alpha}24+ TCR, but the invariant V{alpha}24J{alpha}Q chain could not be detected in these samples. The NND samples did not express any V{alpha}24+ TCR chain. Furthermore, the V{alpha}24J{alpha}Q-expressing plaque and four randomly chosen MS plaques were examined for the presence of IFN-{gamma} and IL-4 mRNA. The V{alpha}24J{alpha}Q-expressing plaque did not express IFN-{gamma} mRNA, whereas the other plaques were all positive for IFN-{gamma} (Table IVGo, MS plaques). IL-4 was not detected in any of the CNS lesions.


View this table:
[in this window]
[in a new window]
 
Table III. Detection frequency of the V{alpha}24+ TCR and the invariant V{alpha}24J{alpha}Q in the CNS and PNS lesions

This table summarizes the results of all of the SSCP experiments for autopsy samples of the CNS and biopsy samples of PNS.

 


View larger version (64K):
[in this window]
[in a new window]
 
FIGURE 3. Demonstration of the V{alpha}24+ TCR rearrangement and the invariant V{alpha}24J{alpha}Q TCR in CNS lesions of MS patients. Here, we show the SSCP profiles of autopsy tissues from which Va24 TCR messages could be PCR amplified. Each lesion is represented by a combination of patient code (number) and alphabet (except for lesion 4). Except for spinal cord lesion 5b, all of the samples were derived from brains. The samples include acute lesions (1b, 2a, 2b, 3a, 3b, 4, 6a, and 7c), chronic lesions (1a and 7b), chronic active lesions (6b), and subacute lesions (5a and 7a). Note that a subacute lesion 7a expresses two bands hybridizing with the V{alpha}24J{alpha}Q probe. One of these is located at the position for the invariant V{alpha}24J{alpha}Q. The arrows indicate the position for the invariant V{alpha}24J{alpha}Q band.

 

View this table:
[in this window]
[in a new window]
 
Table IV. Presence of the V{alpha}24J{alpha}Q TCR message and cytokine expression

 
We further examined the biopsy samples of CIDP for comparison. In contrast to the MS lesions where the invariant TCR was only rarely detected, 6 of the 10 CIDP samples definitively expressed the invariant V{alpha}24J{alpha}Q (Fig. 4Go; Table IVGo, CIDP biopsy samples). Although IL-4 mRNA was not detected in the MS lesions, this cytokine message was detected in all of the CIDP lesions (Fig. 5Go; Table IVGo, CIPD biopsy samples). By contrast, expression of IFN-{gamma} mRNA appeared to be less consistent in CIDP than MS. Of note, none of the OND nerve samples expressed the invariant V{alpha}24J{alpha}Q, and IL-4 was detected less frequently in the OND as compared with CIDP (Table IVGo, OND biopsy samples). These results indicate that MS, CIDP, and the OND lesions are different in the cytokine milieu as well as in the local frequency of NK T cells. However, because the origins of cytokines were not determined in this study, it remains to be established whether the local IL-4 expression in the PNS lesions may reflect the local presence of V{alpha}24J{alpha}Q NK T cells.



View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 4. Demonstration of the V{alpha}24+ TCR rearrangement and the invariant V{alpha}24J{alpha}Q TCR in biopsied peripheral nerves. In this experiment, 10 sural nerve samples from CIDP patients (A) and 4 from ONDs (B) were examined on the same SSCP gel. The same patient codes are used in this figure and Table IVGo. The arrows indicate the position for the invariant V{alpha}24J{alpha}Q band.

 


View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 5. Expression of IFN-{gamma} and IL-4 in biopsied peripheral nerves from CIDP. GAPDH, IFN-{gamma}, and IL-4 messages were PCR amplified from nine biopsy samples from CIDP. A representative experiment of three is shown. GAPDH and IL-4 were detected in all of the samples, whereas expression of IFN-{gamma} was seen in six of nine samples.

 
Finally, we examined CD1d expression in the CNS and PNS samples with PCR. Examination revealed that 18 of 25 MS lesions (72.0%) and 6 of 7 NND tissues (85.7%) expressed CD1d mRNA, regardless of the pathological classification. In contrast, CD1d mRNA was found less frequently in the PNS samples (detected in 2 of 9 CIDP lesions (22.2%) and 1 of 4 other PNS diseases (25.0%)). It is possible that the turnover of CD1d molecule in the CNS may be more rapid than in the PNS.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MS is thought to be an autoimmune disease mediated by Th1 T cells specific for CNS autoantigens (31, 32). Since numerical or functional defects of NK T cells were reported in systemic as well as organ-specific autoimmune diseases (15, 16, 17, 18, 19), it was of particular interest to investigate the status of NK T cells in MS. In this study, we used the SSCP method (21, 22, 23) to identify and monitor the presence of the invariant V{alpha}24J{alpha}Q TCR. The previous studies (15, 16) evaluated the frequency of the V{alpha}24J{alpha}Q NK T cells by isolating CD4-CD8- T cells by flow cytometry and cloning V{alpha}24+ TCR. Because it is a laborious procedure, only a limited number of patient PBMC samples (four systemic sclerosis and nine insulin-dependent diabetes mellitus) were examined. In contrast, the SSCP method enables us to monitor the V{alpha}24J{alpha}Q TCR along with the overall V{alpha}24 repertoire and to handle a large number of samples from a variety of sources, including a minute volume of frozen sample. In this study, we examined PBMC, CSF, and inflammatory tissues obtained from MS and control diseases including CIDP. As shown in Fig. 1GoA, the V{alpha}24J{alpha}Q probe always detected the invariant TCR as a dominant band. Although one or two additional bands were faintly detected in some samples, there was no difficulty in identifying the major band for the invariant TCR in a given sample by setting a positive control of HS PBMC. We conceive that the additional bands most probably represent the invariant V{alpha}24J{alpha}Q TCR with an alternative conformation (21, 22) because they would migrate to the same positions (Fig. 1GoA). A possibility for the V{alpha}24J{alpha}Q probe degeneracy was not a major concern, because of the limited number of bands.

The first remarkable observation was that all of the PBMC samples of MS in remission and three-quarters of the samples in relapse did not express the V{alpha}24J{alpha}Q rearrangement (Table IGo). In contrast, all of the samples from HS and 90% of the OND samples expressed the invariant TCR. The striking difference between MS and control groups implies that V{alpha}24J{alpha}Q NK T cells are greatly reduced in MS. It was possible that the reduction of V{alpha}24J{alpha}Q NK T cells in the periphery might be due to recruitment of a large number of the cells into the site of pathology. However, the detection frequency of NK T cells in the CSF and CNS samples (Tables 1 and 3) was lower than the frequency of the PBMC samples of MS in which NK T cells are greatly reduced. Furthermore, examination of PBMC-CSF pairs (Table IIGo) showed that the absence of V{alpha}24J{alpha}Q TCR in the PBMC is not necessarily associated with its presence in the CSF. These results do not support the idea that peripheral reduction of NK T cells may be secondary to massive recruitment of the cells into the CNS.

Studies of mice (33, 34) indicate a role of IL-12 and TCR ligand in causing the apoptotic deletion of NK T cells in vivo. However, the reduction of NK T cells in MS was more pronounced in remission than relapse, excluding a correlation of IL-12 elevation and NK T cell reduction. Although some cytokines could be involved, it is likely that an additional molecule differentially expressed in MS and CIDP may play a key role in the selective reduction of NK T cells in MS. We would speculate that the differentially displayed molecule may be a TCR ligand (possibly glycolipid/CD1d) that could specifically delete NK T cells.

On the other hand, we also demonstrated that the greatly reduced V{alpha}24J{alpha}Q NK T cells could appear again in the course of MS. A most convincing evidence was obtained after a 2-year follow-up of patient 2 (Table IIGo), revealing that NK T cells could probably repopulate during clinical exacerbation. It is currently recognized that NK T cells are relatively resistant to glucocorticoid-induced apoptosis as compared with conventional T cells (35). It was, therefore, arguable that production of endogenous glucocorticoids during clinical exacerbation may trigger the expansion of NK T cells by altering a balance between conventional T cells and NK T cells. However, this is unlikely since the repopulation of V{alpha}24J{alpha}Q NK T cells was accompanied by the reappearance of other V{alpha}24+ clones (see the relapse samples from patient 2 in Fig. 1GoC). It is reported in mice that once deleted, NK T cells in liver and spleen could rapidly repopulate via regeneration of the NK T cells in bone marrow (33). If this observation can be extrapolated to humans, the NK T cell repopulation seen in MS may be explained by disruption of death signals and/or induction of survival (growth) factors that might occur in association with clinical relapse.

