| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Pathology, University of Massachusetts Medical School, Worcester, MA 01655
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The generation and presentation of peptides on MHC class I molecules, the availability of responsive T cells, and poorly understood immunoregulatory effects can all influence whether immune responses are generated to a particular epitope (4). Where examined, one of the most important factors is whether a specific peptide is correctly generated and presented on MHC class I molecules. The majority of Kd-restricted epitopes from influenza Ags (16 of 26) do not bind to class I molecules with sufficient affinity to be presented (5). Of the 10 peptides that bind to Kd class I molecules, immune responses are only generated to 5. Within this group of peptides, binding to MHC molecules with high or low affinity does not necessarily correlate with the strength of the response (5).
In many of these cases, the subdominant or cryptic epitopes stimulate weak or no responses because of a failure of APCs to generate the antigenic peptide efficiently (4). However, the reason that a particular peptide is not efficiently produced is generally not known. The presented peptide must be of a precise size (typically eight or nine residues) to bind to a class I molecule (9, 10) and, conceivably, cellular proteases may make the appropriate cleavages inefficiently, if at all. In addition, it is possible proteases may destroy potential epitopes by cleaving them internally. For example, purified proteasomes appear to make the appropriate cleavages to generate the subdominant OVA peptide KVVRFDKL (K-L) inefficiently and instead tend to cleave within the epitope itself (11). To understand these phenomena, it is necessary to identify the proteases that make the cleavages that generate or destroy the antigenic peptide and to characterize their specificity.
The bulk of cellular proteins are degraded by proteasomes. The
proteolytic core of the proteasome is a 20S cylindrical particle (700
kDa) composed of two outer 
rings and two inner ß rings
(12). In mammalian proteasomes, each ß ring contains
three active sites that are classified based on their specificity for
the P1 residue (the residue on the N-terminal side of the scissile
bound) of small fluorogenic substrates. One site (chymotryptic) cleaves
preferentially on the carboxylic side of hydrophobic amino acids,
another site (tryptic) cleaves after basic residues, and the third site
(peptidylglutamyl hydrolyzing or caspase-like) cleaves after acidic
ones (13, 14). The specificity of these sites for
sequences in proteins or larger oligopeptides is not well defined;
however, the proteasome clearly has specificity for additional residues
(e.g., in the P4 and P5 positions (Ref. 15)).
Inhibitors of the proteasome can block the generation of a majority of MHC class I-presented peptides in APCs (17), indicating that these proteolytic particles are needed to make at least some of the cleavages that yield antigenic peptides. However, it has not been clear whether proteasomes make the precise cleavages that generate antigenic peptides or whether other proteases are needed to trim the proteasomal products to the appropriate size for presentation. Purified proteasomes can generate antigenic peptides of the proper size as well as many oligopeptides that are too long or too short (11, 18, 19, 20, 21, 22). However, it is still uncertain whether results obtained from in vitro biochemical studies can be extrapolated to in vivo situations (reviewed in Ref. 2). Recently, it has been shown with intact APCs that proteasome inhibitors block the presentation of four immunodominant antigenic peptides containing a single or more C-terminal flanking residues (23, 24, 25). Therefore, proteasomes are responsible for the cleavage that generates the proper C terminus of presented peptides. In contrast, the removal of N-terminal flanking residues from these immunodominant peptides is resistant to proteasome inhibitors (23, 24, 25). These residues are efficiently removed by aminopeptidases both in vitro (25, 26) and in vivo (25). In this report, we investigate whether similar mechanisms are involved in generating a subdominant epitope and whether the N-terminal and/or C-terminal cleavages are limiting its presentation in vivo.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A vaccinia construct that contained a full-length cDNA sequence for chicken OVA (V-FLOVA) was obtained from Drs. Jon Yewdell and Jack Bennink (National Institutes of Health, Bethesda, MD), and a vaccinia construct that encoded T7 RNA polymerase (vTF7-3) was obtained from the American Type Culture Collection (VR-2153; Manassas, VA). Both recombinant viruses were propagated in HeLa cells and stored at -80°C.
