| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Microbiology and Immunology, Emory University School of Medicine, Atlanta, GA 30322
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. This is thought to be one
mechanism of maternal tolerance to the fetal allograft. The CIITA gene
is regulated by four distinct promoters; promoter III directs
constitutive (B cell) expression, and promoter IV regulates
IFN--inducible expression. Using in vivo genomic footprinting,
promoter-reporter analysis, Southern blot analysis, and RT-PCR, we have
examined the cause of CIITA silencing in a trophoblast-derived cell
line. We report here that methylation of promoter IV DNA at CpG sites
in Jar cells prevents promoter occupancy and IFN--inducible
transcription. The inhibition of CpG methylation in Jar cells by
treatment with 5-aza-2'-deoxycytidine restores IFN- inducibility to
CIITA. This is the first description of an epigenetic mechanism
involved in regulation of CIITA and MHC class II gene
expression. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/ß heterodimers that participate in the
adaptive arm of the immune response by presenting endogenously derived
antigenic peptides to CD4+ T cells. Although the
normal pattern of expression of MHC class II genes is restricted to
APCs, thymic epithelium, and B cells (1, 2), class II
induction can occur on most cell types through exposure to various
cytokines, the most potent of which is IFN- (1, 3, 4, 5).
Expression of MHC class II on cells other than APCs can aid in the
initiation of an acute immune response. However, aberrant expression of
class II in inappropriate tissues, such as in cases of autoimmune
disease, can have deleterious consequences. It is therefore crucial
that the timing and location of expression of class II molecules be
carefully controlled.
The genes encoding the three MHC class II isotypes, HLA-DR, -DQ, and
–DP, as well as the HLA-DM and invariant chain genes are all
coordinately regulated at the transcriptional level by a set of
conserved cis-acting promoter elements termed the W, X1, X2,
and Y boxes (reviewed in Refs. 2 and 6). The
X1 and X2 boxes are both necessary and sufficient to direct class II
expression in B cells (7, 8). They are bound by the
regulatory factor X (RFX)3 and cAMP
response element binding protein (CREB), respectively
(9, 10, 11). The Y box is required for maximal class II
expression and is bound by the heterotrimeric factor NF-Y
(12). The factors that bind the W box have not been well
characterized. Although RFX and CREB are both necessary for promoter
activity, their presence is not sufficient to activate gene expression.
The other essential component of this system is the class II
trans-activator (CIITA), a non-DNA-binding protein
(13, 14, 15). CIITA expression correlates directly with MHC
class II expression and is induced by IFN- in a time frame that
precedes MHC class II gene expression (16, 17, 18, 19). Cells
negative for CIITA are also MHC class II negative. Thus, CIITA
expression functions as a molecular switch for MHC class II gene
regulation.
Transcription of CIITA is regulated by four distinct promoters that
direct the transcription of four separate first exons spliced to a
common second exon (20). Promoter I is involved in
dendritic cell expression. The function of promoter II is unknown.
Promoter III drives constitutive expression of CIITA, such as that
observed in B cells, and promoter IV controls the IFN--inducible
expression of CIITA seen in most other cell types (20).
There has also been a report that promoter III contributes to
IFN--inducible CIITA expression (21).
The inhibition of expression of MHC class II genes on fetal trophoblast
cells is one of the numerous mechanisms that have been proposed to
explain the phenomenon of maternal-fetal tolerance during pregnancy
(22, 23, 24, 25, 26, 27, 28, 29, 30, 31), whereby the maternal immune system fails to
react to placental tissues expressing both maternal and paternal genes.
Not only do fetal trophoblasts lack constitutive expression of class
II, they also resist induction of class II mRNA when exposed to IFN-
(although other IFN--inducible genes are still responsive)
(32, 33, 34). There is evidence that inhibition of class II
gene expression on trophoblast cells is important for pregnancy
outcome, as in some cases of chronic villitis of unestablished etiology
(a condition associated with recurrent spontaneous abortions) class II
expression is observed in the inflamed regions of the placenta
(35, 36). We and others have recently shown that CIITA
gene expression is absent and unable to be induced by IFN- treatment
in trophoblast-derived cell lines (34, 37). Introduction
of a CIITA expression plasmid into these cell lines restores MHC class
II gene expression at both the mRNA and protein levels, indicating that
inhibition of CIITA expression prevents class II transcription in this
cell type. The mechanism of CIITA transcription inhibition in these
cells is unknown.
There is considerable evidence that methylation of CpG dinucleotides can negatively affect transcription, either directly, by preventing transcription factor access to the DNA, or indirectly, by recruiting repressor molecules that bind methylated CpGs (reviewed in Ref. 38). In mammals, DNA methylation has been shown to be indispensable for development, as mice homozygous for a mutant DNA methyltransferase gene fail to develop past midgestation (39). In many cases, re-expression of genes shut down by methylation can be achieved by exposure to 5-aza-2'-deoxycytidine (5AC), an inhibitor of DNA methyltransferase (40).
In this report we have examined the cause of CIITA silencing in trophoblast-derived choriocarcinoma cells. Our results suggest that CIITA expression is prevented due to a failure to assemble regulatory factors at both CIITA promoters III and IV, but that the factors needed for CIITA transcription are present and can activate reporter gene expression. We present evidence suggesting that the absence of factor binding at pIV is caused by methylation of promoter IV DNA.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Raji, a B cell line derived from a patient with Burkitt’s
lymphoma (41), was grown in RPMI 1640 medium (Life
Technologies, Grand Island, NY) supplemented with 5% FCS (HyClone,
Logan, UT) and 5% bovine calf serum (HyClone). A431 (CRL-1555,
American Type Culture Collection, Manassas, VA), a human vulvar
epidermoid cancer cell line, was grown in DMEM (Mediatech, Washington,
DC) supplemented with 10% bovine calf serum. Jar (HTB-144, American
Type Culture Collection), a choriocarcinoma cell line, was grown in
RPMI 1640 medium supplemented with 10% FCS. JEG-3 (HTB-36, American
Type Culture Collection), another choriocarcinoma cell line, was grown
in DMEM supplemented with 10% FCS. All cell culture medium was
supplemented with 2 mM L-glutamine, 100 U/ml penicillin,
and 100 U/ml streptomycin (Life Technologies). For some experiments,
5AC (Sigma, St. Louis, MO) was added to cells to a final concentration
of 0.75–1 µM. Cells were incubated in 5AC for 3–7 days, at which
time the drug was washed out and grown in fresh medium with or without
200–500 U/ml IFN- (Biogen, Cambridge, MA) for the indicated
time.
In vivo genomic footprinting (IVGF)
IVGF was conducted as previously described (42, 43). Where indicated, cells were treated with IFN- for 8–24
h. The oligonucleotide sequences of the first-strand, PCR, and
extension primers were as follows: pIII coding strand,
5'-TCCCCTCACACCATTTTAATCTCCCAC, 5'-TGTCTTTAGACTGGCGAACCCCG, and
5'-CTGGCGAACCCCGGTGGAACG; pIII noncoding strand,
5'-GAAGGTGGCAGATATTGGCAGCT, 5'-CAGACTGTTGAAGGTTCCCCCAACA, and
5'-GGTTCCCCCAACAGACTTTCTGTGCAACTT; pIV coding strand,
5'CTGCTGGTGGCCTCTCCCTC, 5'-GCGGCAAGTCTGTGGCAGCT, and
5'-AGTCTGTGGCAGCTCGTCCGCTGGT; and pIV noncoding strand,
5'-AGAGAAACAGAGACCCACCCAGG, 5'-GGACTTGCAGATCACTTGCCCAAG, and
5'-CACTTGCCCAAGTGGCTCCCTAGCTCCT.
DNA constructions, transient transfections, and reporter assays
P3CIITA.CAT was constructed from pCAT-Basic (Promega, Madison, WI) and contains 320 bp of CIITA promoter III cloned upstream of the chloramphenicol acetyltransferase (CAT) gene. Similarly, p4CIITA.CAT contains 393 bp of CIITA promoter IV cloned upstream of CAT, and p3-p4CIITA.CAT contains promoters III and IV, as well as the genomic sequence between the two, cloned upstream of CAT.
Seven hundred picomoles of the CIITA promoter-reporter constructs and 2 µg of the luciferase control vector pGL3 (Promega) were cotransfected into Jar or JEG-3 cells by electroporation as described previously (44). Cells were harvested 2 days after transfection. CAT expression was determined by ELISA (Roche, Indianapolis, IN) according to the manufacturer’s instructions. Luciferase activity was measured on a FB12 Luminometer (Zylux, Maryville, TN) and was used to normalize the transfections for transfection efficiency. The results shown are the average of three independent transfections.
Southern blot analysis
Genomic DNA was isolated from Raji, A431, Jar, and JEG-3 cells as described previously (45). Five micrograms of genomic DNA was digested overnight with 10 U/µg of the indicated restriction enzyme. The digests were loaded onto a 1% agarose gel and transferred to nylon membrane. The membrane was then hybridized to a radiolabeled probe containing 393 bp of promoter IV. Bands were visualized by autoradiography or on a Molecular Dynamics Storm 860 PhosphorImager (Sunnyvale, CA).
RT-PCR analysis
Total cytoplasmic RNA was isolated from cells using the Nonidet P-40 lysis method, and RT-PCR was conducted as described previously (34). For the CIITA and DRA RT-PCR, 1.5 µg of RNA was used per reaction. For the GAPDH RT-PCR, 0.5 µg of RNA was used. PCR for 30 s at 94°C, 30 s at 55–60°C (depending on the gene), and 1 min at 72°C for the indicated number of cycles was performed. RT-PCR products were visualized on 1–1.5% agarose gels. The sequences of the PCR primers used are as follows: GAPDH5', 5'-CCATGGGGAAGGTGAAGGTCGGAGTC; GAPDH3', 5'-GAGGAGTGGGTGTCGCTGTTTGAAGTC; HLA-DRA5', 5'-CGACAAGTTCACCCCACCAGT; HLA-DRA3', 5'-CAGGAAAAGGCAATAGACAGG; CIITA-17, 5'-CCACTTGTATGACCAGATGGAC; and CIITA-38, 5'-CGTGGACAGTGAATCCACTG.
In vitro methylation
In vitro methylation reactions included 20 µg of plasmid DNA, 5 mM S-adenosylmethionine, and 8 U of SssI (or water for mock reactions). Methylation was conducted at 37°C for 8 h. Reactions were then extracted with phenol/chloroform and precipitated with ethanol. Plasmid methylation was confirmed by restriction digestion with the methylation-sensitive enzyme HpaII.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Jar choriocarcinoma cells were chosen for analysis because these cells showed the greatest response to transfected CIITA, were easy to grow in the laboratory, and, as shown below, can be induced under certain conditions to express MHC class II genes. Jar cells have been shown to be representative of some fetal trophoblast cells and have been used as a model of these cells in many studies (30, 32, 46, 47, 48). JEG-3, another choriocarcinoma cell line (30, 46, 47, 49), was used in some of the analyses as well.
Previous work demonstrated that CIITA expression in trophoblast cells
is blocked at the transcriptional level (34, 37). To
determine the molecular mechanism responsible for this block,
transcription factor assembly at the CIITA promoters was examined by
IVGF. As described above, CIITA is expressed from multiple promoters.
PIII is responsible for constitutive expression in B cells, and pIV is
primarily responsible for IFN--inducible expression. Both regulatory
regions are close to the start site of transcription of their
respective first exons. The in vivo footprints of genomic DNA isolated
from Raji B cells (express CIITA constitutively), A431 epithelial cells
with or without IFN- (express CIITA after stimulation with IFN-),
and Jar cells with or without IFN- (do not express CIITA under
either condition) were compared. Both promoters III and IV were
examined, because although pIII has mostly been associated with
constitutive expression of CIITA in B cells, there is evidence
suggesting that pIII also contributes to IFN--inducible expression
(21).
IVGF analysis of CIITA pIII in Raji B cells revealed two regions of
factor occupancy, which we have designated IIIA and IIIB, centered at
-138 and -57, respectively, from the pIII transcription start site
(Fig. 1
). The IIIB region also displayed
a constitutively hypersensitive G on the coding strand in both Raji and
A431 cells. The IIIA and IIIB sites as well as a third site centered at
-23 designated IIIC and possibly extending to -14, became protected
in A431 cells upon treatment with IFN-, supporting the results and
conclusions of Piskurich et al. (21) that elements of
promoter III contribute to IFN--inducible, as well as B cell
expression of, CIITA. However, these same regions remain unoccupied in
Jar cells treated with IFN-, suggesting that the factors that bind
these sites are either absent or unable to access the promoter in this
trophoblast cell line. Recently, Ghosh et al. (50)
identified several regions of in vivo occupancy within pIII that were
important for B cell expression. Three of these regions, -142 to
-133, -66 to -56, and -27 to -18, correspond to the sites we have
identified. Thus, our results confirm those of Ghosh et al. with B
cells and also indicate that these sites may be important for IFN-
induction of CIITA as well.
|
induction: a GAS element centered at -137, which binds the
factor STAT1, an adjacent E box, to which the factor USF-1 binds, and
an IRF-1 site centered at -60 (20, 51). IVGF analysis of
the STAT1/E box region of pIV showed no protection in untreated A431 or
Jar cells, suggesting that this region is inactive when the gene is
off. However, upon IFN- treatment of A431 cells, two protected Gs
and a hypersensitive site were observed (Fig. 2). The hypersensitive G lies just 3' of
the E box, one protected G is within the E box, and the other protected
G is in between the E box and the GAS element. This pattern is similar
to that described previously for pIV by Piskurich et al.
(21). No protection was observed on the noncoding strand
for promoter IV (data not shown). Furthermore, no protection or
hypersensitivity was seen at the same sites in DNA from Raji cells,
consistent with the hypothesis that B cells rely on expression of CIITA
from promoter III. As was the case with promoter III, no protection or
hypersensitivity was observed at the promoter IV sites in DNA isolated
from Jar cells treated with IFN-, indicating that CIITA
transcription is prevented in these cells due to an absence of factor
assembly at the promoter.
|
The absence of a footprint at promoters III and IV of Jar cells
could be due either to a lack of expression of the necessary
transcription factors in this cell type or to their inability to access
promoter DNA. To distinguish between these possibilities, reporter
constructs were created that contained either promoter III, promoter
IV, or the contiguous DNA containing both promoters III and IV, cloned
upstream of a promoterless CAT gene. The constructs were transiently
cotransfected with a constitutive luciferase reporter construct into
Jar cells. The transfected cells were left untreated or were treated
24 h later with IFN- for 16 h. The activity of the CAT
reporter gene was determined (Fig. 3).
Although the cells that were transfected with the pIII
construct (p3CIITA.CAT) showed no induction of CAT activity relative to
untreated controls, cells transfected with either the pIV (p4CIITA.CAT)
or the contiguous pIII-pIV (p3-p4fullCIITA.CAT) construct showed an
increase in CAT activity upon IFN- stimulation. The fold induction
of the construct containing only pIV was consistently higher than that
of the pIII-pIV construct, suggesting that negative
regulatory elements may exist in the region between the two promoters.
Nonetheless, the fact that both constructs are responsive to IFN- in
a transient transfection into Jar cells suggests that, at least for
CIITA type IV, the factors necessary for gene expression are present.
This is consistent with data reported previously showing that STAT1 and
IRF-1 are expressed in trophoblast cells (34). In
contrast, the factors that bind CIITA pIII may not be expressed or
correctly modified in trophoblasts, because the promoter III construct
was not responsive to IFN- after transfection. This raises the
intriguing possibility that access to the two promoters may be
regulated differently within the same cell type.
|
Because the factors necessary for transcription of CIITA pIV are
present in trophoblasts but do not bind the promoter DNA, we
investigated the possibility that occupancy of the regulatory regions
is prevented by promoter methylation at CpG dinucleotides. Several
reports have implicated methylation in the down-regulation of
transcription (38, 40, 52, 53). Although CIITA pIII does
not contain an appreciable number of CpG dinucleotides, pIV has several
that are centered around the transcription start site. To examine the
methylation status of CIITA pIV, genomic DNA was prepared from Raji,
A431, and Jar cells; digested with the methylation-sensitive
restriction enzymes SacII and BssHII; and
analyzed by Southern blot with a probe specific for pIV (Fig. 4). In Raji cells and A431 cells,
SacII and BssHII were able to digest the genomic
DNA and produced a pattern representative of nonmethylated DNA. In Jar
cells, however, the two sites were not cut, suggesting that the enzyme
recognition sequences are methylated in this cell type. To confirm this
interpretation, Jar cells were treated with 5AC, an inhibitor of DNA
methylation. Exposure of Jar cells for 72 h to 5AC rendered them
sensitive to digestion with SacII and BssHII,
suggesting that at least these two sites are differentially methylated
in Jar cells compared with other cell types. A similar observation was
made for JEG-3 cells (data not shown).
|
-inducible expression
of CIITA
The treatment of cells with 5AC has been used in several systems
to allow the re-expression of a gene that has been silenced by
methylation (reviewed in Ref. 40). Thus, to examine the
relevance of pIV methylation to CIITA expression, RNA was prepared from
Jar cells treated for 72 h with 5AC, followed by IFN-
treatment. RT-PCR was performed with primers specific for CIITA, the
class II gene HLA-DRA, and GAPDH as a control for loading (Fig. 5). The analysis showed that Jar cells
treated with 5AC expressed CIITA after exposure to IFN-, and this
expression was seen as early as 4 h after IFN- treatment. In
addition, Jar cells expressed HLA-DRA in response to IFN-, and as
expected (19), the kinetics of induction were slower than
those for CIITA. Jar cells treated with 5AC alone did not express
either transcript, indicating that demethylation is necessary, but not
sufficient, for expression of CIITA in trophoblasts. It should be noted
that IVGF could not be evaluated on 5AC-treated DNA due to its
sensitivity to cleavage by piperidine. Thus, in vivo factor occupancy
cannot be verified.
|
To confirm that the re-expression of CIITA observed after 5AC
treatment is due to a direct effect at CIITA pIV, reporter constructs
methylated in vitro were transiently transfected into Jar cells and
assayed for expression. Plasmids were incubated with SssI,
an enzyme that methylates cytosine residues within CpG dinucleotides.
Fig. 6A shows that methylated
DNA is not cleaved by the methylation-sensitive restriction enzyme
HpaII. The pIV and RSVCAT constructs, with or without
methylation, were transfected into Jar cells, and CAT activity
following IFN- treatment was determined (Fig. 6B).
Induction of CAT activity was severely inhibited in cells transfected
with the in vitro methylated pIV construct. In contrast, the control
plasmid RSVCAT was only moderately affected by in vitro methylation,
but this difference was not statistically significant
(p > 0.4). A similar analysis in JEG-3 cells
showed a >90% reduction in CIITA pIV activity as well (data not
shown). These results demonstrate that methylation is a direct cause of
transcriptional silencing at CIITA promoter IV.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. This inhibition is
probably due to the methylation of CpG dinucleotides within the pIV
promoter, as this region, which is responsible for activation of the
CIITA gene by IFN-, was methylated, and inhibition of methylation
led to re-expression of the CIITA gene. Moreover, methylated pIV DNA
was unable to stimulate expression in a transient transfection assay.
Thus, these results provide evidence for epigenetic regulation of CIITA
and suggest a novel mechanism for the control of CIITA and ultimately
MHC class II genes.
IVGF analysis revealed that sites in pIV that have been shown
previously to be required for IFN--inducible expression of CIITA
were unoccupied in Jar cells. In addition, sites were found in promoter
III that showed differential occupation in CIITA-expressing cells and
in Jar cells. A recent report by Ghosh et al. (50) showed
that two sites in promoter III, which they designated ARE-1 and ARE-2,
were critical for transcriptional activity. They also found several
other sites of protein/DNA interaction in pIII, a region designated
site A (-27 to -18). However, site A was not required for
transcription from the pIII promoter. Sites IIIA, IIIB, and IIIC,
identified by the IVGF analysis presented here, are located at the same
positions as ARE-1, ARE-2, and site A, respectively. Thus, our results
confirm the findings of Ghosh et al. and further suggest a role for
these regions in IFN- regulation of CIITA.
Transient transfection assays demonstrated that pIV is capable of driving transcription of a reporter gene in Jar cells, but pIII is not. This suggested that the transcription factors that act at pIV are present in Jar cells and can bind to naked DNA, but are prevented from reaching their target sites on the endogenous gene. One interpretation of this result is that transcriptional silencing is achieved through an epigenetic mechanism. This result is also consistent with earlier findings that STAT-1 and IRF-1, both of which are required for transcription from pIV (20, 51), are expressed in Jar cells. The fact that the pIII reporter construct was inactive suggests that in this case the regulatory factors that act at promoter III are either missing from Jar cells or are unable to activate transcription. This also explains why the pIII-pIV construct did not show increased CAT activity over pIV alone.
Southern blot and RT-PCR analysis suggested that the lack of basal and
IFN--inducible CIITA expression in Jar trophoblasts is due to
selective methylation of pIV. We also examined the methylation status
of pIV in another choriocarcinoma cell line, JEG-3, and obtained
similar results (data not shown). If methylation of the CIITA promoter
also occurs in primary trophoblast cells, this suggests at least one
mechanism that may explain maternal tolerance at the fetal-maternal
interface. Some studies have examined the affect of chronic exposure to
5AC on class II expression and embryo viability in mice and rats
(54, 55, 56), and the results have varied. Although
Athanassakis-Vassiliadis et al. (54) found that 5AC
induced class II expression in the placenta and that this correlated
with fetal loss, Gustafsson et al. (55) and Yuan et al.
(56) found no evidence of increased class II expression on
trophoblast cells after 5AC treatment. However, in none of these
studies was the methylation status of the CIITA gene examined either
before or after 5AC treatment, so it is unclear whether CIITA
re-expression (which is necessary for MHC class II gene expression) was
achieved.
In addition to the absence of class II, trophoblast cells do not
express classical MHC class I molecules, and this is also thought to
play a role in maternal tolerance to the fetal allograft. MHC class I
genes have been shown to be regulated in part by CIITA through its
action at the site region of the class I promoter
(57). Site is part of a X1, X2, Y box module that is
homologous to the MHC class II X-Y box region. Jar cells treated with
5AC re-express class I (58), and it is therefore tempting
to speculate that methylation of CIITA may be at least partially
responsible for the class I-negative phenotype of these cells. Recent
findings that transfection of trophoblast cells with CIITA restores
class I expression (49) support this hypothesis. The
methylation status of MHC class I genes in trophoblastic cell lines was
examined by Guillaudeux et al. (59) and was found to vary
depending on the cell line examined. It was therefore concluded that
methylation did not play a role in inhibition of class I gene
expression in trophoblasts. It is possible, however, that methylation
could play a role in class I expression by acting through inhibition of
CIITA gene expression rather than at the class I loci themselves.
This is the first time that methylation has been demonstrated to regulate the expression of CIITA, and it suggests a way in which one might experimentally control class II for therapeutic intervention. Future studies will explore whether methylation is specific for cells of trophoblast origin or if it is a global mechanism for regulation of CIITA in class II-negative tissues and during development.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jeremy M. Boss, Department of Microbiology and Immunology, Emory University School of Medicine, Atlanta, GA 30322.
3 Abbreviations used in this paper: RFX, regulatory factor X; CREB, cAMP response element-binding protein; NF-Y, nuclear factor-Y; 5AC, 5-aza-2'-deoxycytidine; CIITA, class II trans-activator; CAT, chloramphenicol acetyltransferase; GAS, IFN- activation sequence; IVGF, in vivo genomic footprinting; pIII, promoter III; pIV, promoter IV; IRF-1, IFN regulatory factor-1; RSV, Rous sarcoma virus.
Received for publication November 15, 1999. Accepted for publication February 8, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
response region 5' of the human histocompatibility leukocyte antigen DR chain gene which is active in human glioblastoma multiforme lines. J. Immunol. 138:1275.-inducible regulation of the HLA-DR gene. Proc. Natl. Acad. Sci. USA 85:8598. mediated by the transactivator gene CIITA. Science 265:106. mutants reveals that defects in CIITA or RFX result in defective class II MHC and Ii gene induction. Immunity 1:687.[Medline]
expression is involved in IFN- induction of the class II transactivator and class II MHC genes. J. Immunol. 157:1559.[Abstract]
interferon-inducible promoters of the major histocompatibility complex class II transactivator gene are differentially regulated by STAT1, interferon regulatory factor 1, and transforming growth factor ß. Mol. Cell. Biol. 19:431.
T cells. J. Immunol. 153:2918.[Abstract]
receptor in first trimester placenta to trophoblasts but lack of stimulation of HLA-DRA,-DRB, or invariant chain mRNA expression by IFN-. J. Immunol. 149:2675.[Abstract]
unresponsiveness. Transplant. Proc. 24:470.[Medline]
B p65 mediates the assembly and activation of the tumor necrosis factor responsive element of the murine monocyte chemoattractant-1 gene. J. Immunol. 162:727. insensitivity in human trophoblast cells. Biol. Reprod. 60:312. requires cooperative interaction between Stat1 and USF-1. Immunity 8:157.[Medline]
- and 5-azacytidine-treated mice. Biol. Reprod. 57:715.[Abstract]
-induced MHC class I transactivation: the ISRE-mediate route and a novel pathway involving CIITA. Immunity 6:601.[Medline]
This article has been cited by other articles:
|
|
 |
|
  A. De Lerma Barbaro, A. De Ambrosis, B. Banelli, G. L. Pira, O. Aresu, M. Romani, S. Ferrini, and R. S. Accolla Methylation of CIITA promoter IV causes loss of HLA-II inducibility by IFN-{gamma} in promyelocytic cells Int. Immunol., November 1, 2008; 20(11): 1457 - 1466. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Holling, M. W. T. Bergevoet, L. Wilson, M. C. J. A. Van Eggermond, E. Schooten, R. D. M. Steenbergen, P. J. F. Snijders, M. J. Jager, and P. J. Van den Elsen A Role for EZH2 in Silencing of IFN-{gamma} Inducible MHC2TA Transcription in Uveal Melanoma J. Immunol., October 15, 2007; 179(8): 5317 - 5325. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-D. Chou, A. N. H. Khan, W. J. Magner, and T. B. Tomasi Histone acetylation regulates the cell type specific CIITA promoters, MHC class II expression and antigen presentation in tumor cells Int. Immunol., November 1, 2005; 17(11): 1483 - 1494. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. M. Nagarajan, D. M. Ojcius, L. Stahl, R. G. Rank, and T. Darville Chlamydia trachomatis Induces Expression of IFN-{gamma}-Inducible Protein 10 and IFN-{beta} Independent of TLR2 and TLR4, but Largely Dependent on MyD88 J. Immunol., July 1, 2005; 175(1): 450 - 460. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Radosevich, Z. Song, J. C. Gorga, B. Ksander, and S. J. Ono Epigenetic Silencing of the CIITA Gene and Posttranscriptional Regulation of Class II MHC Genes in Ocular Melanoma Cells Invest. Ophthalmol. Vis. Sci., September 1, 2004; 45(9): 3185 - 3195. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. M. Nagarajan, A. B. Long, M. T. Harreman, A. H. Corbett, and J. M. Boss A Hierarchy of Nuclear Localization Signals Governs the Import of the Regulatory Factor X Complex Subunits and MHC Class II Expression J. Immunol., July 1, 2004; 173(1): 410 - 419. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Holling, E. Schooten, A. W. Langerak, and P. J. van den Elsen Regulation of MHC class II expression in human T-cell malignancies Blood, February 15, 2004; 103(4): 1438 - 1444. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Holtz, J. C. Choi, M. G. Petroff, J. F. Piskurich, and S. P. Murphy Class II Transactivator (CIITA) Promoter Methylation Does Not Correlate with Silencing of CIITA Transcription in Trophoblasts Biol Reprod, September 1, 2003; 69(3): 915 - 924. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. K. Pai, M. Convery, T. A. Hamilton, W. H. Boom, and C. V. Harding Inhibition of IFN-{gamma}-Induced Class II Transactivator Expression by a 19-kDa Lipoprotein from Mycobacterium tuberculosis: A Potential Mechanism for Immune Evasion J. Immunol., July 1, 2003; 171(1): 175 - 184. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. van den Elsen, N. van der Stoep, and T. Yazawa Class II Transactivator (CIITA) Deficiency in Tumor Cells: Complicated Mechanisms or Not? Am. J. Pathol., July 1, 2003; 163(1): 373 - 376. [Full Text] [PDF]
|
|
|
|
|
|
T. Kanaseki, H. Ikeda, Y. Takamura, M. Toyota, Y. Hirohashi, T. Tokino, T. Himi, and N. Sato Histone Deacetylation, But Not Hypermethylation, Modifies Class II Transactivator and MHC Class II Gene Expression in Squamous Cell Carcinomas J. Immunol., May 15, 2003; 170(10): 4980 - 4985. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Moreau, G. Mouillot, P. Rousseau, C. Marcou, J. Dausset, and E. D. Carosella HLA-G gene repression is reversed by demethylation PNAS, February 4, 2003; 100(3): 1191 - 1196. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. van der Stoep, E. Quinten, and P. J. van den Elsen Transcriptional Regulation of the MHC Class II Trans-Activator (CIITA) Promoter III: Identification of a Novel Regulatory Region in the 5'-Untranslated Region and an Important Role for cAMP-Responsive Element Binding Protein 1 and Activating Transcription Factor-1 in CIITA-Promoter III Transcriptional Activation in B Lymphocytes J. Immunol., November 1, 2002; 169(9): 5061 - 5071. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. P. Murphy, R. Holtz, N. Lewandowski, T. B. Tomasi, and H. Fuji DNA Alkylating Agents Alleviate Silencing of Class II Transactivator Gene Expression in L1210 Lymphoma Cells J. Immunol., September 15, 2002; 169(6): 3085 - 3093. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. K. Pai, D. Askew, W. H. Boom, and C. V. Harding Regulation of Class II MHC Expression in APCs: Roles of Types I, III, and IV Class II Transactivator J. Immunol., August 1, 2002; 169(3): 1326 - 1333. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. C. Morris, G. W. Beresford, M. R. Mooney, and J. M. Boss Kinetics of a Gamma Interferon Re |
, Protected Gs; •, hypersensitive sites. The
dashed line at IIIC in B indicates a weak protection.
The results shown are representative of at least three independent
experiments. The genomic sequence of the region examined by IVGF is
depicted in C, with the darker boxes indicating regions
of strong protection and the lighter box indicating the weak protection
at IIIC.
4-kb band
(top arrow), whereas complete digestion with
XbaI and SacII or BssHII
releases a 1-kb band (bottom arrow). The region covered
by the probe is indicated under the schematic map of the CIITA
promoters.
