|
|
||||||||
CUTTING EDGE |


*
Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037; and
Department of Pathology, Harvard Medical School, Boston, MA 02115
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The chemokine TCA4/SLC (7, 8, 9, 10, 11, 12) is expressed predominantly in lymph node HEV, but it is also expressed by cells in the T cell-dependent regions of lymphoid tissue (7). In the thymus, it is expressed by cells in the medulla, including blood vessels and medullary epithelium, and may contribute to tissue organization. For example, in the thymus, thymocytes and DC acquire expression of the TCA4/SLC receptor CCR7 during development (13, 14); therefore, medullary expression of TCA4/SLC may induce migration of mature cells toward the medulla. Similarly, expression of TCA4/SLC by HEV may help organize the T cell/DC compartment around HEV, whereas an opposing gradient of the chemokine B-lymphocyte chemoattractant (BLC) produced by follicular DC draws B cells into the B cell follicles (15).
To assess the role of TCA4/SLC in lymphoid tissue development, we generated transgenic mice with islet ß cell specific expression of TCA4/SLC. Interestingly, the recruitment of lymphocytes and DC to pancreatic islets appeared to be sufficient to trigger development of organized lymphoid tissue. Our results suggest that the spontaneous development and organization of lymphoid tissues, including stroma, can be triggered by the simple accumulation of lymphocytes in an Ag-independent manner and that the compartmentalization of T and B lymphocytes can be influenced directly by differential responses to the chemokine TCA4/SLC.
| Materials and Methods |
|---|
|
|
|---|
The Ins-TCA4 transgene construct was generated by using the 650-bp rat insulin II HindIII-XhoI promoter fragment containing a single intron in the 5' untranslated region, attached to a 2.5-kb BstXI genomic clone of the mouse TCA4 gene isolated from a strain 129 genomic library (our unpublished data). Transgenic mice were generated by microinjection into (BALB/c x C57BL/6)F2 embryos and backcrossed to C57BL/6 mice. Two founders were generated, but only one contained one to two complete copies of the transgene. Expression of transgene mRNA was assayed using RT-PCR of mRNA from several tissues. Using a 5' primer, specific for the insulin 5' untranslated sequence upstream from the intron (CTAAGTGACCAGCTACAGTCG) and a 3' primer, specific for the TCA4 mRNA (CTGGCTGTACTTAAGGCAGCA), PCR amplification of the transgene genomic DNA yielded a band of 375 bp, whereas the expressed mRNA/cDNA yielded a band of 250 bp. Mice were also backcrossed to RAG-1 (The Jackson Laboratory, Bar Harbor, ME) and Ikaros knockout mice (provided by K. Georgopoulos, Harvard Medical School, Charlestown, MA). All mice were housed in the vivarium at The Scripps Research Institute in accordance with institutional and National Institutes of Health guidelines.
TCA4 ELISA
Pancreas and lymph nodes (mesenteric, axillary, cervical, and inguinal) harvested from normal and transgenic mice (25 mg) were homogenized in 0.3 ml PBS containing 1 mM PMSF, 0.01 mg/ml leupeptin, and 0.01 mg/ml aprotinin. The extract was sonicated and centrifuged, and supernatants were removed for assay. TCA4 was detected by ELISA using immobilized mAb 4B1 for capture and biotinylated mAb 3D5 (both mAb developed by M. Dorf, see Ref. 7) followed by alkaline phosphatase-coupled avidin (Pierce, Rockford, IL) and 5 mM p-nitrophenyl phosphate (Sigma, St. Louis, MO) for detection. TCA4 concentrations were calculated from standard curves created by titrating recombinant TCA4 into similar tissues from TCA4-deficient plt/plt mice (16, 17).
Immunostaining and flow cytometry
For immunostaining of tissues, cryostat sections (610 µM) were fixed in ice-cold acetone and incubated with Abs listed below. For flow cytometry, fluorescent conjugates were used. In the case of lymphocytes isolated from islet infiltrates, pancreas was digested for 1015 min at 37°C in collagenase/DNase I (Sigma), followed by manual picking of islets under a dissecting microscope. Cell suspensions were made for immediate staining, although in one experiment, a parallel set of cells was cultured at 37°C in RPMI 1640/10% FBS for 1 h before staining. Abs used was as follows: PE-conjugated anti-CD4, PE-conjugated anti-CD8, biotinylated anti-B220, biotinylated anti-MAdCAM-1, biotinylated anti-PNAd, biotinylated anti-CD11c, FITC-conjugated anti-CD44, biotinylated anti-CD62L, FITC-conjugated anti-CD25, and FITC-conjugated anti-CD69 (PharMingen, San Diego, CA), purified anti-F4/80, and anti-NLDC-145/DEC-205 (Serotec, Oxford, U.K.), anti-FDC-M1 (gift from Dr. M. Kosco-Vilbois, Glaxo Wellcome Geneva, Switzerland), and anti-ER-TR7 (Accurate Chemicals, Westbury NY). For histological studies, purified primary Abs were detected using biotinylated anti-Rat IgG and peroxidase-conjugated streptavidin (Jackson ImmunoResearch, West Grove, PA), using 3-amino-9-ethylcarbazole as a chromagen, and for FACS analysis, biotinylated Abs were detected using streptavidin-conjugated APC (PharMingen).
| Results and Discussion |
|---|
|
|
|---|
To assess the effects of localized expression of TCA4/SLC, we generated transgenic mice using the rat insulin II promoter and the structural gene for TCA4/SLC (Ins-TCA4). Expression of the transgene was specific to the pancreas by RT-PCR and was not detectable in lymph node, spleen, thymus, skin, kidney, and liver (data not shown). Nontransgenic pancreas analyzed by ELISA contained only 0.06 ± 0.07 ng/mg TCA4 (10 mice), whereas Ins-TCA4 pancreas contained 2.77 ± 0.65 ng/mg (8 mice), comparable to levels in normal lymph node (1.95 ± 0.3 ng/mg from nontransgenic axillary, cervical, and inguinal nodes (5 mice), 2.08 ± 0.39 ng/mg from transgenic nodes (8 mice)).
In young Ins-TCA4 transgenic mice (46 wk of age), pancreatic islets
contained small focal mononuclear infiltrates near the centers of the
islets containing CD4 (Fig. 1
A) and CD8 (data not shown) T
cells, and CD11c+ F4/80-
NLDC-145+ DC (Fig. 1
B). B cells were
only found as scattered cells at the perimeter of the islets, not
associated with T cell clusters (Fig. 1
C), suggesting that B
cells respond differently to the chemokine. In older Ins-TCA4 animals
(6 wk to 4 mo), larger islet infiltrates were evident, with two
striking features: First, islet tissue appeared to be intact, but
pushed to the margins of the infiltrates (Fig. 1
, EI).
Accordingly, Ins-TCA4 mice did not develop hyperglycemia even after
several months. Second, the infiltrates resembled normal lymphoid
tissue: Lymph node stromal reticulum development was evident, as ER-TR7
staining (18) detected a network of cells throughout the
lymphoid tissue (Fig. 1
, D and E). MAdCAM-1 and
PNAd were detectable on vascular endothelium, which showed morphology
consistent with HEV (Fig. 1
, F and G). T cell/DC
clusters merged with the collections of B cells, forming a lymph
node-like structure with B cell follicles at the perimeter of the
tissue (Fig. 1
, H and I). Within B cell
follicles, weak staining for the follicular DC marker FDC-M1
(19) was detectable, although germinal center formation
was absent (data not shown). Not all Ins-TCA4 islets developed
organized lymphoid tissue, but nearly all islets contained at least
some lymphocytes, and all transgenic animals showed at least some
lymphoid tissues in islets. These islet lymphoid infiltrates were
easily distinguished from normal lymph node by the presence of islet
tissue and the absence of a connective tissue capsule.
|
In studies on a transgenic model expressing lymphotoxin
in
islets (RIP-LT), lymphoid neogenesis was also observed, but nearly all
lymphocytes showed an activated CD44 high phenotype (6, 20). Indeed, in both the RIP-LT mice and in spontaneous
autoimmune diabetes, lymphocyte activation is present, either as a
nonspecific response to an inflammatory cytokine or as a specific
response to islet Ag. Thus, from those results it could not be
established whether lymphocyte activation is a prerequisite for
lymphoid neogenesis. By contrast, lymphocytes isolated from Ins-TCA4
islets were similar to normal lymph node in the proportions of CD4/CD8
T cells and B cells and their expression of activation markers. Flow
cytometry analysis showed that islet lymphocytes appeared to be
predominantly naive cells, similar to peripheral nodes from the same
mice. That is, lymphocytes were mostly small lymphocytes by forward
light scatter (data not shown), CD44low (Fig. 2
A) and negative for CD25 and
CD69 (data not shown).
|
Considering the ability of the transgene TCA4/SLC to drive new lymphoid
tissue growth, it was possible that the chemokine may also expand the
total lymphocyte pool. To test this, we counted lymph node and spleen
cells from Ins-TCA4 mice and littermate controls (Table I
). There was no clear effect on the
total numbers of lymphocytes in these tissues; however, since these
counts do not include the islet infiltrates, there may be a significant
overall increase in the total number of lymphocytes over time due to
the increase in the total lymphoid tissue.
|
It is possible that lymphoid tissue development in the fetus uses
distinct mechanisms from those involved in lymphoid neogenesis in the
adult. In this context, we began an analysis of Ins-TCA4 mice
backcrossed to RAG-1 and Ikaros knockouts (Fig. 3
). In the case of RAG-1 knockout mice,
normal lymph node stroma developed in the fetus despite the absence of
lymphocytes, possibly due to a
CD3-CD4+LTß+
cell-driving stromal development (21, 22). In contrast,
mice deficient in the transcription factor Ikaros fail to develop any
peripheral lymph node tissue (23, 24). T lymphocyte
development is delayed in these mice, but it is not clear whether this
is responsible for the lymph node defect. Thus, backcrossing the
Ins-TCA4 transgene to these knockouts may help distinguish between
different mechanisms of lymphoid tissue development.
|
In Ikaros knockout mice, T cells but not B cells are generated late in
mouse development due to late compensatory expression of the related
gene Aiolos (24). In these studies, we used Ikaros
"null" mice with a complete deficiency in Ikaros expression
(23); as described for the Ikaros dominant negative
mutant, these mice also fail to generate lymph nodes (data not shown).
In mice with the Ins-TCA4 transgene on the Ikaros knockout background,
lymphoid tissues still developed in islets: they contained CD4 (Fig. 3
B) and CD8 T cells and NLDC-145+ DC
(data not shown), with development of ER-TR7+
stromal reticulum (Fig. 3
C), and
MAdCAM-1+ PNAd+ HEV (Fig. 3
, D and E). Thus, although normal peripheral
lymph nodes were not produced, recruitment of T cells (without B cells)
to Ins-TCA4 islets was sufficient to trigger new lymphoid tissue
development.
It has not yet been established whether Ikaros expression is required in lymphoid stroma. However, it is possible that while the absence of early Ikaros expression blocked normal lymph node development, inducible expression of Aiolos (or related molecule) in stromal cells may allow for the induction of lymphoid neogenesis in adult tissues. Assuming Ikaros null T cells are capable of expressing LT ligands, these may be sufficient to trigger this alternative mechanism of stromal cell development.
In summary, the expression of a TCA4/SLC transgene was sufficient to
drive lymphoid neogenesis under conditions where the majority of
recruited cells showed a naive phenotype. Induction of lymphoid stromal
cell development (HEV, stromal reticular cells) occurs late and
continues through adult life, probably through lymphotoxin-mediated
signals (27). It will be of great interest to identify the
specific signals involved, since studies on the role of LT
and LTß
in normal lymph node development had previously suggested that lymphoid
tissue could only develop within an early developmental window in fetal
life (28). Finally, the differential recruitment of
B cells relative to T cells and DC suggests that the action of TCA4/SLC
has a primary role in the segregation of lymphoid compartments.
Maintenance of the lymphoid compartment segregation may then depend on
subsequent B cell-mediated induction of follicular DC producing the B
cell chemokine BLC (29, 30).
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. David Lo, Department of Immunology IMM-25, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037. ![]()
3 Abbreviations used in this paper: DC, dendritic cell; HEV, high endothelial venule; MAdCAM-1, mucosal addressin cell adhesion molecule-1; PNAd, peripheral lymph node addressin. ![]()
Received for publication November 23, 1999. Accepted for publication February 11, 2000.
| References |
|---|
|
|
|---|
3 and membrane lymphotoxin-
1ß2 in lymphotoxin-induced inflammation: critical role of TNF receptor 1 signaling. J. Immunol. 160:485.
/ß complex is required for the development of peripheral lymphoid organs. J. Exp. Med. 184:1999.
/ß and tumor necrosis factor are required for stromal cell expression of homing chemokines in B and T cell areas of the spleen. J. Exp. Med. 189:403.This article has been cited by other articles:
![]() |
A. L. Fletcher, N. Seach, J. J. Reiseger, T. E. Lowen, M. V. Hammett, H. S. Scott, and R. L. Boyd Reduced Thymic Aire Expression and Abnormal NF-{kappa}B2 Signaling in a Model of Systemic Autoimmunity J. Immunol., March 1, 2009; 182(5): 2690 - 2699. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Manzo, S. Bugatti, R. Caporali, R. Prevo, D. G. Jackson, M. Uguccioni, C. D. Buckley, C. Montecucco, and C. Pitzalis CCL21 Expression Pattern of Human Secondary Lymphoid Organ Stroma Is Conserved in Inflammatory Lesions with Lymphoid Neogenesis Am. J. Pathol., November 1, 2007; 171(5): 1549 - 1562. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Unsoeld, K. Mueller, U. Schleicher, C. Bogdan, J. Zwirner, D. Voehringer, and H. Pircher Abrogation of CCL21 chemokine function by transgenic over-expression impairs T cell immunity to local infections Int. Immunol., November 1, 2007; 19(11): 1281 - 1289. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. White, D. Carragher, S. Parnell, A. Msaki, N. Perkins, P. Lane, E. Jenkinson, G. Anderson, and J. H. Caamano Lymphotoxin a-dependent and -independent signals regulate stromal organizer cell homeostasis during lymph node organogenesis Blood, September 15, 2007; 110(6): 1950 - 1959. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-m. Liang, C.-p. Zhong, R.-x. Sun, B.-b. Liu, C. Huang, J. Qin, S. Zhou, J. Shan, Y.-k. Liu, and S.-l. Ye Local Expression of Secondary Lymphoid Tissue Chemokine Delivered by Adeno-Associated Virus within the Tumor Bed Stimulates Strong Anti-Liver Tumor Immunity J. Virol., September 1, 2007; 81(17): 9502 - 9511. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rangel-Moreno, J. E. Moyron-Quiroz, L. Hartson, K. Kusser, and T. D. Randall Pulmonary expression of CXC chemokine ligand 13, CC chemokine ligand 19, and CC chemokine ligand 21 is essential for local immunity to influenza PNAS, June 19, 2007; 104(25): 10577 - 10582. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Kocks, A. C. M. Davalos-Misslitz, G. Hintzen, L. Ohl, and R. Forster Regulatory T cells interfere with the development of bronchus-associated lymphoid tissue J. Exp. Med., April 16, 2007; 204(4): 723 - 734. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okada and J. G. Cyster CC Chemokine Receptor 7 Contributes to Gi-Dependent T Cell Motility in the Lymph Node J. Immunol., March 1, 2007; 178(5): 2973 - 2978. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Damas, C. Smith, E. Oie, B. Fevang, B. Halvorsen, T. Waehre, A. Boullier, U. Breland, A. Yndestad, O. Ovchinnikova, et al. Enhanced Expression of the Homeostatic Chemokines CCL19 and CCL21 in Clinical and Experimental Atherosclerosis: Possible Pathogenic Role in Plaque Destabilization Arterioscler. Thromb. Vasc. Biol., March 1, 2007; 27(3): 614 - 620. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. E. Hopken, A. M. Wengner, C. Loddenkemper, H. Stein, M. M. Heimesaat, A. Rehm, and M. Lipp CCR7 deficiency causes ectopic lymphoid neogenesis and disturbed mucosal tissue integrity Blood, February 1, 2007; 109(3): 886 - 895. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Katakai, T. Nomura, H. Gonda, M. Sugai, Y. Agata, A. Nishio, T. Masuda, S. Sakaguchi, and A. Shimizu Spontaneous Large-Scale Lymphoid Neogenesis and Balanced Autoimmunity versus Tolerance in the Stomach of H+/K+-ATPase-Reactive TCR Transgenic Mouse J. Immunol., December 1, 2006; 177(11): 7858 - 7867. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Raine, P. Zaccone, P. Mastroeni, and A. Cooke Salmonella typhimurium Infection in Nonobese Diabetic Mice Generates Immunomodulatory Dendritic Cells Able to Prevent Type 1 Diabetes J. Immunol., August 15, 2006; 177(4): 2224 - 2233. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Stachowiak, Y. Wang, Y.-C. Huang, and D. J. Irvine Homeostatic Lymphoid Chemokines Synergize with Adhesion Ligands to Trigger T and B Lymphocyte Chemokinesis J. Immunol., August 15, 2006; 177(4): 2340 - 2348. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yamagami, P. Hamrah, K. Miyamoto, D. Miyazaki, I. Dekaris, T. Dawson, B. Lu, C. Gerard, and M. R. Dana CCR5 Chemokine Receptor Mediates Recruitment of MHC Class II-Positive Langerhans Cells in the Mouse Corneal Epithelium Invest. Ophthalmol. Vis. Sci., April 1, 2005; 46(4): 1201 - 1207. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Heikenwalder, N. Zeller, H. Seeger, M. Prinz, P.-C. Klohn, P. Schwarz, N. H. Ruddle, C. Weissmann, and A. Aguzzi Chronic Lymphocytic Inflammation Specifies the Organ Tropism of Prions Science, February 18, 2005; 307(5712): 1107 - 1110. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Eksteen, A. J. Grant, A. Miles, S. M. Curbishley, P. F. Lalor, S. G. Hubscher, M. Briskin, M. Salmon, and D. H. Adams Hepatic Endothelial CCL25 Mediates the Recruitment of CCR9+ Gut-homing Lymphocytes to the Liver in Primary Sclerosing Cholangitis J. Exp. Med., December 6, 2004; 200(11): 1511 - 1517. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Martin, E. C. Coronel, G.-i. Sano, S.-C. Chen, G. Vassileva, C. Canasto-Chibuque, J. D. Sedgwick, P. S. Frenette, M. Lipp, G. C. Furtado, et al. A Novel Model for Lymphocytic Infiltration of the Thyroid Gland Generated by Transgenic Expression of the CC Chemokine CCL21 J. Immunol., October 15, 2004; 173(8): 4791 - 4798. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Pilkington, I. Clark-Lewis, and S. R. McColl Inhibition of Generation of Cytotoxic T Lymphocyte Activity by a CCL19/Macrophage Inflammatory Protein (MIP)-3{beta} Antagonist J. Biol. Chem., September 24, 2004; 279(39): 40276 - 40282. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Kim, T. Kammertoens, M. Janke, O. Schmetzer, Z. Qin, C. Berek, and T. Blankenstein Establishment of Early Lymphoid Organ Infrastructure in Transplanted Tumors Mediated by Local Production of Lymphotoxin {alpha} and in the Combined Absence of Functional B and T Cells J. Immunol., April 1, 2004; 172(7): 4037 - 4047. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kerjaschki, H. M. Regele, I. Moosberger, K. Nagy-Bojarski, B. Watschinger, A. Soleiman, P. Birner, S. Krieger, A. Hovorka, G. Silberhumer, et al. Lymphatic Neoangiogenesis in Human Kidney Transplants Is Associated with Immunologically Active Lymphocytic Infiltrates J. Am. Soc. Nephrol., March 1, 2004; 15(3): 603 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Baekkevold, M. Roussigne, T. Yamanaka, F.-E. Johansen, F. L. Jahnsen, F. Amalric, P. Brandtzaeg, M. Erard, G. Haraldsen, and J.-P. Girard Molecular Characterization of NF-HEV, a Nuclear Factor Preferentially Expressed in Human High Endothelial Venules Am. J. Pathol., July 1, 2003; 163(1): 69 - 79. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yanagawa and K. Onoe CCR7 ligands induce rapid endocytosis in mature dendritic cells with concomitant up-regulation of Cdc42 and Rac activities Blood, June 15, 2003; 101(12): 4923 - 4929. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Drayton, X. Ying, J. Lee, W. Lesslauer, and N. H. Ruddle Ectopic LT{alpha}{beta} Directs Lymphoid Organ Neogenesis with Concomitant Expression of Peripheral Node Addressin and a HEV-restricted Sulfotransferase J. Exp. Med., May 5, 2003; 197(9): 1153 - 1163. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Weninger, H. S. Carlsen, M. Goodarzi, F. Moazed, M. A. Crowley, E. S. Baekkevold, L. L. Cavanagh, and U. H. von Andrian Naive T Cell Recruitment to Nonlymphoid Tissues: A Role for Endothelium-Expressed CC Chemokine Ligand 21 in Autoimmune Disease and Lymphoid Neogenesis J. Immunol., May 1, 2003; 170(9): 4638 - 4648. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. Savinov, F. S. Wong, A. C. Stonebraker, and A. V. Chervonsky Presentation of Antigen by Endothelial Cells and Chemoattraction Are Required for Homing of Insulin-specific CD8+ T Cells J. Exp. Med., March 3, 2003; 197(5): 643 - 656. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Christopherson II, A. F. Hood, J. B. Travers, H. Ramsey, and R. A. Hromas Endothelial induction of the T-cell chemokine CCL21 in T-cell autoimmune diseases Blood, February 1, 2003; 101(3): 801 - 806. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Jensen, S.-C. Chen, R. W. Hipkin, M. T. Wiekowski, M. A. Schwarz, C.-C. Chou, J. P. Simas, A. Alcami, and S. A. Lira Disruption of CCL21-Induced Chemotaxis In Vitro and In Vivo by M3, a Chemokine-Binding Protein Encoded by Murine Gammaherpesvirus 68 J. Virol., December 6, 2002; 77(1): 624 - 630. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Muller, U. E. Hopken, H. Stein, and M. Lipp Systemic immunoregulatory and pathogenic functions of homeostatic chemokine receptors J. Leukoc. Biol., July 1, 2002; 72(1): 1 - 8. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Luther, A. Bidgol, D. C. Hargreaves, A. Schmidt, Y. Xu, J. Paniyadi, M. Matloubian, and J. G. Cyster Differing Activities of Homeostatic Chemokines CCL19, CCL21, and CXCL12 in Lymphocyte and Dendritic Cell Recruitment and Lymphoid Neogenesis J. Immunol., July 1, 2002; 169(1): 424 - 433. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Grant, S. Goddard, J. Ahmed-Choudhury, G. Reynolds, D. G. Jackson, M. Briskin, L. Wu, S. G. Hubscher, and D. H. Adams Hepatic Expression of Secondary Lymphoid Chemokine (CCL21) Promotes the Development of Portal-Associated Lymphoid Tissue in Chronic Inflammatory Liver Disease Am. J. Pathol., April 1, 2002; 160(4): 1445 - 1455. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-C. Chen, G. Vassileva, D. Kinsley, S. Holzmann, D. Manfra, M. T. Wiekowski, N. Romani, and S. A. Lira Ectopic Expression of the Murine Chemokines CCL21a and CCL21b Induces the Formation of Lymph Node-Like Structures in Pancreas, But Not Skin, of Transgenic Mice J. Immunol., February 1, 2002; 168(3): 1001 - 1008. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-C. Chen, M. W. Leach, Y. Chen, X.-Y. Cai, L. Sullivan, M. Wiekowski, B. J. Dovey-Hartman, A. Zlotnik, and S. A. Lira Central Nervous System Inflammation and Neurological Disease in Transgenic Mice Expressing the CC Chemokine CCL21 in Oligodendrocytes J. Immunol., February 1, 2002; 168(3): 1009 - 1017. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ploix, D. Lo, and M. J. Carson A Ligand for the Chemokine Receptor CCR7 Can Influence the Homeostatic Proliferation of CD4 T Cells and Progression of Autoimmunity J. Immunol., December 15, 2001; 167(12): 6724 - 6730. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Kirk, D. Hartigan-O'Connor, and J. J. Mule The Dynamics of the T-Cell Antitumor Response: Chemokine-secreting Dendritic Cells Can Prime Tumor-reactive T Cells Extranodally Cancer Res., December 1, 2001; 61(24): 8794 - 8802. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. W. Chensue Molecular Machinations: Chemokine Signals in Host-Pathogen Interactions Clin. Microbiol. Rev., October 1, 2001; 14(4): 821 - 835. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Eo, U. Kumaraguru, and B. T. Rouse Plasmid DNA Encoding CCR7 Ligands Compensate for Dysfunctional CD8+ T Cell Responses by Effects on Dendritic Cells J. Immunol., October 1, 2001; 167(7): 3592 - 3599. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hjelmström Lymphoid neogenesis: de novo formation of lymphoid tissue in chronic inflammation through expression of homing chemokines J. Leukoc. Biol., March 1, 2001; 69(3): 331 - 339. [Abstract] [Full Text] |
||||
![]() |
H. Nakano and M. D. Gunn Gene Duplications at the Chemokine Locus on Mouse Chromosome 4: Multiple Strain-Specific Haplotypes and the Deletion of Secondary Lymphoid-Organ Chemokine and EBI-1 Ligand Chemokine Genes in the plt Mutation J. Immunol., January 1, 2001; 166(1): 361 - 369. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Vicari, S. Ait-Yahia, K. Chemin, A. Mueller, A. Zlotnik, and C. Caux Antitumor Effects of the Mouse Chemokine 6Ckine/SLC Through Angiostatic and Immunological Mechanisms J. Immunol., August 15, 2000; 165(4): 1992 - 2000. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |