| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
B-Crystallin to T Cells in Active Multiple Sclerosis Lesions: An Early Event Following Inflammatory Demyelination1
*
*
Division of Immunological and Infectious Diseases, TNO Prevention and Health, Leiden, The Netherlands;
Department of Cell Biology and Immunology, Faculty of Medicine, Free University, Amsterdam, The Netherlands; and
Department of Neurochemistry, Institute of Neurology, University College London, London, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B-crystallin has been shown to be an
important myelin Ag to human T cells. Since B-crystallin is an
intracellular heat shock protein, the question arises at what stage, if
any, during lesional development in MS this Ag becomes available for
CD4+ T cells. In 3 of 10 active MS lesions, B-crystallin
could be detected inside phagocytic vesicles of perivascular
macrophages, colocalizing with myelin basic protein and myelin
oligodendrocyte glycoprotein (MOG). Although the detectability of MOG
in phagosomes is considered as a marker for very recent demyelination,
MOG was detected in more macrophages and in more lesions than
B-crystallin. The disappearance of B-crystallin from macrophages
even before MOG was confirmed by in vitro studies; within 6 h
after myelin-uptake B-crystallin disappears from the phagosomes.
B-Crystallin-containing macrophages colocalized with infiltrating T
cells and they were characterized by expression of MHC class II, CD40,
and CD80. To examine functional presentation of myelin Ags to T cells,
purified macrophages were pulsed in vitro with whole myelin membranes.
These macrophages activated both myelin-primed and
B-crystallin-primed T cells in terms of proliferation and IFN-
secretion. In addition, B-crystallin-pulsed macrophages activated
myelin-primed T cells to the same extent as myelin-pulsed macrophages,
whereas myelin basic protein-pulsed macrophages triggered no response
at all. These data indicate that, in active MS lesions, B-crystallin
is available for functional presentation to T cells early during
inflammatory demyelination. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B-crystallin
(3), a small heat shock protein (4, 5).
B-Crystallin is present at enhanced levels in the cytosol of
oligodendrocytes and astrocytes in MS lesions, where it is up-regulated
already at the earliest stages of lesional formation (6).
Elevated expression of B-crystallin in the oligodendrocyte-myelin
complex correlates strongly with the immunological activity of the
lesion. To locally (re)activate T cells, a potential autoantigen must
be presented to the cellular immune system. In immunologically active
MS lesions, characterized by ongoing or recent demyelination and the
presence of inflammatory infiltrates, several myelin proteins can be
detected in macrophages (7), suggesting processing and
presentation of these proteins to the cellular immune system.
Detectability of such myelin proteins in macrophages, along with activation markers of macrophages, can be used to assess lesional age (8). Detection of minor myelin constituents like MOG and/or CNPase in phagocytic vesicles inside macrophages indicate recent demyelination. Macrophages containing vesicles that show immunoreactivity for the major myelin constituents MBP and/or PLP, but not for MOG or CNPase, are indicative of more advanced myelin degradation. Inactive lesions may show infiltration of T cells and of macrophages containing either empty vacuoles or myelin protein-negative vesicles, whereas the most frequently found lesions in MS patients are even older and contain less, if any, immunological activity.
In addition to immunohistochemical analyses that do not
provide information with respect to the functional relevance of
(auto)Ag presentation, there has been extensive research on
autoantigen-specific T cell responses in MS (9). Most of
these in vitro studies have been performed with purified myelin
proteins, assuming that during demyelination these proteins
will be liberated from the fatty myelin membrane and will
subsequentially be processed and presented by APC to T cells. The role
of B-crystallin as a putative autoantigen has been studied with
protein extracts of myelin in vitro (3), and
B-crystallin is localized in the cytosol of oligodendrocytes and
astrocytes (6) in MS lesions. So far it has thus remained
unclear whether B-crystallin actually becomes presented to MHC class
II-restricted T cells in MS lesions.