Cell lines and hybridomas
E36.12.4 APCs were originally derived from E36 cells (hamster lung carcinoma cells) and were stably transfected with murine H-2Kb and ICAM-1 molecules (27). The T hybridoma 1G8 specific for K-L was obtained from Dr. James McCluskey (Flinders Medical Center) (28). The T cell hybridoma RF33.70 specific for S-L was described previously (29). These T cell hybridomas are highly specific and do not recognize unrelated peptides. All cells were maintained in RPMI 1640 medium with 5% FCS (Atlanta Biologicals, Norcross, GA).
Peptides and proteasome inhibitor
The peptide S-L, corresponding to OVA residues 257–264, and the peptide K-L, corresponding to OVA residues 55–62, were purchased from Molecular Resources (Colorado State University, Fort Collins, CO). These two peptides were purified by reverse phase HPLC and were at least 95% pure. The proteasome inhibitor clasto-lactacystin ß-lactone (ß-lactone) was kindly provided by Dr. Julian Adams (ProScript, Cambridge, MA) and was dissolved at 10 µM in DMSO and stored at -80°C.
Plasmid constructs
Synthetic minigenes encoding the antigenic peptides
corresponding to chicken OVA OVA55–62 (K-L) or OVA257–264 (S-L) with
or without either natural or mutated N- or C-terminal flanking residues
were constructed from synthetic oligonucleotides. The coding sequences
for all of the plasmid constructs were preceded by a translation
initiation codon (ATG), and therefore all of the translated products
start with Met, which should be rapidly removed by cytosolic methionine
aminopeptidase. The oligonucleotides were cloned into pBluescript SK
under the control of the T7 RNA promoter as described previously
(23). The various Ag constructs are shown in Fig. 3
B.
|
Pro (p.OVA.P) and from
Thr Leu (p.OVA.L) were produced using the Clontech transformer
site-directed mutagenesis kit (Clontech Laboratories, Palo Alto, CA).
Briefly, the target plasmid (p.OVA) was denatured and then a selection
primer (which converts an ScaI site to a DrdI
site) GTGACTGGTGAGTCCTCAACCAAGTC and a mutagenic primer
CAACTTTGAAAAACTGCCTGAATGGACCAG were annealed to the ssDNA, and the
second strand was synthesized with T4 DNA polymerase and ligase.
Repair-deficient competent Escherichia coli were
transformed, and recombinant isolated plasmids were selected by cutting
nonrecombinant plasmids with ScaI. DH5-competent
E. coli were then transformed, and plasmid
minipreps were digested with DrdI. Positives were then
sequenced to check for mutagenic insertion. Ag presentation assay
Ags were introduced into H-2Kb APCs (E36/Kb) either by recombinant vaccinia infection or by infection plus plasmid transfection. E36 APCs were first infected with V-FLOVA (multiplicity of infection (MOI),5 10) for 2 h or infected with vTF7-3 first and then transfected with Lipofectin-bound plasmid, as described previously (23), for various lengths of time as described in the figure legends. These Ag-expressing APCs were fixed to stop further Ag processing, washed, and then incubated with T cell hybridomas (1 x 105/well) for 20 h. The amount of plasmid transfected and the length of incubation before fixation were titrated to obtain limiting conditions of Ag presentation and these limiting conditions were then used in all experiments. The expression level of MHC class I-peptides complex on the surface of APCs was then evaluated by their ability to stimulate the peptide-specific T hybridomas to produce IL-2. Levels of IL-2 in the supernatant were measured by the CTLL cell proliferation (cpm) (30). For all of the experiments, the peptide-specific T hybridomas generated a very low level of IL-2 (cpm <2500) when no Ag (APC# = 0) was present.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In initial experiments, we analyzed the presentation on
Kb of K-L (OVA55–62) and S-L (OVA257–264)
peptides from OVA. E36 (H-2Kb) APCs were infected
with a vaccinia recombinant containing the full-length OVA sequence
(V-FLOVA) and fixed after 2 h. The presentation of K-L or S-L
peptides was assayed by coculturing these cells with specific T cell
hybridomas and measuring their production of IL-2. As shown in Fig. 1A, the response of the
K-L-specific hybridoma (1G8) was much lower than that of the
S-L-specific clone (RF33.70) (Fig. 1A). In contrast, when
the APCs were incubated with a titration of K-L or S-L peptides added
to the medium, the K-L-specific hybridoma responded to slightly lower
concentrations of peptide than the S-L-specific hybrid (Figs. 1B and 2, B and D). Since the
K-L-reactive hybridoma was at least as sensitive as the S-L-specific
one, our results indicate that K-L is presented more poorly than S-L in
cells expressing the full-length OVA protein (Fig. 1A).