Most notably, we demonstrate the presence of V{alpha}24J{alpha}Q NK T cells in the autoimmune inflammatory lesions of CIDP. To our knowledge, this is the first definitive proof for the local engagement of V{alpha}24J{alpha}Q NK T cells. In contrast to CIDP, the invariant TCR was only rarely detected in MS lesions (Fig. 3Go and Table IIIGo). This intriguing contrast can probably be based on the difference in the total number of NK T cells in vivo. However, differences in the local environment for the survival of NK T cells may also underlie the immunopathological differences between MS and CIDP.

At this moment, the role of the locally infiltrated NK T cells in CIDP or MS is not clear. Because both murine and human NK T cells have the potential to produce a large amount of IFN-{gamma} and IL-4 (1, 2, 10, 11, 12), it is possible that the Th1 cell-mediated CNS or PNS inflammation may be up- or down-regulated by either IFN-{gamma} or IL-4 locally produced by NK T cells. To obtain some insight, we evaluated expression of the cytokine messages in the CNS and PNS samples (Table IVGo). The results revealed significant differences in the cytokine milieu among the CNS and PNS diseases. To know whether the NK T cell infiltration may account for the differential expression of the cytokines, we need to perform cytokine analysis on a single-cell basis in the future.

In summary, we demonstrate that a great reduction of V{alpha}24J{alpha}Q NK T cells in the peripheral blood is an immunological hallmark of MS, whereas it is not appreciable in CIDP. The CIDP lesions were found to be often infiltrated with V{alpha}24J{alpha}Q NK T cells, but MS lesions only rarely expressed the V{alpha}24J{alpha}Q TCR. It is therefore possible that the extent of NK T cell alteration may be a critical factor which would define the clinical and pathological features of the autoimmune diseases. Finally, although the mechanism underlying the NK T cell deletion remains largely unclear, a remarkable contrast between the CNS and PNS diseases allows us to speculate a role of tissue-specific elements such as the level of CD1d expression or differences in the CD1d-bound glycolipid. Namely, it is possible that interaction of NK T cells with the CNS APC strongly expressing CD1d or recognition of CD1d-associated ligand restricted to the CNS by NK T cells may lead to deletion of NK T cells via TCR engagement. This postulate could be verified in the future by analyzing the alteration of NK T cells in a wider range of tissue-specific autoimmune diseases.


    Acknowledgments
 
We thank Dr. T. Makifuchi (Brain Research Institute, Niigata University), Nigata, Japan for providing CNS samples from ONDs, Dr. H. Hara (Kyushu University), Dr. H. Shigeto (Musashi Hospital, National Center of Neurology and Psychiatry), and Dr. M. Hayashi (Otsu Municipal Hospital) for blood and CSF samples. We also thank Dr. Sachiko Miyake for critical reading of this manuscript.


    Footnotes
 
1 This work was supported by a Research on Brain Science grant and the research grant for Nervous and Mental Disorders from the Ministry of Health and Welfare of Japan. Back

2 Z.I. and T.K. have contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Takashi Yamamura, Department of Immunology, National Institute of Neuroscience, National Center of Neurology and Psychiatry, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187-8502, Japan. E-mail address: Back

4 Abbreviations used in this paper: MS, multiple sclerosis; CIDP, chronic inflammatory demyelinating polyneuropathy; CSF, cerebrospinal fluid; HS, healthy subject; NND, non-neurological disease; OND, other neurological disease; PNS, peripheral nervous system; SSCP, single-strand conformation polymorphism. Back