We therefore investigated whether presentation of B-crystallin to
the cellular immune system occurs in MS lesions using a combined in
situ-in vitro approach. In this report, we show that in demyelinating
MS lesions B-crystallin can be detected inside vesicles belonging to
the endosomal/lysosomal pathway in a subset of myelin-phagocytosing
macrophages. These perivascular macrophages express MHC class II
molecules as well as CD80 and CD40 and they are found in close
proximity of infiltrating T cells, suggesting presentation of
myelin-derived B-crystallin to these T cells. Functional
presentation of myelin-derived B-crystallin to T cells was
demonstrated in vitro by proliferative responses and IFN- production
of B-crystallin-primed T cells in response to macrophages fed with
whole myelin membranes. The response of myelin-primed T cells to
macrophages fed with whole myelin was similar to their response to
macrophages fed with purified B-crystallin alone, showing that much
of the human T cell response to APC fed with whole myelin is accounted
for by the recognition of myelin-derived B-crystallin. The present
study demonstrates that as an early event after myelin phagocytosis in
MS lesions, B-crystallin becomes available to T cells, suggesting an
important role of this autoantigen in the pathogenesis of MS.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Immunohistochemistry was performed on snap-frozen brain sections
(10 µm) from six patients with clinically definite MS and on two
control cases (obtained from the Multiple Sclerosis Tissue Bank,
Institute of Neurology, London, U.K.). Ten MS lesions were selected for
the presence of active demyelination using Oil red O (ORO)-positive
macrophage infiltration as a marker for myelin uptake. These active
lesions were analyzed for cellular infiltrates and myelin-derived
protein detectability in macrophages. ORO staining was performed as
described previously. Sections were fixed in ice-cold acetone with
0.03% H2O2 (to block
endogenous peroxidase) for 10 min. Following air-drying, the sections
were incubated overnight at 4°C with primary Abs in 0.1% BSA and
rinsed extensively with PBS + 0.05% Tween 20. Primary Abs used for
glial cell and myelin protein detection were rabbit polyclonal
anti-glial fibrillary acidic protein (-GFAP; Zymed, San
Francisco, CA), murine monoclonal -MOG (clone 8-18C5, provided by
Dr. Sarah Piddlesden, University of Melbourne, Melbourne, Australia)
and murine monoclonal anti-human -MBP (Boehringer Mannheim,
Indianapolis, IN). To study markers of immunological relevance, the
following primary Abs were used: murine monoclonal anti-MHC class
II (-HLA-D; NovoCastra, New Castle, U.K.), murine monoclonal
anti-CD40 (provided by Dr. Mark de Boer, Tanox Pharma B.V.,
Amsterdam, The Netherlands), murine monoclonal anti-CD68 (Dako,
Carpinteria, CA), murine monoclonal anti-CD80 (provided by Dr.
Carine Dello, Innogenetics, Ghent, Belgium), and rabbit polyclonal
anti-CD3 (Dako). For detection of B-crystallin, we used rabbit
polyclonal anti-B-crystallin w3/13 (3) and rabbit
polyclonal anti-lap70 directed against the C-terminal 14 amino
acids of B-crystallin provided by Dr. Gerard Stege (University of
Nijmegen, Nijmegen, The Netherlands). The secondary Abs used were
biotinylated horse anti-mouse (Vector Laboratories, Burlingame, CA)
and biotinylated donkey anti-rabbit (Life Sciences, St. Petersburg,
FL). They were incubated in 1% BSA + 1% normal human serum (NHS) for
45 min at room temperature. After rinsing with PBS + 0.05% Tween 20,
peroxidase-labeled streptavidin (Life Technologies, Rockville, MD) in
1% BSA + 1% NHS was added for 45 min at room temperature.
Binding of the Abs was visualized using 3'-diaminobenzidine as a chromogen. Counterstaining was performed using hematoxylin. Negative controls included serum of nonimmunized mice or rabbits as a first Ab and primary Ab omission controls.
As an additional specificity assay for the B-crystallin staining,
Abs were supplied with partly digested B-crystallin (incubation
time, 120 min; see below) at a 10 µg/ml concentration and incubated
for 1 h at room temperature before use in the above-mentioned
immunohistochemical procedure.
In vitro myelin uptake assay
Twenty-four-well plates were incubated for 2 h at room temperature with 0.5 ml (2 mg/ml) human fibronectin (Central Laboratory of the Netherlands, Amsterdam, The Netherlands) per well. PBMC at a concentration of 2 x 106/ml in RPMI 1640 + 10% FCS + streptomycin (50 mg/ml), penicillin (100 IU/ml), and 1 mM glutamine was added per well and incubated for 48 h at 37°C and 5% CO2. The supernatant was discarded and the cells were washed twice with RPMI 1640. The adherent monocytes were incubated for 90 min with 0.5 ml RPMI 1640 + 4% NHS and fed with 20 µg MS patient-derived myelin. The supernatant was discarded and cells were washed twice with RPMI 1640. At various time points, cells were harvested using 0.5 ml RPMI 1640 + 5 mM EDTA/well. Cells were left on ice for 15–30 min before they were harvested and centrifuged for 5 min at 1500 rpm. Cells were resuspended in PBS + 0.1% BSA and used for cytospins at 500 rpm. Cytospins were analyzed for macrophage purity using the anti-CD68 mAb and found to contain >85% monocytes. Immunohistochemistry was performed as described above.
Western blotting and in vitro degradation of B-crystallin
Myelin samples were lyophilized and dissolved in sample buffer
(60 mM Tris-HCl (pH 6, 8), 2% SDS, 10% glycerol, 5% 2-ME, and 0.01%
bromophenol blue). They were subjected to standard SDS-PAGE analysis
using an 8–25% gradient polyacrylamide gel (Pharmacia LKB,
Piscataway, NJ). Western blots were analyzed for the presence of
B-crystallin using rabbit polyclonal anti-lap70 and alkaline
phosphatase-labeled swine anti-rabbit Abs (Dako). Degradation of
B-crystallin was performed in vitro by the addition of 50 µg/ml
cathepsin B (28 U/mg) and 50 µg/ml cathepsin D (8.5 U/mg) to a 2
mg/ml solution of B-crystallin in 50 mM sodium acetate (pH 5.0) at
37°C. Cathepsins B and D were preincubated in sodium acetate/acetic
acid buffer supplied with 0.14 M 2-ME. Samples were taken at various
time points and diluted 10-fold in 0.5 M Tris (pH 9.0) buffer to
terminate proteolytic activity. Western blot analysis of these samples
using the polyclonal Abs w3/13 and lap70 was performed as described
above.
Ags
Whole myelin derived from an MS patient was isolated by density
gradient centrifugation, as described (10). Human MBP was
isolated from human myelin, as described previously (11).
Human recombinant B-crystallin was prepared as follows.
B-crystallin encoding mRNA derived from the astrocytoma cell line
U373 was amplified by RT-PCR using primers, to which SacI
and KpnI restriction sites were added at the 5' end of the
upstream primer and HindIII and PstI restriction
sites at the 5' end of the downstream primer. Primer sequences were:
upstream, 5'- GAGCTCGGTACCATGGACATCGCCATC; downstream,
5'-GGAAGCTTCTGCAGCTATTTCTTGGGGGCTGC. The PCR product was digested
with KpnI/HindIII and subcloned into the
KpnI/HindIII site of vector pQE30 (Qiagen,
Chatsworth, CA). The sequence of the construct was confirmed by
sequence analysis using the Applied Biosystems Prism automatic
sequencing system (Perkin-Elmer, Norwalk, CT). Histidine-tagged
recombinant protein was isolated using a Ni-NTA column, followed by
reversed-phase-HPLC purification. Identity of the protein was confirmed
by Western blot analysis using B-crystallin-specific mAb
(3).
T cell proliferation assay
PBMC from healthy control subjects were cultured in RPMI 1640
medium (Dutch modification) supplemented with 100 U/ml penicillin, 0.1
mg/ml streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate,
10 mM HEPES (pH 7.4), and 5% NHS at 2 x
105 cells per 100 µl in round-bottom wells at
37°C and 5% CO2 in the presence of 10 µg/ml
human recombinant B-crystallin or 25 µg/ml MS-affected myelin. On
days 5 and 8, 10% Lymphocult-T (Biotest Seralc, Zaventem, Belgium) in
culture medium was added as source of growth-promoting cytokines
including IL-2. At day 10, the T cells were harvested and Ag
specificity was determined in a standard proliferation assay using
purified monocytes/macrophages as APC.
To isolate monocytes/macrophages, 6-well plates were incubated
overnight at room temperature with 250 µl (1 mg/ml) human plasma
fibronectin (Life Technologies). PBMC were seeded at a concentration of
2 x 106/ml per well in culture medium and
incubated for 2 h at 37°C and 5% CO2.
Nonadherent cells were removed by washing the wells twice with RPMI
1640. After an additional 72-h incubation in culture medium at 37°C
and 5% CO2, the wells were washed with RPMI 1640
and adherent monocytes/macrophages were trypsinized using 0.25% w/v
porcine trypsin (Sigma, St. Louis, MO) in 0.12 M NaCl, 50 mM KCl, 10 mM
NaHCO3, 0.7 mM EDTA, 20 mM HEPES, and 0.1% w/v
glucose. Purity of the monocyte/macrophage population was determined by
direct immunofluorescence surface staining using mAbs directed against
CD14, CD3, and CD19 conjugated with FITC or PE (Becton Dickinson,
Mountain View, CA) and analyzed on a FACScalibur flow cytofluorometer
using CellQuest software (Becton Dickinson). The population contained
>85% monocytes/macrophages. Proliferation assays were performed by
seeding 5 x 104 T cells with varying doses
of irradiated (30 Gy) monocytes/macrophages in the presence of 25
µg/ml human recombinant B-crystallin or MS-affected myelin in 200
µl culture medium in flat-bottom wells. After a 72-h incubation, 20
kBq [3H]thymidine (Amersham Life Sciences,
Arlington Heights, IL) was added per well. After 16 h,
[3H]thymidine incorporation was determined by
using a beta plate counter (Canberra Packard, Meriden, CT).
IFN- assay
To determine IFN- release in response to the Ags examined in
the proliferation assays, 100 µl of culture supernatant was harvested
before the addition of [3H]thymidine. IFN-
production was determined by ELISA using a commercially available
detection kit (BioSource International, Camarillo, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B-Crystallin is present in phagocytic vesicles in a subset of
myelin-phagocytosing macrophages in active MS lesions
Lesions were selected on the basis of the presence of inflammatory
infiltrates and active demyelination. Myelin uptake, as revealed by
ORO-positive lipids and MBP-immunostaining inside macrophages,
indicated that ORO and MBP were detectable in numerous macrophages
distributed throughout these lesions. In agreement with our previous
findings (6), such lesions contain oligodendrocytes and
astrocytes with clearly elevated levels of B-crystallin (Fig. 1
A). In three of these lesions
B-crystallin could also be detected in phagocytic vesicles of
perivascular macrophages. Colocalization of ORO, MBP, MOG, and
B-crystallin in macrophages, as demonstrated by the use of serial
sections (Fig. 1, B–E), revealed that all
B-crystallin-containing macrophages were actively phagocytosing
myelin. Moreover, B-crystallin- and MOG-containing macrophages were
far less abundant than MBP- or ORO-positive macrophages. They were
restricted to the perivascular spaces and represented a small subset of
MBP-positive macrophages only. In addition, MBP-containing macrophages
were detected in more lesions than MOG- and B-crystallin-containing
macrophages and MOG was detected inside phagocytic vesicles in two
lesions in which B-crystallin was undetectable in macrophages (Table I). The pattern of Ag-laden macrophages
therefore suggested a temporal relationship in the disappearance of
individual myelin Ags from phagocytic vesicles after myelin uptake in
the following order: B-crystallin, MOG, and MBP.
|
|
B-Crystallin-laden macrophages reflect very recent myelin
phagocytosis
In vitro experiments were performed to gain more insight into the
detectability of individual myelin proteins within intracellular
vesicles in macrophages. MS-affected myelin was fed to
monocytes/macrophages freshly isolated from PBMC. This myelin contained
small amounts of B-crystallin as confirmed by Western blotting (data
not shown). By immunohistochemical criteria, macrophages pulsed in
vitro with whole myelin were indistinguishable from myelin-laden
macrophages in MS lesions (Fig. 2,
A–C). Within 6 h after myelin uptake, B-crystallin
disappeared from phagocytic vesicles, whereas MBP and MOG remained
detectable well after this period (Fig. 2, D–F). The order
in which individual myelin Ags disappear from macrophages following
myelin uptake is a function of the sensitivity and specificity of the
Abs used to detect the Ags, the relative concentration of each Ag in
myelin at the time of phagocytosis, and the relative rate of
degradation of each Ag in the endosomal pathway of macrophages. For the
in vitro experiment in Fig. 2, these parameters are probably comparable
to those that apply to Fig. 1
. The Abs used to stain the macrophages
were the same as those used to stain the tissue sections in Fig. 1, the
myelin membranes used as an Ag source in Fig. 2 were extracted from MS
brains, and in both cases phagocytosed myelin appeared to undergo
degradation in the endolysosomal compartment. These data therefore
confirm the suggested order of disappearance of individual myelin Ags
from phagocytic vesicles after myelin uptake in MS lesions (Table I)
and support the notion that the detectability of B-crystallin in
phagocytosing macrophages reflects very recent myelin uptake.
|
B-Crystallin enters a proteolytic pathway inside macrophages
after myelin phagocytosis
To verify that the vesicles in which B-crystallin was visible
belong to the endosomal/lysosomal pathway, two antisera were used that
discriminate between intact and cathepsin-degraded B-crystallin.
Recognition of B-crystallin by the lap70 polyclonal antiserum is
dependent on the integrity of the C-terminal amino acid sequence. This
sequence is highly susceptible to cleavage by both cathepsins B and D,
two major endosomal/lysosomal proteases. In vitro degradation followed
by amino acid analyses revealed that cathepsin B recognizes two major
scissile bonds in the C terminus of B-crystallin, i.e.,
T170-A171, and
K174-P175 (data not shown).
As shown by Western blotting, only the w3/13 antiserum recognizes
B-crystallin degradation products generated by cathepsins B and D
digestion, albeit for a limited period of time (Fig. 3). The lap70 antiserum almost
exclusively recognizes intact B-crystallin, indicating that the
integrity of the C terminus of B-crystallin is indeed rapidly lost
upon proteolytic degradation.
|
B-crystallin in phagocytic vesicles
inside macrophages, whereas both Abs proved able to recognize
B-crystallin expressed in the cytosol of astrocytes and
oligodendrocytes. This confirms that B-crystallin-positive vesicles
indeed belong to the endosomal/lysosomal pathway. The pattern of
recognition also renders it highly unlikely that the transient
detection of B-crystallin in macrophages reflects endogenous
production of B-crystallin rather than myelin uptake. Colocalization of T cells, costimulatory molecules, and macrophages that contain minor myelin proteins in perivascular infiltrates
To examine where Ag presentation is most likely to take place, we
analyzed the MS lesions for the presence of T cells, MHC class II
molecules, and costimulatory molecules CD80 and CD40. MHC class II
molecules were distributed widely on macrophages, microglia, and
astrocytes throughout the lesional area. In contrast, expression of the
costimulatory molecules CD80 and CD40 on T cells and macrophages was
found to be more restricted to the perivascular regions often localized
at the lesion edge. Analysis of serial sections revealed that recent
phagocytic activity, as shown by the presence of MOG in phagocytic
vesicles of perivascular macrophages, colocalized with the presence of
MHC class II and costimulatory molecules on macrophages as well as with
the presence of T cells in the direct vicinity (Fig. 1, F–I). Ag presentation in these lesions is thus most likely
to take place in the perivascular regions, colocalizing with recent
myelin phagocytosis.
In vitro uptake of whole myelin by macrophages leads to
presentation of B-crystallin to T cells
Next, we investigated whether uptake of total myelin by
monocytes/macrophages not only leads to protein degradation but also to
presentation of B-crystallin to T cells. Macrophages were fed in
vitro with myelin membranes derived from MS-affected brain. As a
readout for Ag presentation, proliferative responses and IFN-
production were monitored of B-crystallin- and myelin-primed T cells
derived from the same donor as the macrophages. Proliferative responses
of B-crystallin-primed T cells were found against both
B-crystallin- and myelin-fed macrophages (Fig. 4A). In addition, these T
cells produce readily detectable amounts of IFN-, indicative of
Ag-specific activation (Fig. 4C). Similarly, myelin-primed T
cells also proliferated and produced IFN- in response to either
myelin or B-crystallin (Fig. 4, B and D). It
is remarkable to note that the strength of the proliferative responses
as well as the amount of IFN- produced by these T cells in response
to B-crystallin-fed macrophages are comparable to the responses
measured against macrophages pulsed with total myelin. These results
are in marked contrast to the lack of proliferation and IFN-
production shown in response to macrophages fed with the major myelin
constituent MBP. All T cell responses were Ag specific since
tetanus toxoid-primed T cells did neither proliferate nor produce
IFN- in response to MBP-, B-crystallin-, or myelin-fed APC while
showing marked responses to APC fed with tetanus toxoid (data not
shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B-crystallin, a candidate autoantigen
in MS, is presented to the cellular immune system in demyelinating MS
lesions. Therefore, we performed a detailed immunohistochemical
analysis of 10, difficult to obtain, active demyelinating MS
lesions.
The immunohistochemical analysis confirmed the previously reported
enhanced expression of B-crystallin in the cytosol of
oligodendrocytes and astrocytes already during early phases of lesion
formation. In this study, we show that intracellular vesicles in a
subset of myelin-digesting macrophages contain B-crystallin in
addition to other myelin proteins. The use of two different antisera
that discriminate intact from partially degraded B-crystallin showed
that inside these macrophages B-crystallin enters a proteolytic
pathway, most likely resulting in MHC class II-restricted presentation
of B-crystallin-derived peptides to T cells.
The detectability of myelin proteins in phagocytosing macrophages in MS
lesions using immunohistochemistry has been described in great detail
and is used to estimate lesional age (8). Major myelin
constituents like MBP remain detectable in phagocytic vesicles inside
macrophages for a longer period of time than minor myelin constituents
like CNPase or MOG. Lesions or lesional areas containing macrophages
positive for minor myelin proteins reflect recent demyelination and are
therefore classified as early active lesions (7, 8). Since
B-crystallin is a minor myelin constituent, one would expect the
detectability of this protein inside macrophages to be limited. The
pattern of B-crystallin-positive macrophages in actively
demyelinating lesions was consistent with this expectation. A small
number of MBP-positive macrophages and a larger number of MOG-positive
macrophages were also found to be positive for B-crystallin.
Detectability of B-crystallin in macrophages is thus an even more
selective feature than the detectability of MOG. In vitro assays in
which macrophages were fed MS, brain-derived total myelin confirmed
that the detectability of B-crystallin in phagocytosing macrophages
is indeed limited to a very short period of time, i.e., <6 h, compared
with MBP and MOG which were still present after 6 h (A. van der
Goes, T. K. van der Berg, and C. D. Dijkstra, manuscript in
preparation). Thus, detectability of B-crystallin inside macrophages
can be used as a marker for very recent myelin uptake.
Macrophages that contained endosomal/lysosomal vesicles positive for
MBP, MOG, and B-crystallin, expressed MHC class II as well as
costimulatory molecules CD80 and CD40, and they were found in the close
proximity of infiltrating T cells. This indicates that all factors
required for productive (re)activation of T cells accumulate in the
areas where MOG- and B-laden macrophages were observed. The strict
perivascular localization of APC that are fully equipped to present Ag
and deliver the necessary costimulatory signals is in concordance with
earlier reports describing expression patterns of CD80 and CD40 in MS
lesions (12, 13, 14, 15). Experimental allergic encephalomyelitis
(EAE) studies using mannosylated liposome-encapsulated
dichloromethylene diphosphonate to deplete peripheral monocytes
(16, 17, 18) have shown an important role for hematogenous
perivascular macrophages in the induction of EAE. Also, bone marrow
chimera studies showed that the inflammatory response in EAE can start,
proceed, and end virtually in the absence of resident microglia that
may also be able to present Ag in the right MHC class II context
(19). Recently, hematogenous macrophages were shown to
modulate local activation of T cells in the brain and subsequent
migration of macrophages into the brain parenchyma in adoptively
transferred EAE (20). Functional interaction between
monocytes/macrophages and T cells is likely to play a key role in the
early phases of MS lesion development (21, 22). The
perivascular localization of the phagocytosing CD68-positive cells
strongly suggests that these cells are infiltrating hematogenous
macrophages and not resident microglia. Recently, there have been
reports that local activation of resident microglia in normal-appearing
white matter in MS brains is followed by myelin phagocytosis as an
initiating or very early event in MS pathogenesis, followed by the
recruitment of large numbers of hematogenous macrophages
(23). In our studies, minor myelin protein-positive
microglia in unaffected white matter were not observed. The most recent
myelin breakdown in our material, as assessed by the detectability of
minor myelin proteins in macrophages, was found to occur in the
perivascular spaces. Clustering of such blood vessels was often found
at the edges of the lesion.
The absence of dendritic cells in the CNS renders it highly unlikely
that the interactions between APC and T cells in the perivascular
spaces lead to activation of naive T cells against myelin-derived Ags.
Therefore, we would strongly favor the idea that, if these T cells are
to play a role in the pathogenesis of MS, they must already have been
primed against myelin Ags in the periphery. Several mechanisms have
been described for such a peripheral priming against CNS-specific
autoantigens, many of which hypothesize the involvement of infectious
agents (8, 24, 25, 26, 27). Recently, we described a novel
mechanism for the activation of peripheral T cells to B-crystallin,
involving virus-induced presentation of this Ag by EBV-infected B
lymphocytes to peripheral T cells (28).
The presence of B-crystallin inside phagocytic vesicles in
macrophages in the vicinity of infiltrating T cells strongly suggests
functional Ag presentation to T cells. To confirm functional
presentation of myelin-derived B-crystallin to T cells, we used
peripheral monocytes/macrophages fed with total myelin membranes. Total
myelin membranes contain 75% lipids, whereas of the remaining 25%
protein fraction MBP makes up about 12% and B-crystallin only makes
up 0.5%. Despite this low level of expression in whole myelin, we
showed that much of the total T cell response to total myelin is
accounted for by the responses to B-crystallin. This is consistent
with the previously reported vigorous T cell responses to
B-crystallin (3). Although we took great care in
purifying monocytes from peripheral blood, we cannot rule out that
small numbers of dendritic cells or B cells might have had a role in Ag
presentation in addition to macrophages in these in vitro assays. Even
if this were the case, however, our data still show that with
MS-affected myelin as starting material, B-crystallin becomes
available for T cell recognition and acts as a dominant Ag.
In summary, data presented here show that the presence of
B-crystallin in myelin-phagocytosing macrophages can be used as a
marker for very recent myelin uptake. In these macrophages,
B-crystallin enters the endosomal/lysosomal compartment which
generally leads to MHC class II-restricted Ag presentation. Functional
presentation of total myelin-derived B-crystallin was demonstrated
using hematogenous macrophages as APC in an in vitro approach. The
localization and immunological properties of B-crystallin-containing
macrophages strongly suggests that functional presentation of
B-crystallin to T cells takes place in the perivascular spaces of
active MS lesions. As an early event following myelin phagocytosis,
B-crystallin becomes available to the cellular immune system. The
vigorous response of T cells to this protein is likely to initiate
(29) or to enhance the ongoing immune response via
chemokine/cytokine-induced attraction of macrophages and modulation of
the properties of the blood-brain barrier.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Johannes M. van Noort, Division of Immunological and Infectious Diseases, TNO Prevention and Health, P.O. Box 2215, 2301 CE Leiden, The Netherlands.
3 Abbreviations used in this paper: MS, multiple sclerosis; CNPase, 2',3'-cyclic nucleotide 3'-phosphohydrolase; EAE, experimental allergic encephalomyelitis; MBP, myelin basic protein; MOG, myelin oligodendrocyte glycoprotein; ORO, Oil red O; PLP, proteolipid protein; NHS, normal human serum.
Received for publication November 3, 1999. Accepted for publication February 8, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, M. El Ouagmiri, C. H. Polman, H. Lassmann, R. Ravid. 1995. The small heat shock protein B-crystallin as candidate autoantigen in multiple sclerosis. Nature 375:798.[Medline]
-crystallin. Proc. Natl. Acad. Sci. USA 79:2360.B-crystallin is a small heat shock protein. Proc. Natl. Acad. Sci. USA 88:3652., J. J., H. Lassmann, J. M. van Noort. 1997. Expression of B-crystallin in glia cells during lesional development in multiple sclerosis. J. Neuroimmunol. 78:143.[Medline]
, M. J. van Stipdonk, C. Persoon-Deen, S. B. Geutskens, J. M. van Noort. 1999. EBV-induced expression and HLA-DR-restricted presentation by human B cells of B-crystallin, a candidate autoantigen in multiple sclerosis. J. Immunol. 162:129.. 1998. The small heat-shock protein B-crystallin as key autoantigen in multiple sclerosis. , , , , , ed. In Progress in Brain Research Vol. 117:435. Elsevier Science B.V., Amsterdam. [Medline]
This article has been cited by other articles:
|
|
 |
|
  C. Draghetti, C. Salvat, F. Zanoguera, M.-L. Curchod, C. Vignaud, H. Peixoto, A. Di Cara, D. Fischer, M. Dhanabal, G. Andreas, et al. Functional Whole-genome Analysis Identifies Polo-like Kinase 2 and Poliovirus Receptor as Essential for Neuronal Differentiation Upstream of the Negative Regulator {alpha}B-crystallin J. Biol. Chem., November 13, 2009; 284(46): 32053 - 32065. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Zaadstra, A. Chorus, S. van Buuren, H. Kalsbeek, and J. van Noort Selective association of multiple sclerosis with infectious mononucleosis Multiple Sclerosis, April 1, 2008; 14(3): 307 - 313. [Abstract] [PDF]
|
|
|
|
|
|
J M van Noort, R Verbeek, J F Meilof, C H Polman, and S Amor Autoantibodies against alpha B-crystallin, a candidate autoantigen in multiple sclerosis, are part of a normal human immune repertoire Multiple Sclerosis, June 1, 2006; 12(3): 287 - 293. [Abstract] [PDF]
|
|
|
|
 |
|
 S. Ellmerich, M. Mycko, K. Takacs, H. Waldner, F. N. Wahid, R. J. Boyton, R. H. M. King, P. A. Smith, S. Amor, A. H. Herlihy, et al. High Incidence of Spontaneous Disease in an HLA-DR15 and TCR Transgenic Multiple Sclerosis Model J. Immunol., February 15, 2005; 174(4): 1938 - 1946. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. R. Jimenez, F. J. Stam, K. W. Li, Y. Gouwenberg, M. P. Hornshaw, F. De Winter, J. Verhaagen, and A. B. Smit Proteomics of the Injured Rat Sciatic Nerve Reveals Protein Expression Dynamics During Regeneration Mol. Cell. Proteomics, February 1, 2005; 4(2): 120 - 132. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Lefranc, L. Almeras, S. Dubucquoi, J. de Seze, P. Vermersch, and L. Prin Distortion of the Self-Reactive IgG Antibody Repertoire in Multiple Sclerosis as a New Diagnostic Tool J. Immunol., January 1, 2004; 172(1): 669 - 678. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. van Veen, L. van Winsen, J. B.A. Crusius, N. F. Kalkers, F. Barkhof, A. S. Pena, C. H. Polman, and B. M.J. Uitdehaag {alpha}B-Crystallin genotype has impact on the multiple sclerosis phenotype Neurology, November 11, 2003; 61(9): 1245 - 1249. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