These results confirm the findings of earlier reports in which the
K-L-specific response was much lower than the S-L-specific response
measured by the GA4.2 T hybridoma when OVA protein was introduced into
the APCs by electroporation (28).
|
) or
length of incubation (23). As shown in Fig. 2, when S-L
and K-L peptides were expressed endogenously in the APCs, the
K-L-specific hybridoma responded to somewhat lower numbers of these
APCs than the S-L-specific hybrid, even under conditions of limiting Ag
(Fig. 2, A and C). Therefore, once the K-L and
S-L peptides are generated, they are presented with similar efficiency
in this system. These results, along with those in Fig. 1
, indicate
that the responses of the K-L-specific 1G8 and S-L-specific RF33.70 T
hybridomas can be compared to determine the relative amount of K-L and
S-L being generated and presented on Kb. The
lower presentation efficiency of the K-L epitope from OVA protein (Fig. 1A) but not from the minimal short construct (8-mer) (Fig. 2) further indicates that this peptide is generated less efficiently
than S-L.
|
B). These constructs were
then expressed in APCs by the T7 polymerase transfection method, and Ag
presentation was measured. When S-L was flanked by its natural flanking
residues ((M)VSGLEQLES-LTEWTS), strong presentation was
observed with 7 µg of plasmid (Fig. 4A). However, when S-L was
surrounded by the flanking residues of K-L, S-L presentation was low
even with 20 µg of plasmid (Fig. 4B). These data indicate
that the flanking sequences of K-L negatively affect peptide generation
and are consistent with earlier results (11).
|
Given the results described above, it is important to understand
whether the residues that flank S-L and K-L are removed by similar
mechanisms. Recently, we and others have demonstrated that in APCs
distinct proteolytic processes are involved in the cleavages that
generate the proper N and C termini of several immunodominant peptides,
including S-L (23). The C-terminal cleavage is made by
proteasomes and can be blocked by proteasome inhibitors whereas the N
terminus can be trimmed by aminopeptidases, and this process is
resistant to proteasome inhibitors (23, 24, 25). We therefore
examined whether the removal of N- or C-terminal residues that flank
K-L was also blocked by proteasome inhibitors. A cDNA for full-length
OVA or minigene construct consisting of the K-L peptide with five
additional residues of natural flanking sequence
((M)K-LPGFGD) was constructed and expressed in APCs. The
presentation of the K-L peptide was subsequently detected using the T
cell hybridoma assay. When the APCs were treated with the proteasome
inhibitor ß-lactone, presentation of K-L from full-length OVA (Fig. 5A) and from the C-terminally
extended construct (M)K-LPGFGD (Fig. 5B) was
markedly reduced. In contrast, this proteasome inhibitor did not block
the presentation of the octamer K-L peptide expressed from a minigene
(which does not require proteolysis for presentation) (Fig. 5D). These results indicate that the proteasome inhibitor
blocks presentation by interfering with the proteolytic removal of the
C-terminal residues of (M)K-LPGFGD and is not affecting
other steps in the class I pathway. Interestingly, the proteasome
inhibitor also did not enhance the presentation of the K-L minigene
(Fig. 5D). This is surprising because earlier reports using
purified 20S proteasomes found multiple cleavages within the K-L
epitope itself, with the major cleavage between Arg (R) and Phe (F)
(KVVR-cleavage-FDKL) (11), resulting in the destruction of
this peptide. These in vitro studies concluded that destruction of this
peptide by proteasomes was one of the reasons that led to its
subdominance; however, our findings that the presentation of K-L was
similar to that of S-L (Fig. 2) and that proteasome inhibitors did not
enhance the presentation of K-L from the minimal 8-mer construct (Fig. 5D) in intact cells do not support this conclusion.