Received for publication October 12, 1999. Accepted for publication February 2, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bendelac, A., M. N. Rivera, S. Park, J. H. Roark. 1997. Mouse CD1-specific NK1 T cells: development, specificity and function. Annu. Rev. Immunol. 15:535.[Medline]
  2. Bix, M., R. M. Locksley. 1995. Natural T cells: cells that co-express NKRP-1 and TCR. J. Immunol. 155:1020.[Medline]
  3. Porcelli, S., C. E. Yockey, M. B. Brenner, S. P. Balk. 1993. Analysis of T cell antigen receptor (TCR) expression by human peripheral blood CD4-8- {alpha}/ß T cells demonstrates preferential use of several Vß genes and an invariant TCR {alpha} chain. J. Exp. Med. 178:1.[Abstract/Free Full Text]
  4. Dellabona, P., E. Padovan, G. Casorati, M. Brockhaus, A. Lanzavecchia. 1994. An invariant V{alpha}24-J{alpha}Q/Vß11 T cell receptor is expressed in all individuals by clonally expanded CD4-8- T cells. J. Exp. Med. 180:1171.[Abstract/Free Full Text]
  5. Exley, M., J. Garcia, S. P. Balk, S. Porcelli. 1997. Requirements for CD1d recognition by human invariant V{alpha}24+ CD4-CD8- T cells. J. Exp. Med. 186:109.[Abstract/Free Full Text]
  6. Prussin, C., B. Foster. 1998. TCR V{alpha}24 and Vß11 coexpression defines a human NK1 T cell analog containing a unique Th0 subpopulation. J. Immunol. 159:5862.[Abstract]
  7. Kawano, T., J. Cui, Y. Koezuka, I. Toura, Y. Kaneko, K. Motoki, H. Ueno, R. Nakagawa, H. Sato, E. Kondo, et al 1997. CD1d-restricted and TCR-mediated activation of V{alpha}14 NK T cells by glycosylceramides. Science 278:1626.[Abstract/Free Full Text]
  8. Spada, F. M., Y. Koezuka, S. A. Porcelli. 1998. CD1d-restricted recognition of synthetic glycolipid antigens by human natural killer T cells. J. Exp. Med. 188:1529.[Abstract/Free Full Text]
  9. Brossay, L., M. Chioda, N. Burdin, Y. Koezuka, G. Casorati, P. Dellabona, M. Kronenberg. 1998. CD1d-mediated recognition of an {alpha}-galactosylceramide by natural killer T cells is highly conserved through mammalian evolution. J. Exp. Med. 188:1521.[Abstract/Free Full Text]
  10. Yoshimoto, T., W. E. Paul. 1994. CD4pos, NK1.1pos T cells promptly produce interleukin 4 in response to in vivo challenge with anti-CD3. J. Exp. Med. 179:1285.[Abstract/Free Full Text]
  11. Arase, H., N. Arase, T. Saito. 1996. Interferon-{gamma} production by natural killer (NK) cells and NK1.1+ T cells upon NKR-P1 cross-linking. J. Exp. Med. 183:2391.[Abstract/Free Full Text]
  12. Chen, H., W. E. Paul. 1997. Cultured NK1.1+ CD4+ T cells produce large amounts of IL- 4 and IFN-{gamma} upon activation by anti-CD3 or CD1. J. Immunol. 159:2240.[Abstract/Free Full Text]
  13. Smiley, S. T., M. H. Kaplan, M. J. Grusby. 1997. Immunoglobulin E production in the absence of interleukin-4-secreting CD1-dependent cells. Science 275:977.[Abstract/Free Full Text]
  14. Mendiratta, S. J., W. D. Martin, S. Hong, A. Boesteanu, S. Joyce, L. van Kaer. 1997. CD1d mutant mice are deficient in natural T cells that promptly produce IL-4. Immunity 6:469.[Medline]
  15. Sumida, T., A. Sakamoto, H. Murata, Y. Makino, H. Takahashi, S. Yoshida, K. Nishioka, I. Iwamoto, M. Taniguchi. 1995. Selective reduction of T cells bearing invariant V{alpha}24J{alpha}Q antigen receptor in patients with systemic sclerosis. J. Exp. Med. 182:1163.[Abstract/Free Full Text]
  16. Wilson, S. B., S. C. Kent, K. T. Patton, T. Orban, R. A. Jackson, M. Exley, S. Porcelli, D. A. Schatz, M. A. Atkinson, S. P. Balk, et al 1998. Extreme Th1 bias of invariant V{alpha}24J{alpha}Q T cells in type 1 diabetes. Nature 391:177.[Medline]
  17. Mieza, M. A., T. Itoh, J. Q. Cui, Y. Makino, T. Kawano, K. Tsuchida, T. Koike, T. Shirai, H. Yagita, A. Matsuzawa, et al 1996. Selective reduction of V{alpha}14+ NK T cells associated with disease development in autoimmune-prone mice. J. Immunol. 156:4035.[Abstract]
  18. Takeda, K., G. Dennert. 1993. The development of autoimmunity in C57BL/6 lpr mice correlates with the disappearance of natural killer type 1-positive cells: evidence for their suppressive action on bone marrow stem cell proliferation, B cell immunoglobulin secretion, and autoimmune symptoms. J. Exp. Med. 177:155.[Abstract/Free Full Text]
  19. Baxter, A. G., S. J. Kinder, K. J. Hammond, R. Scollay, D. I. Godfrey. 1997. Association between {alpha}ß TCR+CD4-CD8- T-cell deficiency and IDDM in NOD/Lt mice. Diabetes 46:572.[Abstract]
  20. Hammond, K. J. L., L. D. Poulton, L. J. Palmisano, P. A. Silveira, D. I. Godfrey, A. G. Baxter. 1998. {alpha}/ß-T cell receptor (TCR)+CD4-CD8- (NK T) thymocytes prevent insulin-dependent diabetes mellitus in nonobese diabetic (NOD)/Lt mice by the influence of interleukin (IL)-4 and/or IL-10. J. Exp. Med. 187:1047.[Abstract/Free Full Text]
  21. Yamamoto, K., K. Masuko-Hongo, A. Tanaka, M. Kurokawa, T. Hoeger, K. Nishioka, T. Kato. 1996. Establishment and application of a novel T cell clonality analysis using single-strand conformation polymorphism of T cell receptor messenger signals. Hum. Immunol. 48:23.[Medline]
  22. Andrews, D. M., C. P. Leary, M. Hishii, J. Shen, T. Kurnick. 1998. Use of single stranded conformational polymorphism (SSCP) for analysis of the T cell receptor. J. R. Oksenberg, ed. The Antigen T Cell Receptor: Selected Protocols and Applications 373. Chapman & Hall, New York.
  23. Illés, Z., T. Kondo, K. Yokoyama, T. Ohashi, T. Tabira, T. Yamamura. 1999. Identification of autoimmune T cells among in vivo expanded CD25+ T cells in multiple sclerosis. J. Immunol. 162:1811.[Abstract/Free Full Text]
  24. Ad Hoc Subcommittee of the American Academy of Neurology AIDS Task Force. 1991. Research criteria for diagnosis of chronic inflammatory demyelinating polyneuropathy (CIDP). Neurology 41:617.
  25. Rizzuto, N., M. Morbin, T. Cavallaro, S. Ferrari, M. Fallahi, S. Galiazzo Rizzuto. 1998. Focal lesions are feature of chronic inflammatory demyelinating polyneuropathy (CIDP). Acta Neuropathol. 96:603.[Medline]
  26. Good, J. L., M. Chehrenama, R. F. Mayer, C. L. Koski. 1998. Pulse cyclophosphamide therapy in chronic inflammatory demyelinating polyneuropathy. Neurology 51:1735.[Abstract/Free Full Text]
  27. Hahn, A. F.. 1998. Treatment of chronic inflammatory demyelinating polyneuropathy with intravenous immunoglobulin. Neurology 51:(Suppl. 5):S16.[Abstract/Free Full Text]
  28. Poser, C. M., D. W. Paty, L. Scheinberg, W. I. MacDonald, F. A. Davis, G. C. Ebers, K. P. Johnson, W. A. Sibley, D. H. Silberberg, W. W. Tourtellotte. 1983. New diagnostic criteria for multiple sclerosis: guidelines for research protocols. Ann. Neurol. 13:227.[Medline]
  29. P. J. Dyck, and P. K. Thomas, and J. W. Griffin, eds. Peripheral Neuropathy 3rd Ed.1993 Saunders, Philadelphia.
  30. Li, H., J. Newcombe, N. Groome, M. L. Cuzner. 1993. Characterization and distribution of phagocytic macrophages in multiple sclerosis plaques. Neuropathol. Appl. Neurobiol. 19:214.[Medline]
  31. Martin, R., H. F. McFarland, D. E. McFarlin. 1992. Immunological aspects of demyelinating diseases. Annu. Rev. Immunol. 10:153.[Medline]
  32. Tuohy, V. K., M. Yu, L. Yin, J. A. Kawczak, J. M. Johnson, P. M. Mathisen, B. Weinstock- Guttman, R. P. Kinkel. 1998. The epitope spreading cascade during progression of experimental autoimmune encephalomyelitis and multiple sclerosis. Immunol. Rev. 164:93.[Medline]
  33. Ebert, G., H. R. MacDonald. 1998. Rapid death and regeneration of NK T cells in anti- CD3{epsilon}- or IL-12-treated mice: a major role for bone marrow in NK T cell homeostasis. Immunity 9:345.[Medline]
  34. Emoto, M., Y. Emoto, S. H. Kaufmann. 1997. Bacille Calmette Guerin and interleukin-12 down-modulate interleukin-4-producing CD4+NK1+ T lymphocytes. Eur. J. Immunol. 27:183.[Medline]
  35. Tamada, K., M. Harada, K. Abe, T. Li, K. Nomoto. 1998. IL-4-producing NK1.1+ T cells are resistant to glucocorticoid-induced apoptosis: implications for the Th1/Th2 balance. J. Immunol. 161:1239.[Abstract/Free Full Text]
  36. Rowland, L. P., ed. Merritt’s Textbook of Neurology, 9th Ed. 1995. Williams & Wilkins, Baltimore.



This article has been cited by other articles:


Home page
Mult SclerHome page
M Podbielska and E. Hogan
Molecular and immunogenic features of myelin lipids: incitants or modulators of multiple sclerosis?
Multiple Sclerosis, September 1, 2009; 15(9): 1011 - 1029.
[Abstract] [PDF]


Home page
Therapeutic Advances in Neurological DisordersHome page
H. C. Lehmann, G. Meyer zu Horste, B. C. Kieseier, and H.-P. Hartung
Review: Pathogenesis and treatment of immune-mediated neuropathies
Therapeutic Advances in Neurological Disorders, July 1, 2009; 2(4): 261 - 281.
[Abstract] [PDF]


Home page
Int ImmunolHome page
A. Peterfalvi, E. Gomori, T. Magyarlaki, J. Pal, M. Banati, A. Javorhazy, J. Szekeres-Bartho, L. Szereday, and Z. Illes
Invariant V{alpha}7.2-J{alpha}33 TCR is expressed in human kidney and brain tumors indicating infiltration by mucosal-associated invariant T (MAIT) cells
Int. Immunol., December 1, 2008; 20(12): 1517 - 1525.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
I. Tsunoda, T. Tanaka, and R. S. Fujinami
Regulatory Role of CD1d in Neurotropic Virus Infection
J. Virol., October 15, 2008; 82(20): 10279 - 10289.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Diao, K. Iwabuchi, L. Li, K. Onoe, L. Van Kaer, S. Kon, Y. Saito, J. Morimoto, D. T. Denhardt, S. Rittling, et al.
Osteopontin regulates development and function of invariant natural killer T cells
PNAS, October 14, 2008; 105(41): 15884 - 15889.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. T. Mars, A.-S. Gautron, J. Novak, L. Beaudoin, J. Diana, R. S. Liblau, and A. Lehuen
Invariant NKT Cells Regulate Experimental Autoimmune Encephalomyelitis and Infiltrate the Central Nervous System in a CD1d-Independent Manner
J. Immunol., August 15, 2008; 181(4): 2321 - 2329.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. V. Baev, S. Caielli, F. Ronchi, M. Coccia, F. Facciotti, K. E. Nichols, and M. Falcone
Impaired SLAM-SLAM Homotypic Interaction between Invariant NKT Cells and Dendritic Cells Affects Differentiation of IL-4/IL-10-Secreting NKT2 Cells in Nonobese Diabetic Mice
J. Immunol., July 15, 2008; 181(2): 869 - 877.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Yamaura, C. Hotta, M. Nakazawa, L. Van Kaer, and M. Minami
Human invariant V{alpha}24+ natural killer T cells acquire regulatory functions by interacting with IL-10-treated dendritic cells
Blood, April 15, 2008; 111(8): 4254 - 4263.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Tsukamoto, M. Ohtsuji, W. Shiroiwa, Q. Lin, K. Nakamura, H. Tsurui, Y. Jiang, K. Sudo, H. Nishimura, T. Shirai, et al.
Aberrant Genetic Control of Invariant TCR-Bearing NKT Cell Function in New Zealand Mouse Strains: Possible Involvement in Systemic Lupus Erythematosus Pathogenesis
J. Immunol., April 1, 2008; 180(7): 4530 - 4539.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. Vasan, M. A. Poles, A. Horowitz, E. E. Siladji, M. Markowitz, and M. Tsuji
Function of NKT cells, potential anti-HIV effector cells, are improved by beginning HAART during acute HIV-1 infection
Int. Immunol., August 16, 2007; (2007) dxm055v1.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
R H Grose, A G Cummins, and F M Thompson
Deficiency of invariant natural killer T cells in coeliac disease
Gut, June 1, 2007; 56(6): 790 - 795.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Wiethe, M. Schiemann, D. Busch, L. Haeberle, M. Kopf, G. Schuler, and M. B. Lutz
Interdependency of MHC Class II/Self-Peptide and CD1d/Self-Glycolipid Presentation by TNF-Matured Dendritic Cells for Protection from Autoimmunity
J. Immunol., April 15, 2007; 178(8): 4908 - 4916.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. S. Im, N. Tapinos, G.-T. Chae, P. A. Illarionov, G. S. Besra, G. H. DeVries, R. L. Modlin, P. A. Sieling, A. Rambukkana, and S. A. Porcelli
Expression of CD1d Molecules by Human Schwann Cells and Potential Interactions with Immunoregulatory Invariant NK T Cells
J. Immunol., October 15, 2006; 177(8): 5226 - 5235.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. C. Kent, Y. Chen, S. M. Clemmings, V. Viglietta, N. S. Kenyon, C. Ricordi, B. Hering, and D. A. Hafler
Loss of IL-4 Secretion from Human Type 1a Diabetic Pancreatic Draining Lymph Node NKT Cells
J. Immunol., October 1, 2005; 175(7): 4458 - 4464.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Minami, Y. Yanagawa, K. Iwabuchi, N. Shinohara, T. Harabayashi, K. Nonomura, and K. Onoe
Negative feedback regulation of T helper type 1 (Th1)/Th2 cytokine balance via dendritic cell and natural killer T cell interactions
Blood, September 1, 2005; 106(5): 1685 - 1693.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Forestier, A. Molano, J. S. Im, Y. Dutronc, B. Diamond, A. Davidson, P. A. Illarionov, G. S. Besra, and S. A. Porcelli
Expansion and Hyperactivity of CD1d-Restricted NKT Cells during the Progression of Systemic Lupus Erythematosus in (New Zealand Black x New Zealand White)F1 Mice
J. Immunol., July 15, 2005; 175(2): 763 - 770.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
H. Koller, B. C. Kieseier, S. Jander, and H.-P. Hartung
Chronic Inflammatory Demyelinating Polyneuropathy
N. Engl. J. Med., March 31, 2005; 352(13): 1343 - 1356.
[Full Text] [PDF]


Home page
Mult SclerHome page
J. Feng, T. Misu, K. Fujihara, S. Sakoda, Y. Nakatsuji, H. Fukaura, S. Kikuchi, K. Tashiro, A. Suzumura, N. Ishii, et al.
Ibudilast, a nonselective phosphodiesterase inhibitor, regulates Th1/Th2 balance and NKT cell subset in multiple sclerosis
Multiple Sclerosis, October 1, 2004; 10(5): 494 - 498.
[Abstract] [PDF]


Home page
J. Immunol.Home page
Y. Nagayama, K. Watanabe, M. Niwa, S. M. McLachlan, and B. Rapoport
Schistosoma mansoni and {alpha}-Galactosylceramide: Prophylactic Effect of Th1 Immune Suppression in a Mouse Model of Graves' Hyperthyroidism
J. Immunol., August 1, 2004; 173(3): 2167 - 2173.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Roelofs-Haarhuis, X. Wu, and E. Gleichmann
Oral Tolerance to Nickel Requires CD4+ Invariant NKT Cells for the Infectious Spread of Tolerance and the Induction of Specific Regulatory T Cells
J. Immunol., July 15, 2004; 173(2): 1043 - 1050.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L.-P. Ho, B. C. Urban, L. Jones, G. S. Ogg, and A. J. McMichael
CD4-CD8{alpha}{alpha} Subset of CD1d-Restricted NKT Cells Controls T Cell Expansion
J. Immunol., June 15, 2004; 172(12): 7350 - 7358.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Falcone, F. Facciotti, N. Ghidoli, P. Monti, S. Olivieri, L. Zaccagnino, E. Bonifacio, G. Casorati, F. Sanvito, and N. Sarvetnick
Up-Regulation of CD1d Expression Restores the Immunoregulatory Function of NKT Cells and Prevents Autoimmune Diabetes in Nonobese Diabetic Mice
J. Immunol., May 15, 2004; 172(10): 5908 - 5916.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. K. Sandberg, C. A. Stoddart, F. Brilot, K. A. Jordan, and D. F. Nixon
Development of innate CD4+ {alpha}-chain variable gene segment 24 (V{alpha}24) natural killer T cells in the early human fetal thymus is regulated by IL-7
PNAS, May 4, 2004; 101(18): 7058 - 7063.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
Z. Illes, M. Shimamura, J. Newcombe, N. Oka, and T. Yamamura
Accumulation of V{alpha}7.2-J{alpha}33 invariant T cells in human autoimmune inflammatory lesions in the nervous system
Int. Immunol., February 1, 2004; 16(2): 223 - 230.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. S. Im, K. O. A. Yu, P. A. Illarionov, K. P. LeClair, J. R. Storey, M. W. Kennedy, G. S. Besra, and S. A. Porcelli
Direct Measurement of Antigen Binding Properties of CD1 Proteins Using Fluorescent Lipid Probes
J. Biol. Chem., January 2, 2004; 279(1): 299 - 310.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. M. Esteban, T. Tsoutsman, M. A. Jordan, D. Roach, L. D. Poulton, A. Brooks, O. V. Naidenko, S. Sidobre, D. I. Godfrey, and A. G. Baxter
Genetic Control of NKT Cell Numbers Maps to Major Diabetes and Lupus Loci
J. Immunol., September 15, 2003; 171(6): 2873 - 2878.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. L. Matsuda, L. Gapin, J. L. Baron, S. Sidobre, D. B. Stetson, M. Mohrs, R. M. Locksley, and M. Kronenberg
Mouse V{alpha}14i natural killer T cells are resistant to cytokine polarization in vivo
PNAS, July 8, 2003; 100(14): 8395 - 8400.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Araki, T. Kondo, J. E. Gumperz, M. B. Brenner, S. Miyake, and T. Yamamura
Th2 bias of CD4+ NKT cells derived from multiple sclerosis in remission
Int. Immunol., February 1, 2003; 15(2): 279 - 288.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
B. C. Kieseier, M. C. Dalakas, and H.-P. Hartung
Immune mechanisms in chronic inflammatory demyelinating neuropathy
Neurology, December 24, 2002; 59(90126): S7 - 12.
[Abstract] [Full Text]


Home page
J. Virol.Home page
J. K. Sandberg, N. M. Fast, E. H. Palacios, G. Fennelly, J. Dobroszycki, P. Palumbo, A. Wiznia, R. M. Grant, N. Bhardwaj, M. G. Rosenberg, et al.
Selective Loss of Innate CD4+ V{alpha}24 Natural Killer T Cells in Human Immunodeficiency Virus Infection
J. Virol., June 27, 2002; 76(15): 7528 - 7534.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. T. Mars, V. Laloux, K. Goude, S. Desbois, A. Saoudi, L. Van Kaer, H. Lassmann, A. Herbelin, A. Lehuen, and R. S. Liblau
Cutting Edge: V{alpha}14-J{alpha}281 NKT Cells Naturally Regulate Experimental Autoimmune Encephalomyelitis in Nonobese Diabetic Mice
J. Immunol., June 15, 2002; 168(12): 6007 - 6011.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. E. Gumperz, S. Miyake, T. Yamamura, and M. B. Brenner
Functionally Distinct Subsets of CD1d-restricted Natural Killer T Cells Revealed by CD1d Tetramer Staining
J. Exp. Med., March 4, 2002; 195(5): 625 - 636.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
P. T. Lee, K. Benlagha, L. Teyton, and A. Bendelac
Distinct Functional Lineages of Human V{alpha}24 Natural Killer T Cells
J. Exp. Med., March 4, 2002; 195(5): 637 - 641.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. W. Jahng, I. Maricic, B. Pedersen, N. Burdin, O. Naidenko, M. Kronenberg, Y. Koezuka, and V. Kumar
Activation of Natural Killer T Cells Potentiates or Prevents Experimental Autoimmune Encephalomyelitis
J. Exp. Med., December 17, 2001; 194(12): 1789 - 1799.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. K. Singh, M. T. Wilson, S. Hong, D. Olivares-Villagomez, C. Du, A. K. Stanic, S. Joyce, S. Sriram, Y. Koezuka, and L. Van Kaer
Natural Killer T Cell Activation Protects Mice Against Experimental Autoimmune Encephalomyelitis
J. Exp. Med., December 17, 2001; 194(12): 1801 - 1811.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
D Baeten, N Van Damme, F Van den Bosch, E Kruithof, M De Vos, H Mielants, E M Veys, and F De Keyser
Impaired Th1 cytokine production in spondyloarthropathy is restored by anti-TNF{alpha}
Ann Rheum Dis, August 1, 2001; 60(8): 750 - 755.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. Yamazaki, Y. Ohsawa, and H. Yoshie
Elevated Proportion of Natural Killer T Cells in Periodontitis Lesions : A Common Feature of Chronic Inflammatory Diseases
Am. J. Pathol., April 1, 2001; 158(4): 1391 - 1398.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Pal, T. Tabira, T. Kawano, M. Taniguchi, S. Miyake, and T. Yamamura
Costimulation-Dependent Modulation of Experimental Autoimmune Encephalomyelitis by Ligand Stimulation of V{{alpha}}14 NK T Cells
J. Immunol., January 1, 2001; 166(1): 662 - 668.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Illés, Z.
Right arrow Articles by Yamamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Illés, Z.
Right arrow Articles by Yamamura, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS