The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morris, A. C.
Right arrow Articles by Boss, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morris, A. C.
Right arrow Articles by Boss, J. M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*AZACITIDINE
The Journal of Immunology, 2000, 164: 4143-4149.
Copyright © 2000 by The American Association of Immunologists

Methylation of Class II trans-Activator Promoter IV: A Novel Mechanism of MHC Class II Gene Control1

Ann C. Morris, Wendi E. Spangler and Jeremy M. Boss2

Department of Microbiology and Immunology, Emory University School of Medicine, Atlanta, GA 30322


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inhibition of class II trans-activator (CIITA) expression prevents embryonic trophoblast cells from up-regulating MHC class II genes in response to IFN-{gamma}. This is thought to be one mechanism of maternal tolerance to the fetal allograft. The CIITA gene is regulated by four distinct promoters; promoter III directs constitutive (B cell) expression, and promoter IV regulates IFN-{gamma}-inducible expression. Using in vivo genomic footprinting, promoter-reporter analysis, Southern blot analysis, and RT-PCR, we have examined the cause of CIITA silencing in a trophoblast-derived cell line. We report here that methylation of promoter IV DNA at CpG sites in Jar cells prevents promoter occupancy and IFN-{gamma}-inducible transcription. The inhibition of CpG methylation in Jar cells by treatment with 5-aza-2'-deoxycytidine restores IFN-{gamma} inducibility to CIITA. This is the first description of an epigenetic mechanism involved in regulation of CIITA and MHC class II gene expression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The MHC class II molecules are {alpha}/ß heterodimers that participate in the adaptive arm of the immune response by presenting endogenously derived antigenic peptides to CD4+ T cells. Although the normal pattern of expression of MHC class II genes is restricted to APCs, thymic epithelium, and B cells (1, 2), class II induction can occur on most cell types through exposure to various cytokines, the most potent of which is IFN-{gamma} (1, 3, 4, 5). Expression of MHC class II on cells other than APCs can aid in the initiation of an acute immune response. However, aberrant expression of class II in inappropriate tissues, such as in cases of autoimmune disease, can have deleterious consequences. It is therefore crucial that the timing and location of expression of class II molecules be carefully controlled.

The genes encoding the three MHC class II isotypes, HLA-DR, -DQ, and –DP, as well as the HLA-DM and invariant chain genes are all coordinately regulated at the transcriptional level by a set of conserved cis-acting promoter elements termed the W, X1, X2, and Y boxes (reviewed in Refs. 2 and 6). The X1 and X2 boxes are both necessary and sufficient to direct class II expression in B cells (7, 8). They are bound by the regulatory factor X (RFX)3 and cAMP response element binding protein (CREB), respectively (9, 10, 11). The Y box is required for maximal class II expression and is bound by the heterotrimeric factor NF-Y (12). The factors that bind the W box have not been well characterized. Although RFX and CREB are both necessary for promoter activity, their presence is not sufficient to activate gene expression. The other essential component of this system is the class II trans-activator (CIITA), a non-DNA-binding protein (13, 14, 15). CIITA expression correlates directly with MHC class II expression and is induced by IFN-{gamma} in a time frame that precedes MHC class II gene expression (16, 17, 18, 19). Cells negative for CIITA are also MHC class II negative. Thus, CIITA expression functions as a molecular switch for MHC class II gene regulation.

Transcription of CIITA is regulated by four distinct promoters that direct the transcription of four separate first exons spliced to a common second exon (20). Promoter I is involved in dendritic cell expression. The function of promoter II is unknown. Promoter III drives constitutive expression of CIITA, such as that observed in B cells, and promoter IV controls the IFN-{gamma}-inducible expression of CIITA seen in most other cell types (20). There has also been a report that promoter III contributes to IFN-{gamma}-inducible CIITA expression (21).

The inhibition of expression of MHC class II genes on fetal trophoblast cells is one of the numerous mechanisms that have been proposed to explain the phenomenon of maternal-fetal tolerance during pregnancy (22, 23, 24, 25, 26, 27, 28, 29, 30, 31), whereby the maternal immune system fails to react to placental tissues expressing both maternal and paternal genes. Not only do fetal trophoblasts lack constitutive expression of class II, they also resist induction of class II mRNA when exposed to IFN-{gamma} (although other IFN-{gamma}-inducible genes are still responsive) (32, 33, 34). There is evidence that inhibition of class II gene expression on trophoblast cells is important for pregnancy outcome, as in some cases of chronic villitis of unestablished etiology (a condition associated with recurrent spontaneous abortions) class II expression is observed in the inflamed regions of the placenta (35, 36). We and others have recently shown that CIITA gene expression is absent and unable to be induced by IFN-{gamma} treatment in trophoblast-derived cell lines (34, 37). Introduction of a CIITA expression plasmid into these cell lines restores MHC class II gene expression at both the mRNA and protein levels, indicating that inhibition of CIITA expression prevents class II transcription in this cell type. The mechanism of CIITA transcription inhibition in these cells is unknown.

There is considerable evidence that methylation of CpG dinucleotides can negatively affect transcription, either directly, by preventing transcription factor access to the DNA, or indirectly, by recruiting repressor molecules that bind methylated CpGs (reviewed in Ref. 38). In mammals, DNA methylation has been shown to be indispensable for development, as mice homozygous for a mutant DNA methyltransferase gene fail to develop past midgestation (39). In many cases, re-expression of genes shut down by methylation can be achieved by exposure to 5-aza-2'-deoxycytidine (5AC), an inhibitor of DNA methyltransferase (40).

In this report we have examined the cause of CIITA silencing in trophoblast-derived choriocarcinoma cells. Our results suggest that CIITA expression is prevented due to a failure to assemble regulatory factors at both CIITA promoters III and IV, but that the factors needed for CIITA transcription are present and can activate reporter gene expression. We present evidence suggesting that the absence of factor binding at pIV is caused by methylation of promoter IV DNA.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells and cell culture

Raji, a B cell line derived from a patient with Burkitt’s lymphoma (41), was grown in RPMI 1640 medium (Life Technologies, Grand Island, NY) supplemented with 5% FCS (HyClone, Logan, UT) and 5% bovine calf serum (HyClone). A431 (CRL-1555, American Type Culture Collection, Manassas, VA), a human vulvar epidermoid cancer cell line, was grown in DMEM (Mediatech, Washington, DC) supplemented with 10% bovine calf serum. Jar (HTB-144, American Type Culture Collection), a choriocarcinoma cell line, was grown in RPMI 1640 medium supplemented with 10% FCS. JEG-3 (HTB-36, American Type Culture Collection), another choriocarcinoma cell line, was grown in DMEM supplemented with 10% FCS. All cell culture medium was supplemented with 2 mM L-glutamine, 100 U/ml penicillin, and 100 U/ml streptomycin (Life Technologies). For some experiments, 5AC (Sigma, St. Louis, MO) was added to cells to a final concentration of 0.75–1 µM. Cells were incubated in 5AC for 3–7 days, at which time the drug was washed out and grown in fresh medium with or without 200–500 U/ml IFN-{gamma} (Biogen, Cambridge, MA) for the indicated time.

In vivo genomic footprinting (IVGF)

IVGF was conducted as previously described (42, 43). Where indicated, cells were treated with IFN-{gamma} for 8–24 h. The oligonucleotide sequences of the first-strand, PCR, and extension primers were as follows: pIII coding strand, 5'-TCCCCTCACACCATTTTAATCTCCCAC, 5'-TGTCTTTAGACTGGCGAACCCCG, and 5'-CTGGCGAACCCCGGTGGAACG; pIII noncoding strand, 5'-GAAGGTGGCAGATATTGGCAGCT, 5'-CAGACTGTTGAAGGTTCCCCCAACA, and 5'-GGTTCCCCCAACAGACTTTCTGTGCAACTT; pIV coding strand, 5'CTGCTGGTGGCCTCTCCCTC, 5'-GCGGCAAGTCTGTGGCAGCT, and 5'-AGTCTGTGGCAGCTCGTCCGCTGGT; and pIV noncoding strand, 5'-AGAGAAACAGAGACCCACCCAGG, 5'-GGACTTGCAGATCACTTGCCCAAG, and 5'-CACTTGCCCAAGTGGCTCCCTAGCTCCT.

DNA constructions, transient transfections, and reporter assays

P3CIITA.CAT was constructed from pCAT-Basic (Promega, Madison, WI) and contains 320 bp of CIITA promoter III cloned upstream of the chloramphenicol acetyltransferase (CAT) gene. Similarly, p4CIITA.CAT contains 393 bp of CIITA promoter IV cloned upstream of CAT, and p3-p4CIITA.CAT contains promoters III and IV, as well as the genomic sequence between the two, cloned upstream of CAT.

Seven hundred picomoles of the CIITA promoter-reporter constructs and 2 µg of the luciferase control vector pGL3 (Promega) were cotransfected into Jar or JEG-3 cells by electroporation as described previously (44). Cells were harvested 2 days after transfection. CAT expression was determined by ELISA (Roche, Indianapolis, IN) according to the manufacturer’s instructions. Luciferase activity was measured on a FB12 Luminometer (Zylux, Maryville, TN) and was used to normalize the transfections for transfection efficiency. The results shown are the average of three independent transfections.

Southern blot analysis

Genomic DNA was isolated from Raji, A431, Jar, and JEG-3 cells as described previously (45). Five micrograms of genomic DNA was digested overnight with 10 U/µg of the indicated restriction enzyme. The digests were loaded onto a 1% agarose gel and transferred to nylon membrane. The membrane was then hybridized to a radiolabeled probe containing 393 bp of promoter IV. Bands were visualized by autoradiography or on a Molecular Dynamics Storm 860 PhosphorImager (Sunnyvale, CA).

RT-PCR analysis

Total cytoplasmic RNA was isolated from cells using the Nonidet P-40 lysis method, and RT-PCR was conducted as described previously (34). For the CIITA and DRA RT-PCR, 1.5 µg of RNA was used per reaction. For the GAPDH RT-PCR, 0.5 µg of RNA was used. PCR for 30 s at 94°C, 30 s at 55–60°C (depending on the gene), and 1 min at 72°C for the indicated number of cycles was performed. RT-PCR products were visualized on 1–1.5% agarose gels. The sequences of the PCR primers used are as follows: GAPDH5', 5'-CCATGGGGAAGGTGAAGGTCGGAGTC; GAPDH3', 5'-GAGGAGTGGGTGTCGCTGTTTGAAGTC; HLA-DRA5', 5'-CGACAAGTTCACCCCACCAGT; HLA-DRA3', 5'-CAGGAAAAGGCAATAGACAGG; CIITA-17, 5'-CCACTTGTATGACCAGATGGAC; and CIITA-38, 5'-CGTGGACAGTGAATCCACTG.

In vitro methylation

In vitro methylation reactions included 20 µg of plasmid DNA, 5 mM S-adenosylmethionine, and 8 U of SssI (or water for mock reactions). Methylation was conducted at 37°C for 8 h. Reactions were then extracted with phenol/chloroform and precipitated with ethanol. Plasmid methylation was confirmed by restriction digestion with the methylation-sensitive enzyme HpaII.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Factor assembly at CIITA promoters III and IV does not occur in trophoblast cells

Jar choriocarcinoma cells were chosen for analysis because these cells showed the greatest response to transfected CIITA, were easy to grow in the laboratory, and, as shown below, can be induced under certain conditions to express MHC class II genes. Jar cells have been shown to be representative of some fetal trophoblast cells and have been used as a model of these cells in many studies (30, 32, 46, 47, 48). JEG-3, another choriocarcinoma cell line (30, 46, 47, 49), was used in some of the analyses as well.

Previous work demonstrated that CIITA expression in trophoblast cells is blocked at the transcriptional level (34, 37). To determine the molecular mechanism responsible for this block, transcription factor assembly at the CIITA promoters was examined by IVGF. As described above, CIITA is expressed from multiple promoters. PIII is responsible for constitutive expression in B cells, and pIV is primarily responsible for IFN-{gamma}-inducible expression. Both regulatory regions are close to the start site of transcription of their respective first exons. The in vivo footprints of genomic DNA isolated from Raji B cells (express CIITA constitutively), A431 epithelial cells with or without IFN-{gamma} (express CIITA after stimulation with IFN-{gamma}), and Jar cells with or without IFN-{gamma} (do not express CIITA under either condition) were compared. Both promoters III and IV were examined, because although pIII has mostly been associated with constitutive expression of CIITA in B cells, there is evidence suggesting that pIII also contributes to IFN-{gamma}-inducible expression (21).

IVGF analysis of CIITA pIII in Raji B cells revealed two regions of factor occupancy, which we have designated IIIA and IIIB, centered at -138 and -57, respectively, from the pIII transcription start site (Fig. 1Go). The IIIB region also displayed a constitutively hypersensitive G on the coding strand in both Raji and A431 cells. The IIIA and IIIB sites as well as a third site centered at -23 designated IIIC and possibly extending to -14, became protected in A431 cells upon treatment with IFN-{gamma}, supporting the results and conclusions of Piskurich et al. (21) that elements of promoter III contribute to IFN-{gamma}-inducible, as well as B cell expression of, CIITA. However, these same regions remain unoccupied in Jar cells treated with IFN-{gamma}, suggesting that the factors that bind these sites are either absent or unable to access the promoter in this trophoblast cell line. Recently, Ghosh et al. (50) identified several regions of in vivo occupancy within pIII that were important for B cell expression. Three of these regions, -142 to -133, -66 to -56, and -27 to -18, correspond to the sites we have identified. Thus, our results confirm those of Ghosh et al. with B cells and also indicate that these sites may be important for IFN-{gamma} induction of CIITA as well.



View larger version (80K):
[in this window]
[in a new window]
 
FIGURE 1. Factor assembly does not occur on CIITA promoter III in trophoblasts. IVGF for the promoter III region of the CIITA gene in various cell types is shown for the coding strand (A) and the noncoding strand (B). Lanes marked with a V indicate in vitro methylated DNA. {circ}, Protected Gs; •, hypersensitive sites. The dashed line at IIIC in B indicates a weak protection. The results shown are representative of at least three independent experiments. The genomic sequence of the region examined by IVGF is depicted in C, with the darker boxes indicating regions of strong protection and the lighter box indicating the weak protection at IIIC.

 
In CIITA pIV, three sites were previously shown to be required for IFN-{gamma} induction: a GAS element centered at -137, which binds the factor STAT1, an adjacent E box, to which the factor USF-1 binds, and an IRF-1 site centered at -60 (20, 51). IVGF analysis of the STAT1/E box region of pIV showed no protection in untreated A431 or Jar cells, suggesting that this region is inactive when the gene is off. However, upon IFN-{gamma} treatment of A431 cells, two protected Gs and a hypersensitive site were observed (Fig. 2Go). The hypersensitive G lies just 3' of the E box, one protected G is within the E box, and the other protected G is in between the E box and the GAS element. This pattern is similar to that described previously for pIV by Piskurich et al. (21). No protection was observed on the noncoding strand for promoter IV (data not shown). Furthermore, no protection or hypersensitivity was seen at the same sites in DNA from Raji cells, consistent with the hypothesis that B cells rely on expression of CIITA from promoter III. As was the case with promoter III, no protection or hypersensitivity was observed at the promoter IV sites in DNA isolated from Jar cells treated with IFN-{gamma}, indicating that CIITA transcription is prevented in these cells due to an absence of factor assembly at the promoter.



View larger version (60K):
[in this window]
[in a new window]
 
FIGURE 2. The GAS and USF-1 elements are occupied in vivo in A431 cells treated with IFN-{gamma}, but not in untreated A431, Raji, or Jar cells. IVGF of the coding strand for the promoter IV region of CIITA is shown, along with a sequence summary of the region. {circ}, Protection; •, hypersensitivity. The in vitro methylated DNA lane is marked with a V.

 
The factors required for transcription of CIITA type IV are present in Jar cells

The absence of a footprint at promoters III and IV of Jar cells could be due either to a lack of expression of the necessary transcription factors in this cell type or to their inability to access promoter DNA. To distinguish between these possibilities, reporter constructs were created that contained either promoter III, promoter IV, or the contiguous DNA containing both promoters III and IV, cloned upstream of a promoterless CAT gene. The constructs were transiently cotransfected with a constitutive luciferase reporter construct into Jar cells. The transfected cells were left untreated or were treated 24 h later with IFN-{gamma} for 16 h. The activity of the CAT reporter gene was determined (Fig. 3Go). Although the cells that were transfected with the pIII construct (p3CIITA.CAT) showed no induction of CAT activity relative to untreated controls, cells transfected with either the pIV (p4CIITA.CAT) or the contiguous pIII-pIV (p3-p4fullCIITA.CAT) construct showed an increase in CAT activity upon IFN-{gamma} stimulation. The fold induction of the construct containing only pIV was consistently higher than that of the pIII-pIV construct, suggesting that negative regulatory elements may exist in the region between the two promoters. Nonetheless, the fact that both constructs are responsive to IFN-{gamma} in a transient transfection into Jar cells suggests that, at least for CIITA type IV, the factors necessary for gene expression are present. This is consistent with data reported previously showing that STAT1 and IRF-1 are expressed in trophoblast cells (34). In contrast, the factors that bind CIITA pIII may not be expressed or correctly modified in trophoblasts, because the promoter III construct was not responsive to IFN-{gamma} after transfection. This raises the intriguing possibility that access to the two promoters may be regulated differently within the same cell type.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 3. Reporter constructs containing pIV are active in trophoblast cells. Schematic maps of the CIITA pIII and pIV regions and the promoter-reporter constructs are shown. Transient transfections were performed as described in Materials and Methods. CAT ELISA data from three independent experiments were normalized to cotransfected luciferase activity, averaged, and plotted as OD units. The average fold induction of CAT activity after IFN-{gamma} treatment is indicated.

 
CIITA promoter IV is methylated near the transcription start site in trophoblasts

Because the factors necessary for transcription of CIITA pIV are present in trophoblasts but do not bind the promoter DNA, we investigated the possibility that occupancy of the regulatory regions is prevented by promoter methylation at CpG dinucleotides. Several reports have implicated methylation in the down-regulation of transcription (38, 40, 52, 53). Although CIITA pIII does not contain an appreciable number of CpG dinucleotides, pIV has several that are centered around the transcription start site. To examine the methylation status of CIITA pIV, genomic DNA was prepared from Raji, A431, and Jar cells; digested with the methylation-sensitive restriction enzymes SacII and BssHII; and analyzed by Southern blot with a probe specific for pIV (Fig. 4Go). In Raji cells and A431 cells, SacII and BssHII were able to digest the genomic DNA and produced a pattern representative of nonmethylated DNA. In Jar cells, however, the two sites were not cut, suggesting that the enzyme recognition sequences are methylated in this cell type. To confirm this interpretation, Jar cells were treated with 5AC, an inhibitor of DNA methylation. Exposure of Jar cells for 72 h to 5AC rendered them sensitive to digestion with SacII and BssHII, suggesting that at least these two sites are differentially methylated in Jar cells compared with other cell types. A similar observation was made for JEG-3 cells (data not shown).



View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 4. CpG sites in pIV are methylated in Jar cells, but not in Raji or A431 cells. Genomic DNA from Raji, A431, untreated Jar cells, and Jar cells treated with 5AC was digested with either XbaI alone or XbaI plus SacII or BssHII. Digested DNA was analyzed by Southern blot as described in Materials and Methods. XbaI digestion alone yields an ~4-kb band (top arrow), whereas complete digestion with XbaI and SacII or BssHII releases a 1-kb band (bottom arrow). The region covered by the probe is indicated under the schematic map of the CIITA promoters.

 
Exposure of Jar cells to 5AC restores IFN-{gamma}-inducible expression of CIITA

The treatment of cells with 5AC has been used in several systems to allow the re-expression of a gene that has been silenced by methylation (reviewed in Ref. 40). Thus, to examine the relevance of pIV methylation to CIITA expression, RNA was prepared from Jar cells treated for 72 h with 5AC, followed by IFN-{gamma} treatment. RT-PCR was performed with primers specific for CIITA, the class II gene HLA-DRA, and GAPDH as a control for loading (Fig. 5Go). The analysis showed that Jar cells treated with 5AC expressed CIITA after exposure to IFN-{gamma}, and this expression was seen as early as 4 h after IFN-{gamma} treatment. In addition, Jar cells expressed HLA-DRA in response to IFN-{gamma}, and as expected (19), the kinetics of induction were slower than those for CIITA. Jar cells treated with 5AC alone did not express either transcript, indicating that demethylation is necessary, but not sufficient, for expression of CIITA in trophoblasts. It should be noted that IVGF could not be evaluated on 5AC-treated DNA due to its sensitivity to cleavage by piperidine. Thus, in vivo factor occupancy cannot be verified.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 5. Treatment of Jar cells with 5AC restores IFN-{gamma} inducibility to both CIITA and class II MHC genes. RNA prepared from Raji cells, untreated Jar cells (with or without IFN-{gamma}), and Jar cells treated with 5AC (with or without IFN-{gamma}) was subjected to RT-PCR with primers specific for CIITA (32 cycles), HLA-DRA (32 cycles), and GAPDH (30 cycles). RT-PCR reactions for each sample were performed with and without reverse transcriptase (RT). The PCR products were visualized on an agarose gel.

 
In vitro methylation inhibits pIV promoter activity

To confirm that the re-expression of CIITA observed after 5AC treatment is due to a direct effect at CIITA pIV, reporter constructs methylated in vitro were transiently transfected into Jar cells and assayed for expression. Plasmids were incubated with SssI, an enzyme that methylates cytosine residues within CpG dinucleotides. Fig. 6GoA shows that methylated DNA is not cleaved by the methylation-sensitive restriction enzyme HpaII. The pIV and RSVCAT constructs, with or without methylation, were transfected into Jar cells, and CAT activity following IFN-{gamma} treatment was determined (Fig. 6GoB). Induction of CAT activity was severely inhibited in cells transfected with the in vitro methylated pIV construct. In contrast, the control plasmid RSVCAT was only moderately affected by in vitro methylation, but this difference was not statistically significant (p > 0.4). A similar analysis in JEG-3 cells showed a >90% reduction in CIITA pIV activity as well (data not shown). These results demonstrate that methylation is a direct cause of transcriptional silencing at CIITA promoter IV.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 6. In vitro methylation of promoter IV reduces reporter gene activity. A, The RSVCAT and p4CIITA.CAT constructs were incubated with SssI methylase (meRSVCAT and me-p4CIITA.CAT) or with water (RSVCAT and p4CIITA.CAT). Methylation of the constructs was verified by incubation with NcoI alone (N) or with NcoI and the methylation-sensitive enzyme HpaII (N/H). A representative digest is shown. B, Methylated or unmethylated constructions were transfected into Jar cells, and cells transfected with either p4CIITA.CAT or me-p4CIITA.CAT were treated with IFN-{gamma} 24 h after transfection. CAT activity was measured by ELISA 48 h after transfection. The data represent the result of three independent transfections.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results of this study indicate that expression of CIITA in Jar cells is inhibited due to a lack of binding of transcription factors at the CIITA promoter upon exposure to IFN-{gamma}. This inhibition is probably due to the methylation of CpG dinucleotides within the pIV promoter, as this region, which is responsible for activation of the CIITA gene by IFN-{gamma}, was methylated, and inhibition of methylation led to re-expression of the CIITA gene. Moreover, methylated pIV DNA was unable to stimulate expression in a transient transfection assay. Thus, these results provide evidence for epigenetic regulation of CIITA and suggest a novel mechanism for the control of CIITA and ultimately MHC class II genes.

IVGF analysis revealed that sites in pIV that have been shown previously to be required for IFN-{gamma}-inducible expression of CIITA were unoccupied in Jar cells. In addition, sites were found in promoter III that showed differential occupation in CIITA-expressing cells and in Jar cells. A recent report by Ghosh et al. (50) showed that two sites in promoter III, which they designated ARE-1 and ARE-2, were critical for transcriptional activity. They also found several other sites of protein/DNA interaction in pIII, a region designated site A (-27 to -18). However, site A was not required for transcription from the pIII promoter. Sites IIIA, IIIB, and IIIC, identified by the IVGF analysis presented here, are located at the same positions as ARE-1, ARE-2, and site A, respectively. Thus, our results confirm the findings of Ghosh et al. and further suggest a role for these regions in IFN-{gamma} regulation of CIITA.

Transient transfection assays demonstrated that pIV is capable of driving transcription of a reporter gene in Jar cells, but pIII is not. This suggested that the transcription factors that act at pIV are present in Jar cells and can bind to naked DNA, but are prevented from reaching their target sites on the endogenous gene. One interpretation of this result is that transcriptional silencing is achieved through an epigenetic mechanism. This result is also consistent with earlier findings that STAT-1 and IRF-1, both of which are required for transcription from pIV (20, 51), are expressed in Jar cells. The fact that the pIII reporter construct was inactive suggests that in this case the regulatory factors that act at promoter III are either missing from Jar cells or are unable to activate transcription. This also explains why the pIII-pIV construct did not show increased CAT activity over pIV alone.

Southern blot and RT-PCR analysis suggested that the lack of basal and IFN-{gamma}-inducible CIITA expression in Jar trophoblasts is due to selective methylation of pIV. We also examined the methylation status of pIV in another choriocarcinoma cell line, JEG-3, and obtained similar results (data not shown). If methylation of the CIITA promoter also occurs in primary trophoblast cells, this suggests at least one mechanism that may explain maternal tolerance at the fetal-maternal interface. Some studies have examined the affect of chronic exposure to 5AC on class II expression and embryo viability in mice and rats (54, 55, 56), and the results have varied. Although Athanassakis-Vassiliadis et al. (54) found that 5AC induced class II expression in the placenta and that this correlated with fetal loss, Gustafsson et al. (55) and Yuan et al. (56) found no evidence of increased class II expression on trophoblast cells after 5AC treatment. However, in none of these studies was the methylation status of the CIITA gene examined either before or after 5AC treatment, so it is unclear whether CIITA re-expression (which is necessary for MHC class II gene expression) was achieved.

In addition to the absence of class II, trophoblast cells do not express classical MHC class I molecules, and this is also thought to play a role in maternal tolerance to the fetal allograft. MHC class I genes have been shown to be regulated in part by CIITA through its action at the site {alpha} region of the class I promoter (57). Site {alpha} is part of a X1, X2, Y box module that is homologous to the MHC class II X-Y box region. Jar cells treated with 5AC re-express class I (58), and it is therefore tempting to speculate that methylation of CIITA may be at least partially responsible for the class I-negative phenotype of these cells. Recent findings that transfection of trophoblast cells with CIITA restores class I expression (49) support this hypothesis. The methylation status of MHC class I genes in trophoblastic cell lines was examined by Guillaudeux et al. (59) and was found to vary depending on the cell line examined. It was therefore concluded that methylation did not play a role in inhibition of class I gene expression in trophoblasts. It is possible, however, that methylation could play a role in class I expression by acting through inhibition of CIITA gene expression rather than at the class I loci themselves.

This is the first time that methylation has been demonstrated to regulate the expression of CIITA, and it suggests a way in which one might experimentally control class II for therapeutic intervention. Future studies will explore whether methylation is specific for cells of trophoblast origin or if it is a global mechanism for regulation of CIITA in class II-negative tissues and during development.


    Acknowledgments
 
We thank Dr. M. Brown for critical reading of the manuscript.


    Footnotes
 
1 This work was supported by National Institutes of Health Grant HD34440 and Predoctoral National Institutes of Health Training Grant GM849002 (to A.C.M.). Back

2 Address correspondence and reprint requests to Dr. Jeremy M. Boss, Department of Microbiology and Immunology, Emory University School of Medicine, Atlanta, GA 30322. Back

3 Abbreviations used in this paper: RFX, regulatory factor X; CREB, cAMP response element-binding protein; NF-Y, nuclear factor-Y; 5AC, 5-aza-2'-deoxycytidine; CIITA, class II trans-activator; CAT, chloramphenicol acetyltransferase; GAS, IFN-{gamma} activation sequence; IVGF, in vivo genomic footprinting; pIII, promoter III; pIV, promoter IV; IRF-1, IFN regulatory factor-1; RSV, Rous sarcoma virus. Back

Received for publication November 15, 1999. Accepted for publication February 8, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kappes, D., J. L. Strominger. 1988. Human class II major histocompatibility complex genes and proteins. Annu. Rev. Biochem. 57:991.[Medline]
  2. Glimcher, L. H., and C. J. Kara. 1992. Sequences and factors: a guide to MHC class II transcription. In Annual Reviews of Immunology, 10th Ed. W. E. Paul, C. Garrison Fathman, and H. Metzger, eds. Annual Reviews, Palo Alto, p. 13.
  3. Pober, J. S., Jr T. Collins, M. A. Gimbone, R. S. Cotran, J. D. Gitlin, W. Fiers, C. Clayberber, A. M. Krensky, S. J. Burakoff, C. S. Reiss. 1983. Lymphocytes recognize human vascular endothelial and dermal fibroblast Ia antigens induced by recombinant immune interferon. Nature 305:726.[Medline]
  4. Boss, J. M., J. L. Strominger. 1986. Regulation of a transfected human class II major histocompatibility complex gene in human fibroblasts. Proc. Natl. Acad. Sci. USA 83:9139.[Abstract/Free Full Text]
  5. Basta, P. V., P. A. Sherman, J. P. Ting. 1987. Identification of an interferon-{gamma} response region 5' of the human histocompatibility leukocyte antigen DR {alpha} chain gene which is active in human glioblastoma multiforme lines. J. Immunol. 138:1275.[Abstract/Free Full Text]
  6. Boss, J. M.. 1997. Regulation of transcription of MHC class II genes. Curr. Opin. Immunol. 9:107.[Medline]
  7. Wright, K. L.. 1988. Conserved upstream sequences of human class II major histocompatibility genes enhance expression of class II genes in wild-type but not mutant B-cell lines. Proc. Natl. Acad. Sci. USA 85:8186.[Abstract/Free Full Text]
  8. Tsang, S. Y., M. Nakanishi, B. M. Peterlin. 1988. B-cell-specific and interferon-{gamma}-inducible regulation of the HLA-DR {alpha} gene. Proc. Natl. Acad. Sci. USA 85:8598.[Abstract/Free Full Text]
  9. Hasegawa, S. L., J. M. Boss. 1991. Two distinct B cell factors bind the HLA-DRA X box region and recognize different subsets of MHC class II promoters. Nucleic Acids Res. 19:6269.[Abstract/Free Full Text]
  10. Moreno, C. S., P. Emery, J. E. West, B. Durand, W. Reith, B. Mach, J. M. Boss. 1995. Purified X2BP cooperatively binds the class II MHC X box region in the presence of purified RFX, the X box factor deficient in the bare lymphocyte syndrome. J. Immunol. 155:4313.[Abstract]
  11. Moreno, C. S., G. Beresford, P. Louis-Plence, A. C. Morris, J. M. Boss. 1999. CREB regulates MHC class II expression in a CIITA-dependent manner. Immunity 10:143.[Medline]
  12. Zeleznik-Le, N. J., J. C. Azizkhan, J. P.-Y Ting. 1991. Affinity-purified CCAAT-box-binding protein (YEBP) functionally regulates expression of a human class II major histocompatibility complex gene and the herpes simplex virus thymidine kinase gene. Proc. Natl. Acad. Sci. USA 88:1873.[Abstract/Free Full Text]
  13. Steimle, V., L. A. Otten, M. Zufferey, B. Mach. 1993. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome). Cell 75:135.[Medline]
  14. Riley, J. L., S. D. Westerheide, J. A. Price, J. A. Brown, J. M. Boss. 1995. Activation of class II MHC genes requires both the X box region and the class II transactivator (CIITA). Immunity 2:533.[Medline]
  15. Zhou, H., L. H. Glimcher. 1995. Human MHC class II gene transcription directed by the carboxyl terminus of CIITA, one of the defective genes in type II MHC combined immune deficiency. Immunity 2:545.[Medline]
  16. Steimle, V., C.-A. Siegrist, A. Mottet, B. Lisowska-Grospierre, B. Mach. 1994. Regulation of MHC class II expression by interferon-{gamma} mediated by the transactivator gene CIITA. Science 265:106.[Abstract/Free Full Text]
  17. Chin, K.-C., C. Mao, C. Skinner, J. L. Riley, K. L. Wright, C. S. Moreno, G. R. Stark, J. M. Boss, J. P.-Y. Ting. 1994. Molecular analysis of G1B and G3A IFN-{gamma} mutants reveals that defects in CIITA or RFX result in defective class II MHC and Ii gene induction. Immunity 1:687.[Medline]
  18. Chang, C.-H., J. D. Fontes, B. M. Peterlin, R. A. Flavell. 1994. Class II transactivator (CIITA) is sufficient for the inducible expression of major histocompatibility complex class II genes. J. Exp. Med. 180:1367.[Abstract/Free Full Text]
  19. Lee, Y. J., E. N. Benveniste. 1996. Stat1{alpha} expression is involved in IFN-{gamma} induction of the class II transactivator and class II MHC genes. J. Immunol. 157:1559.[Abstract]
  20. Muhlethaler-Mottet, A., L. A. Otten, V. Steimle, B. Mach. 1997. Expression of MHC class II molecules in different cellular and functional compartments is controlled by differential usage of multiple promoters of the transactivator CIITA. EMBO J. 16:2851.[Medline]
  21. Piskurich, J. F., M. W. Linhoff, Y. Wang, J. P.-T. Ting. 1999. Two distinct {gamma} interferon-inducible promoters of the major histocompatibility complex class II transactivator gene are differentially regulated by STAT1, interferon regulatory factor 1, and transforming growth factor ß. Mol. Cell. Biol. 19:431.[Abstract/Free Full Text]
  22. Heyborne, K., Y.-X. Fu, A. Nelsen, A. Farr, R. O’Brien, W. Born. 1994. Recognition of trophoblasts by {gamma}{delta} T cells. J. Immunol. 153:2918.[Abstract]
  23. Lin, H., T. R. Mosmann, L. Guilbert, S. Tuntipopipat, T. G. Wegmann. 1993. Synthesis of T helper 2-type cytokines at the maternal-fetal interface. J. Immunol. 151:4562.[Abstract]
  24. Morii, T., K. Nishikawa, S. Saito, M. Encomoto, A. Ito, N. Kural, T. Shimoyama, M. Ichuo, N. Narita. 1993. T-cell receptors are expressed but down regulated on intradecidual T lymphocytes. Am. J. Reprod. Immunol. 29:1.
  25. Raghupathy, R.. 1997. Th1-type immunity is incompatible with successful pregnancy. Immunol. Today 18:478.[Medline]
  26. Altman, D. J., S. L. Schneider, D. A. Thompson, H.-L. Cheng, T. B. Tomasi. 1990. A transforming growth factor ß2 (TGFß2)-like immunosuppressive factor in amniotic fluid and localization of TGF-ß2 mRNA in the pregnant uterus. J. Exp. Med. 172:1391.[Abstract/Free Full Text]
  27. Crainie, M., L. Guilbert, T. G. Wegmann. 1990. Expression of novel cytokine transcripts in the murine placenta. Biol. Reprod. 43:999.[Abstract]
  28. Delassus, S., G. C. Coutinho, C. Saucier, S. Darche, P. Kourilsky. 1994. Differential cytokine expression in maternal blood and placenta during murine gestation. J. Immunol. 152:2411.[Abstract]
  29. Munn, D. H., M. Zhou, J. T. Attwood, I. Bondarov, S. J. Conway, B. Marshall, C. Brown, A. L. Mellor. 1998. Prevention of allogeneic fetal rejection by tryptophan catabolism. Science 281:191.
  30. Hunt, J. S., H. T. Orr. 1992. HLA and maternal-fetal recognition. FASEB J. 6:2344.[Abstract]
  31. Rouas-Freiss, N., R. M. Goncalves, C. Menier, J. Dausset, E. D. Carosella. 1997. Direct evidence to support the role of HLA-G in protecting the fetus from maternal uterine natural killer cytolysis. Proc. Natl. Acad. Sci. USA 94:11520.[Abstract/Free Full Text]
  32. Peyman, J. A., G. L. Hammond. 1992. Localization of IFN-{gamma} receptor in first trimester placenta to trophoblasts but lack of stimulation of HLA-DRA,-DRB, or invariant chain mRNA expression by IFN-{gamma}. J. Immunol. 149:2675.[Abstract]
  33. Peyman, J. A., P. J. Nelson, G. L. Hammond. 1992. HLA-DR genes are silenced in human trophoblasts and stimulation of signal transduction pathways does not circumvent IFN-{gamma} unresponsiveness. Transplant. Proc. 24:470.[Medline]
  34. Morris, A. C., J. L. Riley, W. H. Fleming, J. M. Boss. 1998. MHC class II gene silencing in trophoblast cells is caused by inhibition of CIITA expression. Am. J. Reprod. Immunol. 40:385.
  35. Labarrere, C. A., W. P. Faulk. 1990. MHC class II reactivity of human villous trophoblast in chronic inflammation of unestablished etiology. Transplantation 50:812.[Medline]
  36. Athanassakis, I., Y. Aifantis, A. Makrygiannakis, E. Koumantakis, S. Vassiliadis. 1995. Placental tissue from human miscarriages expresses class II HLA-DR antigens. Am. J. Reprod. Immunol. 34:281.
  37. Murphy, S. P., T. B. Tomasi. 1998. Absence of MHC class II antigen expression in trophoblast cells results from a lack of class II transactivator (CIITA) gene expression. Mol. Reprod. Dev. 51:1.[Medline]
  38. Kass, S. U., D. Pruss, A. P. Wolffe. 1997. How does DNA methylation repress transcription?. Trends Genet. 13:444.[Medline]
  39. Li, E., T. H. Bestor, R. Jaenisch. 1992. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69:915.[Medline]
  40. Razin, A., H. Cedar. 1991. DNA methylation and gene expression. Microbiol. Rev. 55:451.[Abstract/Free Full Text]
  41. Epstein, M. A., B. G. Achong, Y. M. Barr, B. Zajac, G. Henle, W. Henle. 1966. Morphological and virological investigations on cultured Burkitt tumor lymphoblasts (strain Raji). J. Natl. Cancer Inst. 37:547.
  42. Ping, D., P. L. Jones, J. M. Boss. 1996. TNF regulates the in vivo occupancy of both distal and proximal regulatory regions of the murine monocyte chemoattractant protein-1 (MCP-1/JE) gene. Immunity 4:455.[Medline]
  43. Ping, D., G. H. Boekhoudt, E. M. Rogers, J. M. Boss. 1999. NF-{kappa}B p65 mediates the assembly and activation of the tumor necrosis factor responsive element of the murine monocyte chemoattractant-1 gene. J. Immunol. 162:727.[Abstract/Free Full Text]
  44. Riley, J. L., J. M. Boss. 1993. Class II MHC transcriptional mutants are defective in higher order complex formation. J. Immunol. 151:6942.[Abstract]
  45. Sambrook, J., E. F. Fritsch, T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
  46. Gobin, S. J., L. Wilson, V. Keijsers, P. J. van den Elsen. 1997. Antigen processing and presentation by human trophoblast-derived cell lines. J. Immunol. 158:3587.[Abstract]
  47. Cross, J. C., S. Lam, S. Yagel, Z. Werb. 1999. Defective induction of the transcription factor interferon-stimulated gene factor-3 and interferon {alpha} insensitivity in human trophoblast cells. Biol. Reprod. 60:312.[Abstract/Free Full Text]
  48. Peyman, J. A.. 1999. Repression of major histocompatibility complex genes by a human trophoblast ribonucleic acid. Biol. Reprod. 60:23.[Abstract/Free Full Text]
  49. Lefebvre, S., P. Moreau, J. Dausset, E. D. Carosella, P. Paul. 1999. Downregulation of HLA class I gene transcription in choriocarcinoma cells is controlled by the proximal promoter element and can be reversed by CIITA. Placenta 20:293.[Medline]
  50. Ghosh, N., J. F. Piskurich, G. Wright, K. Hassani, J. P.-Y. Ting, K. L. Wright. 1999. A novel element and a TEF-2-like element activate the major histocompatibility complex class II transactivator in B-lymphocytes. J. Biol. Chem. 274:32342.[Abstract/Free Full Text]
  51. Muhlethaler-Mottet, A., W. Di Berardino, L. A. Otten, B. Mach. 1998. Activation of the MHC class II transactivator CIITA by interferon {gamma} requires cooperative interaction between Stat1 and USF-1. Immunity 8:157.[Medline]
  52. Razin, A.. 1998. CpG methylation, chromatin structure and gene silencing: a three-way connection. EMBO J. 17:4905.[Medline]
  53. Antequera, F., J. Boyes, A. Bird. 1990. High levels of de novo methylation and altered chromatin structure at CpG islands in cell lines. Cell 62:503.[Medline]
  54. Athanassakis-Vassiliadis, I., V. K. Galanopolos, M. Grigoriou, J. Papamatheakis. 1990. Induction of class II MHC antigen expression on the murine placenta by 5-azacytidine correlates with fetal abortion. Cell. Immunol. 128:438.[Medline]
  55. Gustafsson, E., M. Arvola, U. Brunsberg, A. Mattsson, R. Mattsson. 1997. Lack of detectable major histocompatibility complex class II A ß-chain messenger ribonucleic acid in placentas of interferon-{gamma}- and 5-azacytidine-treated mice. Biol. Reprod. 57:715.[Abstract]
  56. Yuan, X.-J., B. Dixon-McCarthy, H. Kunz, III T. J. Gill. 1994. Role of methylation in placental major histocompatibility complex antigen expression and fetal loss. Biol. Reprod. 51:831.[Abstract]
  57. Gobin, S. J. P., A. Peijnenburg, V. Keijsers, P. J. van den Elsen. 1997. Site a is crucial for two routes of IFN{gamma}-induced MHC class I transactivation: the ISRE-mediate route and a novel pathway involving CIITA. Immunity 6:601.[Medline]
  58. Bourcraut, J., T. Guillaudeux, M. Alizadeh, J. Boretto, G. Chimini, F. Malecaze, G. Semana, R. Fauchet, P. Pontarotti, P. Le Bouteiller. 1993. HLA-E is the only class I gene that escapes CpG methylation and is transcriptionally active in the trophoblast-derived human cell line JAR. Immunogenetics 38:117.[Medline]
  59. Guillaudeux, T., A. M. Rodriguez, M. Girr, V. Mallet, S. A. Ellis, I. L. Sargent, R. Fauchet, E. Alsat, P. Le Bouteiler. 1995. Methylation status and transcriptional expression of the MHC class I loci in human trophoblast cells from term placenta. J. Immunol. 154:3283.[Abstract]



This article has been cited by other articles:


Home page
Int ImmunolHome page
A. De Lerma Barbaro, A. De Ambrosis, B. Banelli, G. L. Pira, O. Aresu, M. Romani, S. Ferrini, and R. S. Accolla
Methylation of CIITA promoter IV causes loss of HLA-II inducibility by IFN-{gamma} in promyelocytic cells
Int. Immunol., November 1, 2008; 20(11): 1457 - 1466.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. M. Holling, M. W. T. Bergevoet, L. Wilson, M. C. J. A. Van Eggermond, E. Schooten, R. D. M. Steenbergen, P. J. F. Snijders, M. J. Jager, and P. J. Van den Elsen
A Role for EZH2 in Silencing of IFN-{gamma} Inducible MHC2TA Transcription in Uveal Melanoma
J. Immunol., October 15, 2007; 179(8): 5317 - 5325.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S.-D. Chou, A. N. H. Khan, W. J. Magner, and T. B. Tomasi
Histone acetylation regulates the cell type specific CIITA promoters, MHC class II expression and antigen presentation in tumor cells
Int. Immunol., November 1, 2005; 17(11): 1483 - 1494.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
U. M. Nagarajan, D. M. Ojcius, L. Stahl, R. G. Rank, and T. Darville
Chlamydia trachomatis Induces Expression of IFN-{gamma}-Inducible Protein 10 and IFN-{beta} Independent of TLR2 and TLR4, but Largely Dependent on MyD88
J. Immunol., July 1, 2005; 175(1): 450 - 460.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. Radosevich, Z. Song, J. C. Gorga, B. Ksander, and S. J. Ono
Epigenetic Silencing of the CIITA Gene and Posttranscriptional Regulation of Class II MHC Genes in Ocular Melanoma Cells
Invest. Ophthalmol. Vis. Sci., September 1, 2004; 45(9): 3185 - 3195.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
U. M. Nagarajan, A. B. Long, M. T. Harreman, A. H. Corbett, and J. M. Boss
A Hierarchy of Nuclear Localization Signals Governs the Import of the Regulatory Factor X Complex Subunits and MHC Class II Expression
J. Immunol., July 1, 2004; 173(1): 410 - 419.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. M. Holling, E. Schooten, A. W. Langerak, and P. J. van den Elsen
Regulation of MHC class II expression in human T-cell malignancies
Blood, February 15, 2004; 103(4): 1438 - 1444.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. Holtz, J. C. Choi, M. G. Petroff, J. F. Piskurich, and S. P. Murphy
Class II Transactivator (CIITA) Promoter Methylation Does Not Correlate with Silencing of CIITA Transcription in Trophoblasts
Biol Reprod, September 1, 2003; 69(3): 915 - 924.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. K. Pai, M. Convery, T. A. Hamilton, W. H. Boom, and C. V. Harding
Inhibition of IFN-{gamma}-Induced Class II Transactivator Expression by a 19-kDa Lipoprotein from Mycobacterium tuberculosis: A Potential Mechanism for Immune Evasion
J. Immunol., July 1, 2003; 171(1): 175 - 184.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
P. J. van den Elsen, N. van der Stoep, and T. Yazawa
Class II Transactivator (CIITA) Deficiency in Tumor Cells: Complicated Mechanisms or Not?
Am. J. Pathol., July 1, 2003; 163(1): 373 - 376.
[Full Text] [PDF]


Home page
J. Immunol.Home page
T. Kanaseki, H. Ikeda, Y. Takamura, M. Toyota, Y. Hirohashi, T. Tokino, T. Himi, and N. Sato
Histone Deacetylation, But Not Hypermethylation, Modifies Class II Transactivator and MHC Class II Gene Expression in Squamous Cell Carcinomas
J. Immunol., May 15, 2003; 170(10): 4980 - 4985.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Moreau, G. Mouillot, P. Rousseau, C. Marcou, J. Dausset, and E. D. Carosella
HLA-G gene repression is reversed by demethylation
PNAS, February 4, 2003; 100(3): 1191 - 1196.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. van der Stoep, E. Quinten, and P. J. van den Elsen
Transcriptional Regulation of the MHC Class II Trans-Activator (CIITA) Promoter III: Identification of a Novel Regulatory Region in the 5'-Untranslated Region and an Important Role for cAMP-Responsive Element Binding Protein 1 and Activating Transcription Factor-1 in CIITA-Promoter III Transcriptional Activation in B Lymphocytes
J. Immunol., November 1, 2002; 169(9): 5061 - 5071.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. P. Murphy, R. Holtz, N. Lewandowski, T. B. Tomasi, and H. Fuji
DNA Alkylating Agents Alleviate Silencing of Class II Transactivator Gene Expression in L1210 Lymphoma Cells
J. Immunol., September 15, 2002; 169(6): 3085 - 3093.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. K. Pai, D. Askew, W. H. Boom, and C. V. Harding
Regulation of Class II MHC Expression in APCs: Roles of Types I, III, and IV Class II Transactivator
J. Immunol., August 1, 2002; 169(3): 1326 - 1333.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. C. Morris, G. W. Beresford, M. R. Mooney, and J. M. Boss
Kinetics of a Gamma Interferon Response: Expression and Assembly of CIITA Promoter IV and Inhibition by Methylation
Mol. Cell. Biol., July 1, 2002; 22(13): 4781 - 4791.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
R. Naves, A. M. Lennon, G. Barbieri, L. Reyes, G. Puga, L. Salas, V. Deffrennes, M. Rosemblatt, M. Fellous, D. Charron, et al.
MHC class II-deficient tumor cell lines with a defective expression of the class II transactivator
Int. Immunol., May 1, 2002; 14(5): 481 - 491.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J.-M. Waldburger, T. Suter, A. Fontana, H. Acha-Orbea, and W. Reith
Selective Abrogation of Major Histocompatibility Complex Class II Expression on Extrahematopoietic Cells in Mice Lacking Promoter IV of the Class II Transactivator Gene
J. Exp. Med., August 20, 2001; 194(4): 393 - 406.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. J. Magner, A. L. Kazim, C. Stewart, M. A. Romano, G. Catalano, C. Grande, N. Keiser, F. Santaniello, and T. B. Tomasi
Activation of MHC Class I, II, and CD40 Gene Expression by Histone Deacetylase Inhibitors
J. Immunol., December 15, 2000; 165(12): 7017 - 7024.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morris, A. C.
Right arrow Articles by Boss, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morris, A. C.
Right arrow Articles by Boss, J. M.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*AZACITIDINE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS