| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Institute of Medical Microbiology, University of Ulm, Ulm, Germany;
Department of Medicine II, University Hospital of Freiburg, Freiburg, Germany; and
Division of Experimental Pathology, The Scripps Research Institute, La Jolla, CA 92037
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Efficient delivery systems for hepatitis B surface Ag (HBsAg) have been developed that prime potent humoral and cellular immune responses in preclinical animal models. These vaccination approaches comprise protein-based as well as DNA-based systems. These candidate vaccines can be delivered in ways that stimulate strictly polarized responses depending on the dose, route, and technique of delivery of the Ag or expression plasmid, and the codelivery of immunostimulating or -modulating reagents (2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24). Most of the vaccination studies have been performed in mice because this species represents the immunologically best-defined preclinical system available, although mice have disadvantages for the study of the immunopathology associated with chronic HBV infection. Another attractive preclinical model for the study of hepadna virus pathology is the woodchuck hepatitis virus-infected woodchuck, although this system is not well-defined immunologically.
Transgenic (tg) mouse lines have been constructed that express replication-competent HBV genomes or subgenomic HBV fragments in the liver (25, 26, 27, 28, 29, 30, 31, 32, 33). We used two alternative experimental strategies to test antiviral therapeutic vaccination approaches. In the first approach, tg line C57BL/6J-TgN(Alb1HBV)44Bri mice expressing large, middle, and small HBsAg in the liver (HBs-tg) were vaccinated. This was unsuccessful using many alternative vaccination techniques that were very efficient in congenic, non-tg control mice. Therefore, we focused on an alternative approach in which immune cells (primed and boosted in non-tg, congenic donor mice by different vaccination protocols) were transferred into normal (nonconditioned) HBs-tg hosts. The aim of this experimental design was the establishment of a long-lasting, HBsAg-specific cellular and humoral immune response in the tg host and the investigation of its targeting to the liver.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C57BL/6J mice (H-2b) were kept under standard-pathogen-free conditions in the animal colonies of Ulm University (Ulm, Germany). HBs-tg mice were obtained from The Jackson Laboratory (Bar Harbor, ME). Mice were used at 10–16 wk of age.
Recombinant HBsAg
Nonglycosylated HBsAg, subtypes ayw and adw, containing the small HBsAg (S) protein of HBV were produced in the Hansenula polymorpha host strain RB10 (34). HBsAg particles purified from crude yeast extracts by adsorption to silica gel, column chromatography, and isopycnic ultracentrifugation were obtained from Dr. K. Melber (Rhein Biotech, Düsseldorf, Germany) (34).
HBsAg-encoding plasmid DNA used for nucleic acid vaccination
The HBsAg-encoding XhoI/BglII fragment of HBV (subtype ayw) was cloned into the XhoI/BamHI-cut pCI vector (catalog no. E1731; Promega, Heidelberg, Germany). In the generated plasmid pCI/S, the HBsAg is expressed under control of the human CMV immediate early promoter.
In vivo suppression of CD4+ T cells in mice
CD4+ T cells were suppressed in mice by two i.p. injections of 200 µl PBS containing 100 µg of the anti-CD4 mAb YTS 191.1, as described previously (35). Flow cytometric analyses of PBMC populations demonstrated that >99% of the CD4+ T cells expressing the respective phenotype were deleted.
Oligodeoxynucleotides (ODN) with immune-stimulating sequences (ISS)
In some experiments, HBsAg was mixed with either 50 µg ODN TCATTGGAAAACGTTCTTCGGGGCG containing a CpG-ISS or 50 µg ODN TCATTGGAAAAGGTTCTTGGGGGGG (ISS*) containing no ISS (36). The phosphorothioate-modified ODN were produced by MWG-Biotech (Ebersberg, Germany). HBsAg mixed with the ODN was injected into mice without adding further adjuvants.
Vaccination of mice
Adult mice were immunized i.m. into the tibialis anterior muscle or s.c. (at the base of the tail) with the indicated amounts of plasmid DNA or recombinant HBsAg particles as described previously (17, 37, 38). Alternatively, mice were inoculated intradermally (into the lateral abdominal skin) with particle-coated plasmid DNA using the Helios Gene Gun system (catalog no. 165-2431,2432; Bio-Rad, Munich, Germany). The manufacturer’s instructions were closely followed to coat DNA to gold particles and to operate the "gene gun." Briefly, 1 µg plasmid DNA was coated onto 0.5 mg gold microcarrier particles of 1-µm diameter and fixed in a cartridge using 0.05 mg/ml polyvinylpyrrolidone. Mice were intradermally inoculated with DNA-coated gold particles using a helium pressure of 200 psi.
Spleens were obtained from C57BL/6 (B6) mice primed and boosted with the indicated vaccines. Single-cell suspensions were prepared from these spleens in PBS/BSA. A total of 2–5 x 107 spleen cells were injected i.p. or i.v. into HBs-tg or non-tg B6 hosts.
HBsAg-specific CTL
Single-cell suspensions were prepared from spleens of immunized
mice in MEM-
tissue culture medium supplemented with 10 mM HEPES
buffer, 5 x 10-5 M 2-ME, antibiotics, and
10% v/v FCS (Life Technologies, Eggenstein, Germany). A selected batch
of Con A-stimulated rat spleen cell supernatant (2% v/v) was added to
the culture medium. Responder cells (3 x
107) were cocultured with 1 x
106 irradiated, syngeneic RBL5/S transfectants.
Coculture was performed in 10 ml medium in upright
25-cm2 tissue culture flasks in a humidified
atmosphere/7% CO2 at 37°C. After 5 days of
culture, CTL were harvested, washed, and assayed for HBsAg-specific
cytolytic reactivity. All CTL lines generated displayed the
CD3+ CD4-
CD8+ TCRß+
phenotype.
Serial dilutions of effector cells were cultured with 2 x 103 51Cr-labeled targets in 200-µl round-bottom wells. Specific cytolytic activity of cells was tested in short-term 51Cr-release assays against RBL5, RBL5/BMG (transfected with the BMGneo vector without insert), or RBL5/S transfectants (carrying the HBsAg-encoding BMGneo vector) (23). After a 3.5-h incubation at 37°C, 50 µl of supernatant was collected for gamma-radiation counting. The percentage specific release was calculated as [(experimental release - spontaneous release)/(total release - spontaneous release)] x 100. Total counts were measured by resuspending target cells. Spontaneously released counts were always less than 15% of the total counts. Data shown are the mean of triplicate cultures. The SEM of triplicate data was always less than 20% of the mean.
Detection of IFN-
IFN- released into the supernatants of spleen cells
(106/ml) stimulated for 40 h with 10 µg/ml
HBsAg was detected by double-sandwich ELISA. For detection and capture
of IFN-, the mAb R4-6A2 and biotinylated mAb XMg1.2 (both from
PharMingen, Hamburg, Germany) were used. Extinction was analyzed at
405/490 nm on Spectra-Max equipment (Molecular Devices, Sunnyvale, CA)
using the Softmax Pro software (Molecular Devices).
Determination of serum Ab levels
Serum samples were repeatedly obtained from individual, immunized, or control mice by tail bleedings at different time points postinjection. Abs against HBsAg were detected in mouse sera using the commercial IMxAUSAB test (catalog no. 7A39-20; Abbott, Wiesbaden, Germany). Ab levels were quantified using six standard sera. The tested sera were diluted so that the measured OD values were between standard serum one and six. Values presented in this paper are calculated by multiplying the serum dilution by the measured Ab level (mIU/ml).
HBsAg-specific IgG, IgG1, and IgG2a serum Abs were determined by an end-point dilution ELISA assay. MicroELISA plates (Nunc-Maxisorp; Nunc, Wiesbaden, Germany) were coated with 150 ng recombinant HBsAg particles per well in 50 µl 0.1 M sodium carbonate buffer (pH 9.5) at 4°C. Serial dilutions of the sera in loading buffer (PBS supplemented with 3% BSA and 2% Tween 20) were added to the Ag-coated wells. Serum Abs were incubated for 2 h at 37°C before four washes with PBS supplemented with 0.05% Tween 20. Bound serum Abs were detected using HRP-conjugated rat anti-mouse IgG1 or IgG2a Abs (catalog nos. 02237E and 02017E; PharMingen) at a dilution of 1:2000 before incubation with o-phenylendiamine x 2 HCl (catalog no. 6172-24; Abbott) in PBS (pH 6.0). The reaction was stopped by 1 M H2SO4, and the extinction was determined at 492 nm. End-point titers were defined as the highest serum dilution that resulted in an absorbance value three times greater than that of negative control sera (derived from nonimmunized B6 mice).
HBsAg expression in the liver (at the protein and DNA level)
The HBsAg concentrations present in the livers of immunized and adoptively transferred mice were determined by a commercial ELISA (AUSZYME II; Abbott). Liver lysis and total RNA extraction and purification were performed using the QIAshredder or the RNeasy kits, respectively (Qiagen, Köln, Germany), and a subsequent step of digestion with 20 U/ml DNase I. RNA was analyzed by formaldehyde/1.5% agarose gel electrophoresis. Nucleic acids were transferred to Hybond-N+ nylon membranes (Amersham, Arlington Heights, IL). Hybridization with recombinant full-length HBV 1.4 DNA labeled to high specific activity (2 x 108–4 x 108 cpm/mg) was performed for 16 h at 65°C in 50% (v/v) formamide, 5x SSC-phosphate/EDTA , 2.5x Denhardt’s solution, 0.1% SDS, and 200 mg denatured calf thymus DNA/ml after 4 h of prehybridization at 42°C. After hybridization, high-stringency washes were performed. Membranes were exposed to x-ray film at -80°C.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B6 mice were injected with 1) 100 µg HBsAg-encoding pCI/S
plasmid DNA i.m., 2) 1 µg particle-coated pCI/S plasmid DNA
intradermally with the gene
gun,4 3) 1–20 µg
nonadjuvanted HBsAg lipoprotein particles i.m., s.c., or i.p.
(17, 39), or 4) 1–20 µg HBsAg particles adjuvanted with
ISS-containing ODN i.m. or s.c. (40). All vaccinated mice
developed anti-HBsAg serum Ab titers (Fig. 1
). These vaccines specifically primed
different immune effector specificities. HBsAg-binding serum Abs primed
by either delivering particle-coated pCI/S plasmid DNA with the gene
gun or injecting nonadjuvanted HBsAg lipoprotein particles were almost
exclusively of the IgG1 isotype (Fig. 1); hence, these vaccines
stimulated a T2 (or T2-biased) response. In contrast, the isotype
profile of HBsAg-specific serum Abs primed by injecting (i.m. or s.c.)
a high dose (100 µg) of either pCI/S plasmid DNA or HBsAg particles
adjuvanted with ISS-containing ODN-primed IgG2a Ab responses; thus,
these vaccines preferentially primed T1-type responses (Fig. 1) (T1 is
an immune response with isotype profile indicating Th1
immunoregulation). Boost injections using the same Ag delivery
technique as that used for priming enhanced the magnitude of the
response to HBsAg but did not change its polarization pattern (data not
shown). HBsAg-specific, MHC class I molecule (MHC-I)-restricted CTL
were efficiently primed in B6 mice immunized with 100 µg nonpackaged
pCI/S DNA or with HBsAg particles coadministered with ISS-containing
ODN (Fig. 1). In contrast, HBsAg-specific CTL were not detectable in
mice vaccinated with either 1 µg pCI/S plasmid DNA using the gene gun
or nonadjuvanted HBsAg particles (Fig. 1). The polarization of these
murine immune responses to HBsAg was further confirmed by their
specific IFN- release pattern (Table I). Thus, different protein- or DNA-based
vaccines efficiently prime T1 or T2 immune responses to HBsAg.
|
|
HBs-tg B6 mice primed and boosted with each of the four vaccines developed no detectable immune responses to HBsAg. We found no evidence for the stimulation of a cellular or humoral immune response to HBsAg in these mice. The HBsAg antigenemia in vaccinated HBs-tg mice persisted unchanged, no HBsAg-specific serum Abs appeared, HBsAg-specific CTL were not found, and evidence for liver injury (rise in serum transaminases) was not detected (data not shown). Many variants of these vaccination protocols were tested, but none of them could prime an immune response in the HBs-tg host (data not shown; some protocols are described in the Discussion section). Therefore, it is difficult to induce an immune response against this immunogenic viral surface Ag in mice that express secreted HBsAg in liver and kidney cells early in life and contain high levels of this Ag in all body fluids.
HBsAg antigenemia is suppressed and HBsAg-specific serum Ab titers appear in HBs-tg hosts reconstituted with HBsAg-immune cells
Immune B6 donor mice primed and boosted by i.m. injections of 100
µg pCI/S plasmid DNA or HBsAg particles mixed with ODN showed
HBsAg-specific CTL reactivity and high specific serum Ab titers. Within
3–5 days after the adoptive transfer of spleen cells from these donors
into congenic HBs-tg hosts (1–5 x 107
cells/host), HBsAg antigenemia was suppressed and anti-HBsAg serum
Abs appeared (Fig. 2). The HBsAg-specific
serum Ab titers increased for weeks in the transplanted HBs-tg hosts,
suggesting restimulation of the immune response in the adoptive host.
Furthermore, this adoptive T1 immunity established in the tg host was
detectable as specific IFN- release of spleen cells from
transplanted tg mice in response to HBsAg stimulation (data not shown).
The suppression of antigenemia and the high anti-HBsAg serum Ab
levels persisted for at least 5 mo after the transfers. Thus, the
adoptive transfers of T1 HBsAg-immune cells into HBs-tg hosts lead to
stable engraftment of at least one component of the anti-HBsAg
immune reactivity.
|
A). This specific CTL
reactivity was detected in the spleens of syngeneic, non-tg naive hosts
injected 5 days previously with these immune spleen cells (Fig. 3B). In contrast, this HBsAg-specific and MHC-I-restricted
CTL reactivity was not found in spleens of transplanted tg hosts that
were assayed for this specific immune reactivity at different time
points posttransfer (Fig. 3C).
|
We primed and boosted B6 donor mice with one of the four vaccines that
generate stable and potent T1 or T2 immunity to HBsAg. When immune
cells from these donors were transferred into HBs-tg hosts, all tested
spleen cell populations established rising HBsAg-specific serum Ab
titers that suppressed HBsAg antigenemia for weeks (Fig. 2
and Table I). The isotype profile of the serum Abs in the adoptive tg host
reflected the polarization prevalent in the transferred immune cell
population, i.e., T1 and T2 immune cells were equally well-engrafted
and maintained their polarization pattern (imprinted during priming) in
the tg host (Table I).
HBsAg expressed in HBs-tg hosts restimulates adoptively transferred immune cells with different polarization profiles in vivo
HBsAg-immune cells from B6 donor mice were transferred into naive,
syngeneic B6 hosts or congenic HBs-tg mice. Fig. 4 (left panel) shows
data from adoptive transfers of immune cells primed by ODN-adjuvanted
HBsAg particles. After transfer of HBsAg-immune cells into syngeneic,
naive hosts, HBsAg-specific serum Abs were detectable for only a few
weeks posttransfer (Fig. 4, left panel). In contrast, the
transfer of HBsAg-immune cells into HBs-tg hosts established
HBsAg-specific serum Ab titers rising for weeks posttransfer (Fig. 4, left panel). Thus, endogenous (transgene-derived) HBsAg
restimulates the adoptively transferred immune cells in the HBs-tg
hosts without changing their polarization profile (Table I).
|
We tested whether the transfer of HBsAg hyperimmune sera is as
efficient as the adoptive transfer of immune cells in establishing
anti-HBsAg immunity in HBs-tg mice. Xenogeneic, polyclonal
anti-HBsAg Abs (from rabbit or human) were injected into either
normal B6 mice or HBs-tg B6 mice (Fig. 4, right panel; and
data not shown). This passive serotherapy leads to the appearance of
HBsAg-specific Abs in the serum of non-tg B6 mice and HBs-tg mice.
HBsAg antigenemia was suppressed in HBs-tg mice for some weeks but
always reappeared after 3–12 wk. Transferred anti-HBsAg Abs were
more rapidly cleared from the serum of HBs-tg mice than from non-tg
mice (data not shown). Binding of xenogeneic anti-HBsAg Abs to
circulating HBsAg in HBs-tg mice (suppression of HBsAg antigenemia) did
not provide "help" for priming HBsAg-specific immune responses in
HBs-tg mice. Similar data were obtained when anti-HBsAg monoclonal
IgG1 or IgG2b Abs or polyclonal antisera from vaccinated mice were
injected into HBs-tg mice (Fig. 4, right panel; and data not
shown). Hence, the transfer of immune cells but not that of Abs of
different isotypes (and of different species origin) stably suppressed
HBsAg antigenemia.
Engraftment of anti-HBsAg immunity into HBs-tg hosts is CD4+ T cell-dependent
Different mechanisms may contribute to establish stable humoral
immunity to HBsAg in HBs-tg mice by immune cell transfer. These include
1) transfer of long-lived, Ab-producing plasma cells from primed donor
mice, 2) donor T cell-dependent stimulation of engrafted HBsAg-specific
donor B cell memory, or 3) donor T cell-dependent stimulation of HBs-tg
host-derived B cells. Bone marrow cell transfers from immune donors did
not engraft HBsAg immunity in HBs-tg hosts (data not shown). Because
long-lived, Ab-producing plasma cells mainly reside in bone marrow, it
is unlikely that transfer of long-lived donor plasma cells established
humoral immunity in the adoptive host. We investigated the T cell
dependence of the HBsAg-specific Ab responses in transplanted HBs-tg
mice, which expand over many months and suppress antigenemia. Evidence
for the critical role of donor CD4+ T cells in
supporting restimulation of anti-HBsAg immune responses in the
adoptive host was obtained when immune donor B6 mice were
CD4+ T cell-depleted in vivo before the cell
transfer by repeated injections of a depleting anti-CD4 mAb
(35, 41). Normal numbers of CD19+ B
cells and CD8+ T cells but <1% of the
CD4+ T cell population were found in immune
spleen cell populations of CD4+ T cell-depleted
donor mice. Transfer of CD4+ T cell-depleted
immune spleen cells into HBs-tg hosts failed to suppress HBsAg
antigenemia and did not lead to the appearance of anti-HBsAg serum
Abs (Fig. 5). When
CD4+ T cells were depleted from HBs-tg hosts by
mAb treatment in vivo shortly before transfer of immune cells from
donors with an intact CD4+ T cell compartment,
the appearance of serum Abs was delayed but not suppressed (data not
shown). This is readily explained by the persistence of depleting
anti-CD4 Abs in the host that delete a fraction of the transplanted
CD4+ T cells. The almost complete depletion of
CD4+ T cells from HBs-tg mice by repeated in vivo
Ab treatment did not lead to the appearance of anti-HBsAg serum Abs
or the suppression of HBsAg antigenemia. Thus, primed, donor-derived
CD4+ T cells (and not the absence of host-derived
"suppressive" CD4+ T cells) are critical for
the establishment of HBsAg-specific Ab responses in the HBs-tg host.
This is to be expected because the polarization profile of the Ab
response (that usually results from CD4+ helper T
cell regulation) established in the adoptive tg host always
corresponded to that imprinted during priming and boosting in
donor mice.
|
Liver tissue was obtained from nontreated HBs-tg mice (Table II, group 1), nontreated B6 mice (data
not shown), HBs-tg mice reconstituted with immune spleen cells (i.m.
100 µg pCI/S plasmid DNA-vaccinated) from congenic donor mice (Table II, group 2), or HBs-tg mice injected 6 days previously with 3 x
104 mIU rabbit anti-HBsAg antiserum (Table II, group 6). HBsAg concentrations of 15–28 ng/mg tissue were measured
in the liver of HBs-tg mice that were nontreated, injected with
anti-HBsAg antisera, or reconstituted with HBsAg immune cells.
HBsAg was not detectable in the liver of non-tg B6 mice. Despite the
rising anti-HBs Ab titer and the concomitant decline of HBsAg
antigenemia in HBs-tg mice reconstituted with immune cells, no decrease
in HBsAg content of the liver was demonstrated (Table II, group 2).
Furthermore, no differences in the amounts of intrahepatic, pregenomic
2.1/2.4-kb mRNA was observed between nontreated and treated HBs-tg mice
of groups 1, 2, and 6 (data not shown). Thus, ongoing HBsAg-specific
immune responses in the HBs-tg hosts do not suppress transgene-directed
HBsAg expression in the liver.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Vaccination techniques that efficiently primed humoral and CTL responses with T1 or T2 polarization profiles to HBsAg in H-2d and H-2b mice proved spectacularly inefficient in HBs-tg mice. This may reflect induction of neonatal or peripheral tolerance, exhausted T cell responses, Ag expression in immune-privileged sites, or presentation by CD95L+ cells (reviewed in Ref. 1). The described data confirm a previous report in which the direct vaccination of HBs-tg mice was shown to be very difficult (42). Only repeated infections with large numbers of HBsAg-encoding recombinant vaccinia virus or repeated injections of HBsAg adjuvanted in CFA were reported to stimulate low anti-HBsAg Ab responses but no CTL responses in HBs-tg mice. Our data differ from the reported success of therapeutic vaccination with HBsAg-encoding expression plasmid DNA in a different HBs-tg lineage (31, 43, 44). The reported successful therapeutic vaccination in this system might be related to the fact that HBsAg transgene expression in this particular lineage is extinguished by methylation (45, 46, 47, 48). It is unlikely that a deficient anti-pre-S immunity was critical for the failure of our therapeutic vaccination. We vaccinated HBs-tg mice with constructs encoding the large (pre-S1, pre-S2.S) surface Ag or the "mixed" (plasma- or Chinese hamster ovary-derived) HBsAg lipoprotein particles (that contain large, middle, and small HBsAg proteins); these vaccines stimulate efficiently anti-pre-S immunity in normal mice. None of these candidate vaccines suppressed HBsAg antigenemia and induced seroconversion in the HBs-tg hosts. Thus, the data we describe in this paper agree with the conclusion obtained with DNA vaccination in tg lineages in which expression of HBV genes is not methylation-sensitive, i.e., DNA immunization does not break tolerance to HBV Ags (49).
We used additional immunization protocols in HBs-tg mice to provide
heterologous T cell help or to bypass T cell help requirements in an
attempt to prime humoral and CTL responses to HBsAg. Several
approaches were tested: 1) HBsAg-encoding plasmids were mixed with OVA-
or hepatitis B core Ag-encoding plasmids to provide heterologous
carriers, 2) HBsAg of the transgene-encoded serotype (ayw) as well as
HBsAg of a related but different serotype (adw2) were delivered as
recombinant lipoprotein particle, 3) murine cytokines (IL-7, IFN-,
and GM-CSF) were mixed as plasmid DNA with HBsAg-encoding plasmid DNA,
and 4) ODN with ISS were codelivered with HBsAg particles to bypass T
helper cell requirements (35). None of these experimental
strategies established stable anti-HBsAg immunity in HBs-tg
mice.
Adoptive transfer of HBsAg-immune cells
Because the direct immunization experiments of HBs-tg mice were unsuccessful, we used adoptive transfer systems to engraft immune cells into HBs-tg hosts that produce transgene-encoded viral Ag in almost all liver cells. By transferring immune cells from non-tg, congenic donor mice into HBs-tg hosts, we asked whether the Ag-bearing HBs-tg host supports, modulates, or suppresses engraftment of humoral and/or cellular immunity to HBsAg.
Immune cells (from congenic, non-tg mice primed and boosted with HBsAg) were engrafted into the HBs-tg host after the i.v. or i.p. injection of 1–5 x 107 spleen cells. Engraftment of immunity was evident by the appearance of anti-HBsAg serum Ab titers and the concomitant suppression of HBsAg antigenemia. Antigenemia seems to be suppressed because Western analyses detected HBsAg in serum of nontransplanted but not transplanted HBs-tg mice. This makes masking of epitopes required for detection unlikely in that the HBsAg proteins were denatured under reducing conditions and detected with a polyclonal rabbit antiserum that detects denatured, sequential determinants of this viral protein. HBsAg-specific CTL did not establish a functional memory population in the spleen of the adoptive host. They may be selectively anergized, eliminated in the tg host, or trapped in lymph nodes draining hepatic tissues. In ongoing studies, we investigate the fate of primed CD8+ CTL in the adoptive HBs-tg host. Thus, transferred HBsAg-specific CD8+ CTL subset and the CD4+ helper T cell subset seem to have different fates in the adoptive host. While the former subset is functionally silent after its transfer into the tg host, the latter subset supports expanding B cell responses for many months.
Donor CD4+ T cells were required to support long-lasting anti-HBsAg Ab responses restimulated by tg-encoded HBsAg in the adoptive host. When CD4+ T cells were depleted from transferred immune cell populations, engraftment was completely prevented. HBsAg-immune T1 or T2 CD4+ T cells are restimulated by transgene-derived HBsAg in the HBs-tg host, maintain their polarization profile, and (re)stimulate a HBsAg-specific B cell response for months. Because the transfer of purified, immune CD4+ T cells into HBs-tg hosts did not stimulate the appearance of anti-HBsAg serum Ab titers (data not shown), most responding HBsAg-specific B cells are donor-derived.
Targeting antiviral immune cells to the liver
Adoptive transfers of high numbers of MHC-I-restricted, HBsAg-specific CTL lines into irradiated HBs-tg hosts induce liver injury in a well-characterized multistep process (26, 28, 50, 51, 52, 53). Injury can also be triggered in these mice by injecting LPS, cytokines, or liver infection with unrelated viruses (33, 42, 54, 55). In our transfer experiments, we used nonirradiated hosts and injected lower numbers of immune cells i.p. to establish an immune response in the host. In the weeks that followed the T1 or T2 immune cell transfers into HBs-tg hosts, the serum transaminase levels did not rise, i.e., no evidence for liver injury was evident. Expression of transgene-encoded HBsAg in the liver (at the RNA and protein level) was not influenced by the establishment of this immunity in the tg host. Northern analyses indicated that neither the level of the (heterologous albumin promoter-driven) 2.4-kb transcript nor that of the (HBV-promoter-driven) 2.1-kb transcript of HBsAg differed between HBs-tg mice that were nontransplanted, transplanted with syngeneic nonimmune spleen cells, or transplanted with syngeneic HBsAg-immune spleen cells. Furthermore, no evidence for suppression of HBsAg expression at the protein level was detectable in the liver of adoptive hosts reconstituted with immune cells. Hence, although a vigorous and expanding antiviral immune response is going on for months, this does not affect Ag expression in the main target organ.
The problem of organ-specific microenvironment for the access and development of activated T cells
The fate of antiviral CTL that rapidly disappear after transfer is
under study. CD4+ T cells are engrafted and can
be detected for months posttransfer. IFN--producing T1
CD4+ T cells (that supported the development of
continuously rising anti-HBsAg serum IgG2a Ab responses) with
antiviral activity apparently do not accumulate in the HBsAg-producing
liver and cause injury or suppression of Ag expression. These T cells
may either not migrate to the liver or home to the liver to be
functionally silenced or physically eliminated. In the
C57BL/6J-TgN(Alb1HBV)44Bri tg line of HBs-tg mice used in this study,
virtually all hepatocytes express HBsAg (25);
furthermore, HBsAg is expressed in the kidney epithelium and the
epithelium of the choroid plexus of these mice. Restricted CTL access
to HBsAg-expressing renal and neural tissues in vivo has been described
in this model (8, 9). Our data suggest that a similar
failure to accumulate at the site of Ag expression operates in the
liver. This indicates a major problem for designing a specific, T
cell-based immunotherapy for chronic HBV or HCV infection, i.e.,
delivering primed antiviral effector cells to the target organ.
As is evident from some experimental systems, breaking peripheral tolerance of MHC-I-restricted CTL in vivo does not directly result in autoimmunity. A well-characterized model demonstrating this point is a TCR tg mouse system displaying peripheral tolerance against a liver-specific MHC-I Kb Ag (56, 57, 58, 59). Peripheral tolerance to this liver-specific Ag can be broken in vivo by appropriate vaccination strategies employing costimulatory cytokines. However, the activated Kb-specific CTL do not induce liver injury. It is only through a (nondefined) change in the tissue microenvironment (e.g., triggered by an unrelated infection) that this organ supports activated T cells to specifically deliver their effector functions to the Ag-expressing tissue and thereby cause damage (60). The mechanism underlying this phenomenon remains to be elucidated. The intact tissue environment may restrict access of activated T cells, may suppress in situ T cell responses, or may fail to support clonal expansion and differentiation (61, 62). This observation may not be specific for the liver but may also operate in targeting activated T cells to, e.g., pancreas or nervous system. Many rules remain to be discovered in this field of the tissue-specific regulation of autoaggressive and antiviral T cell responses.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jörg Reimann, Department of Medical Microbiology and Immunology, University of Ulm, Helmholtzstr. 8/1, D-89081 Ulm, Germany.
3 Abbreviations used in this paper: HBV, hepatitis B virus; HBsAg, hepatitis B surface Ag; tg, transgenic; HBs-tg, tg line C57BL/6J-TgN(Alb1HBV)44Bri mice expressing large, middle, and small HBsAg in the liver; ODN, oligodeoxynucleotide; ISS, immune-stimulating sequences within ODN; S, small HBsAg; B6, C57BL/6; MHC-I, MHC class I molecule; T1, immune response with isotype profile indicating Th1 immunoregulation; T2, immune response with isotype profile indicating Th2 immunoregulation.
4 R. Schirmbeck and J. Reimann. In vivo induction and stability of polarized immunity to hepatitis B surface Ag primed by genetic vaccination in adult and neonatal mice. Submitted for publication.
Received for publication October 4, 1999. Accepted for publication February 8, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-secreting T cells after DNA-based immunization. J. Immunol. 161:5564.. Hepatology 16:655.[Medline]
This article has been cited by other articles:
|
|
 |
|
  D. Stober, I. Jomantaite, R. Schirmbeck, and J. Reimann NKT Cells Provide Help for Dendritic Cell-Dependent Priming of MHC Class I-Restricted CD8+ T Cells In Vivo J. Immunol., March 1, 2003; 170(5): 2540 - 2548. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Klugewitz, F. Blumenthal-Barby, A. Schrage, P. A. Knolle, A. Hamann, and I. N. Crispe Immunomodulatory Effects of the Liver: Deletion of Activated CD4+ Effector Cells and Suppression of IFN-{gamma}-Producing Cells After Intravenous Protein Immunization J. Immunol., September 1, 2002; 169(5): 2407 - 2413. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Riedl, S. El Kholy, J. Reimann, and R. Schirmbeck Priming Biologically Active Antibody Responses Against an Isolated, Conformational Viral Epitope by DNA Vaccination J. Immunol., August 1, 2002; 169(3): 1251 - 1260. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Schirmbeck, D. Stober, S. El Kholy, P. Riedl, and J. Reimann The Immunodominant, Ld-Restricted T Cell Response to Hepatitis B Surface Antigen (HBsAg) Efficiently Suppresses T Cell Priming to Multiple Dd-, Kd-, and Kb-Restricted HBsAg Epitopes J. Immunol., June 15, 2002; 168(12): 6253 - 6262. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Malanchere-Bres, P. J. Payette, M. Mancini, P. Tiollais, H. L. Davis, and M.-L. Michel CpG Oligodeoxynucleotides with Hepatitis B Surface Antigen (HBsAg) for Vaccination in HBsAg-Transgenic Mice J. Virol., July 15, 2001; 75(14): 6482 - 6491. [Abstract] [Full Text]
|
|
|
|
 |
|
 A. Kröger, D. Ortmann, T. U. Krohne, L. Mohr, H. E. Blum, H. Hauser, and M. Geissler Growth Suppression of the Hepatocellular Carcinoma Cell Line Hepa1-6 by an Activatable Interferon Regulatory Factor-1 in Mice Cancer Res., March 1, 2001; 61(6): 2609 - 2617. [Abstract] [Full Text]
|
|
|
|
|
|
R. Schirmbeck, X. Zheng, M. Roggendorf, M. Geissler, F. V. Chisari, J. Reimann, and M. Lu Targeting Murine Immune Responses to Selected T Cell- or Antibody-Defined Determinants of the Hepatitis B Surface Antigen by Plasmid DNA Vaccines Encoding Chimeric Antigen J. Immunol., January 15, 2001; 166(2): 1405 - 1413. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||