|
E). It is
again notable that the proteasome inhibitor also did not enhance
the presentation of the (M)DSTRTQINK-L peptide, further
suggesting that proteasome-mediated destruction of the K-L epitope does
not limit its presentation in vivo. Similar results were obtained using
even higher concentrations of ß-lactone (20 µM; data not shown).
The failure of the proteasome inhibitor to block presentation of this
N-terminally extended construct was similar to findings reported
earlier for S-L and three other viral immunodominant peptides
(23, 24, 25). Therefore, the generation of the proper N and C
termini of both subdominant and immunodominant peptides involve
distinct proteolytic processes. Given our results described above, one
or both of these processes must remove the flanking residues of K-L
less efficiently than the sequences surrounding S-L. N-terminal flanking sequences can affect the efficiency of Ag presentation
To address whether the N-terminal flanking sequence of the
subdominant K-L peptide impairs Ag presentation, we constructed a
chimeric cDNA encoding these residues (DSTRTQIN) as amino-terminal
flanking sequence on the immunodominant S-L peptide
((M)DSTRTQINS-L). This construct was expressed in APCs and
its presentation was compared with an S-L construct with natural
flanking residues ((M)VSGLEQLES-L). The construct with the
natural flanking residues was presented considerably better than the
chimeric construct with the subdominant flanking sequences (Fig. 4C). These results demonstrate that compared with
(M)VSGLEQLE, the (M)DSTRTQIN residues are trimmed less efficiently
from the N terminus of S-L.
C-terminal flanking sequences can also affect the efficiency of Ag presentation
We also examined whether the C-terminal flanking residues of
K-L contributed to its suboptimal presentation. Plasmids were made that
encoded S-L with its natural C-terminal flanking residues
(S-LTEWTS) or with those from K-L
(S-LPGFGD) (Fig. 3B). These
constructs were expressed in APCs and S-L presentation was measured.
S-L presentation was decreased significantly when its C-terminal flank
(S-LTEWTS) was replaced with that of K-L
(S-LPGFGD) (Fig. 6A). Similar experiments were
done comparing the presentation of K-L constructs with natural flanking
residues (K-LPGFGD) or with the flanking
sequence from the immunodominant peptide S-L (K-LTEWTS). In
this case, the flanking residues from S-L markedly augmented the
presentation of K-L (Fig. 6B). The generation of the
presented peptides from all of these constructs was still dependent on
the proteasome because proteasome inhibitors blocked their presentation
(data not shown). These results indicate that the removal of the
C-terminal flanking residues of K-L is also less efficient than for
those flanking S-L and thus limits Ag presentation.
|
K-LTGFGD) (Fig. 6C). The generation of the K-L peptide from this
Thr-containing construct was also blocked by proteasome inhibitors
(Fig. 5C), indicating that the proteasome has specificity
for this P1' residue. Consistent with this result, the enhanced
presentation of the chimeric construct of K-L with the C-terminal
flanking residues of S-L (K-LTEWTS) was markedly reduced
when the P1' Thr was mutated to Pro (K-LPEWTS) (Fig. 6B). We also performed the same kind of analysis for the S-L
epitope. Mutation of its natural P1' residue (Thr) to the P1' residue
of K-L (Pro) reduced its Ag presentation (Fig. 6A).These
results show that the P1' Pro residue contributes to the suboptimal
removal of the K-L C-terminal flanking residues.
It is uncertain whether short oligopeptide constructs will always be
cleaved identically to the same sequence in the corresponding
full-length protein, e.g., oligopeptides are not substrates for
ubiquitination, whereas full-length proteins (including OVA) are
polyubiquitinated. Moreover, Eisenlohr’s group (32) has
described one example where the generation of presented peptides from
an oligopeptide precursor is different from a protein. We therefore
further investigated whether the P1' residue would affect the
generation of the S-L peptide from full-length OVA. We made plasmids
that encoded the full-length OVA protein (Fig. 3A) with the
C-terminal P1' residue of S-L changed from T265P265 (p.OVA.P) and
from T265L265 (p.OVA.L), a residue that was also shown to decrease
S-L generation from a 9-mer S-L.L (31). As
shown in Fig. 7, S-L presentation from
the mutated OVA protein OVA.P was significantly reduced when compared
with that of wild-type OVA OVA (Fig. 7A). Mutation of the
P1' residue to L (OVA.L) also significantly decreased S-L generation
from the whole OVA protein (Fig. 7B). These
results further generalized the importance of the P1' residue for the
generation of class I-presented peptides.
|
In a final set of experiments, we explored whether C-terminal
flanks of cryptic peptides within OVA may also limit Ag presentation.
OVA has four more peptides that contain the proper motif for binding to
H-2Kb molecules but that fail to stimulate immune
responses (cryptic epitopes) (8, 33). Because of the lack
of T cell hybridomas specific for these subdominant peptides, we
constructed plasmids that encoded chimeric oligopeptides, which had the
C-terminal flanks of OVA12–19 (KVHHA), OVA25–32 (AIMSA), OVA107–114
(PEYLQ), and OVA176–183 (WEKTF) linked to S-L. S-L generation from
these constructs was then studied using the T hybridoma RF33.70.
Interestingly, two of these C-terminal flanks, PEYLQ and WEKTF,
markedly decreased S-L generation (Fig. 8, A and B). It is
notable that one of these has a Pro at the P1' position, like K-L, but
the other does not. In addition, the sequence KVHHA also consistently
lowered the presentation of S-L as compared with that of TEWTS (Fig. 8C), although the magnitude of this effect was modest.
Surprisingly, one of the flanks, AIMSA, enhanced the S-L generation
(Fig. 8D). Therefore, it seems that the majority of cryptic
epitopes have suboptimal sequences flanking their carboxyl-termini.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We confirmed that the K-L epitope is presented less efficiently from
OVA than the immunodominant epitope S-L, as has been described
previously (11). In our assay system, when eight-residue
(plus the initiating Met) peptides K-L or S-L are expressed from
minigenes, the K-L peptide is presented with similar efficiency as the
S-L peptide (Fig. 2). However, K-L presentation is weaker than S-L when
they are generated from full-length OVA. Therefore, flanking residues
reduce the efficiency of K-L presentation. In addition, the K-L peptide
has been reported to bind to Kb with lower
affinity than S-L (28), which would further contribute to
its weaker presentation (although the affinity of these peptides would
not be measured in our assays which use T cell hybridomas that
have similar reactivity to a titration of the K-L and S-L peptides
(Figs. 1B and 2, B and D).
Earlier studies have shown that purified proteasomes preferentially cleave octamer K-L or extended K-L constructs within the K-L sequence, thereby destroying the presented peptide (11). This was suggested to contribute to the poor presentation of this epitope. However, we find no evidence to support this mechanism in intact cells. In our assays, the K-L peptide sequence is as efficiently presented as S-L when introduced as minigenes that encode their sequences. More important, the presentation of K-L is not enhanced by proteasome inhibitors even when they are present at very high concentrations (which are sufficient to inhibit protein degradation (34) and Ag presentation). Similarly, proteasome inhibitors do not enhance the presentation of K-L from constructs that have N-terminal flanking residues that might theoretically be needed for binding to proteasomes and cleavage within the K-L sequence. Therefore, destruction of the K-L epitope by proteasomes is not limiting its presentation. The inefficient generation of the K-L epitope is instead due to impaired removal of its flanking residues.
Earlier studies had shown that flanking residues could influence the presentation of class I-presented epitopes (35, 36). However, the proteases that were responsible for removing these sequences were not known, and, therefore, it was uncertain how these flanking sequences were exerting their effects. In most earlier studies proteolytic mechanisms were not examined, or in one case which examined whether the proteasome was involved (for the generation of the influenza nucleoprotein (NP) 147–155 peptide), proteasome inhibitors did not block the presentation of this epitope (37). Therefore, we sought to define the proteolytic mechanisms that removed the N-terminal and C-terminal flanking residues from K-L and determine whether these processes were influenced by these flanking sequences.
The presentation of K-L from OVA was blocked by proteasome inhibitors
(Fig. 5A). In contrast, the presentation of the
eight-residue K-L peptide from a minigene was not inhibited by these
agents. Therefore, the proteasome is required for generating the K-L
epitope from longer constructs. Proteasome inhibitors also blocked the
presentation of K-L from constructs that had carboxyl-terminal flanking
residues (Fig. 5, B and C). These results
indicate that the proteasome is responsible for removing the
carboxyl-terminal flank of this epitope. In contrast, proteasome
inhibitors did not block the presentation of K-L from constructs with
N-terminal extensions (Fig. 5E). These results are identical
to those with several immunodominant epitopes where aminopeptidases
were found to trim N-terminal extensions while proteasomes removed the
C-terminal flanking residues. We conclude that the subdominant K-L
epitope is not generated by fundamentally different mechanisms than the
immunodominant peptides.
Since two distinct proteolytic processes are involved in removing the N- and C-terminal flanking residues (2), we examined whether one or both of these processes was responsible for the suboptimal generation of K-L. We found that the presentation of S-L was reduced when its N-terminal flanking residues were replaced with those from K-L. Presumably, aminopeptidases hydrolyze this sequence more slowly than the natural flank of S-L. This is somewhat unexpected because earlier studies had found that alterations in N-terminal flanking sequences did not in general affect Ag presentation (31, 38). This might indicate that the N-terminal trimming mechanism can remove most, but not all, sequences with similar efficiency. The cytoplasm contains several aminopeptidases (39) and perhaps in combination they can remove most residues at similar rates. However, it is also possible that earlier assays were not sufficiently sensitive to detect quantitative differences in presentation. In any case, we provide clear evidence that N-terminal flanking residues can affect the generation of a presented peptide.
We also found that the presentation of an S-L minigene was reduced when
its C-terminal flanking residues were replaced with those of K-L. In
contrast, the presentation of a K-L minigene was enhanced when its
C-terminal flank was replaced with the corresponding S-L sequences
(Fig. 6). The suboptimal effect of the K-L flank was due to the Pro
residue in the P1' position. These results are consistent with earlier
studies that Pro at this position of extended oligopeptide
constructs reduced Ag presentation of S-L (11, 31).
Since antigenic peptide generation from oligopeptides may not behave
similar to full-length constructs, we extended the studies to the
full-length OVA constructs with mutated Thr265
mutated to Pro and found that presentation of S-L was reduced. Pro
residues alter polypeptide structure and it has been suggested that
proteasomes do not efficiently cleave within Pro-containing
sequences (40). However, we also found that
mutation of Thr265 Leu in OVA reduced Ag
presentation, which was consistent with earlier results with
oligopeptide constructs (31). The results reinforce
the importance of P1' residues for adjacent peptide
generation.
Since the proteasome is responsible for making the correct C-terminal cleavage in S-L and K-L, one of the active sites of this proteolytic particle must have specificity for the P1' residue, a property that has not been previously appreciated. In our study, removal of the P5', P4', and P3' residues did not seem to alter the efficiencies of presenting S-L (data not shown). However, it may be the case that other proteasome active sites have specificity for different P' residues. For example, we have observed that the removal of the C-terminal flanking residues from an influenza NP-derived peptide NP366–374 by proteasomes requires three C-terminal flanking residues (25). This may indicate that one of the active sites has specificity for the P3' position.
The TAP transporter has specificity for the C-terminal residue of
peptides (41, 42, 43). However, it should be noted that this
almost certainly does not account for any limitations on the
presentation of our C-terminally extended constructs. We show that the
removal of these flanks is dependent on proteasomes and therefore must
occur in the cytoplasm. Moreover, we and others have shown that there
is no C-terminal trimming activity in the endoplasmic reticulum
(23, 44). Our results with K-L suggest that flanking
residues probably also contribute to the subdominant status of this
epitope, in addition to the low binding affinity of K-L to the MHC
molecule as described previously (28). Moreover, we find
similar suboptimal flanks at the C terminus of a majority of cryptic
epitopes in OVA. Therefore, by affecting proteolytic cleavages,
C-terminal flanking sequences may often influence the immunogenicity of
potential epitopes. It remains to be determined which of the P'
residues is responsible for the suboptimal removal of the cryptic
flanks. However, like K-L, one of these has a Pro at the P1' position.
Interestingly, the C-terminal flank from one cryptic epitope enhanced
the presentation of S-L (Fig. 8D). Presumably this
particular epitope is cryptic for reasons other than removal of its
C-terminal flank or this sequence behaves differently when fused to
S-L. This finding does indicate that the sequences flanking
immunodominant epitopes may not necessarily be the most optimal one for
cleavage.
As we move toward a better understanding of the specificity of the proteases that make the N- and C-terminal cleavages of presented peptides, the ability to predict the epitopes in proteins that get presented should be improved. Moreover, the density of MHC/peptide is critical to activating CTLs and determines the magnitude of CTL responses (16, 45, 46). Therefore, it should be possible to engineer proteins to improve the production in cells of specific epitopes, which might enhance the immunogenicity of vaccines.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Current address: Children’s Cancer Center, University Hospital Groningen, Groningen, The Netherlands.
3 Current address: Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, 300 Brookline Avenue, Boston, MA 02215.
4 Address correspondence and reprint requests to Dr. Kenneth Rock, University of Massachusetts Medical School, Worcester, MA 01655.
5 Abbreviation used in this paper: MOI, multiplicity of infection.
Received for publication September 23, 1999. Accepted for publication February 2, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
can stimulate post-proteasomal trimming of the N terminus of an antigenic peptide by inducing leucine aminopeptidase. J. Biol. Chem. 273:18734.This article has been cited by other articles:
|
|
 |
|
  X. Ma, A. Serna, R.-H. Xu, and L. J. Sigal The Amino Acid Sequences Flanking an Antigenic Determinant Can Strongly Affect MHC Class I Cross-Presentation without Altering Direct Presentation J. Immunol., April 15, 2009; 182(8): 4601 - 4607. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. F. Towne, I. A. York, L. B. Watkin, J. S. Lazo, and K. L. Rock Analysis of the Role of Bleomycin Hydrolase in Antigen Presentation and the Generation of CD8 T Cell Responses J. Immunol., June 1, 2007; 178(11): 6923 - 6930. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Liu, B. A. Ewald, D. M. Lynch, A. Nanda, S. M. Sumida, and D. H. Barouch Modulation of DNA Vaccine-Elicited CD8+ T-Lymphocyte Epitope Immunodominance Hierarchies J. Virol., December 15, 2006; 80(24): 11991 - 11997. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Otahal, S. C. Hutchinson, L. M. Mylin, M. J. Tevethia, S. S. Tevethia, and T. D. Schell Inefficient Cross-Presentation Limits the CD8+ T Cell Response to a Subdominant Tumor Antigen Epitope J. Immunol., July 15, 2005; 175(2): 700 - 712. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. J. Cheadle, D. O'Donnell, P. J. Selby, and A. M. Jackson Closely Related Mycobacterial Strains Demonstrate Contrasting Levels of Efficacy as Antitumor Vaccines and Are Processed for Major Histocompatibility Complex Class I Presentation by Multiple Routes in Dendritic Cells Infect. Immun., February 1, 2005; 73(2): 784 - 794. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Chapatte, C. Servis, D. Valmori, O. Burlet-Schiltz, J. Dayer, B. Monsarrat, P. Romero, and F. Levy Final Antigenic Melan-A Peptides Produced Directly by the Proteasomes Are Preferentially Selected for Presentation by HLA-A*0201 in Melanoma Cells J. Immunol., November 15, 2004; 173(10): 6033 - 6040. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Lou, R. J. Kelleher Jr, A. Sette, J. Loyall, S. Southwood, R. B. Bankert, and S. H. Bernstein Germ line tumor-associated immunoglobulin VH region peptides provoke a tumor-specific immune response without altering the response potential of normal B cells Blood, August 1, 2004; 104(3): 752 - 759. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kan-Mitchell, B. Bisikirska, F. Wong-Staal, K. L. Schaubert, M. Bajcz, and M. Bereta The HIV-1 HLA-A2-SLYNTVATL Is a Help-Independent CTL Epitope J. Immunol., May 1, 2004; 172(9): 5249 - 5261. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Draenert, S. Le Gall, K. J. Pfafferott, A. J. Leslie, P. Chetty, C. Brander, E. C. Holmes, S.-C. Chang, M. E. Feeney, M. M. Addo, et al. Immune Selection for Altered Antigen Processing Leads to Cytotoxic T Lymphocyte Escape in Chronic HIV-1 Infection J. Exp. Med., April 5, 2004; 199(7): 905 - 915. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ali, R. Lubong, H. Ng, D. G. Brooks, J. A. Zack, and O. O. Yang Impacts of Epitope Expression Kinetics and Class I Downregulation on the Antiviral Activity of Human Immunodeficiency Virus Type 1-Specific Cytotoxic T Lymphocytes J. Virol., January 15, 2004; 78(2): 561 - 567. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Dadaglio, S. Morel, C. Bauche, Z. Moukrim, F. A. Lemonnier, B. J. Van den Eynde, D. Ladant, and C. Leclerc Recombinant adenylate cyclase toxin of Bordetella pertussis induces cytotoxic T lymphocyte responses against HLA*0201-restricted melanoma epitopes Int. Immunol., December 1, 2003; 15(12): 1423 - 1430. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Li, M. A. Haque, and J. S. Blum Role of Disulfide Bonds in Regulating Antigen Processing and Epitope Selection J. Immunol., September 1, 2002; 169(5): 2444 - 2450. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Kawamura, R.-C. Su, L. T. Nguyen, A. R. Elford, P. S. Ohashi, and J. Gariepy In Vivo Generation of Cytotoxic T Cells from Epitopes Displayed on Peptide-Based Delivery Vehicles J. Immunol., June 1, 2002; 168(11): 5709 - 5715. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. M. Boon, G. de Mutsert, Y. M. F. Graus, R. A. M. Fouchier, K. Sintnicolaas, A. D. M. E. Osterhaus, and G. F. Rimmelzwaan The Magnitude and Specificity of Influenza A Virus-Specific Cytotoxic T-Lymphocyte Responses in Humans Is Related to HLA-A and -B Phenotype J. Virol., January 15, 2002; 76(2): 582 - 590. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. M. Gray, G. D. Parks, and M. A. Alexander-Miller A Novel CD8-Independent High-Avidity Cytotoxic T-Lymphocyte Response Directed against an Epitope in the Phosphoprotein of the Paramyxovirus Simian Virus 5 J. Virol., November 1, 2001; 75(21): 10065 - 10072. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Knuehl, P. Spee, T. Ruppert, U. Kuckelkorn, P. Henklein, J. Neefjes, and P.-M. Kloetzel The Murine Cytomegalovirus pp89 Immunodominant H-2Ld Epitope Is Generated and Translocated into the Endoplasmic Reticulum as an 11-Mer Precursor Peptide J. Immunol., August 1, 2001; 167(3): 1515 - 1521. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
