| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Receptor Loci1
Center for Immunology and Department of Pathology, Washington University School of Medicine, St. Louis, MO 63110
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
receptor gene from original 129 ES cells
are resistant to development of diabetes. However, extended
backcrossing of this mouse line to the NOD mouse resulted in a
segregation of the IFN-R-deficient genotype from the
diabetes-resistant phenotype. These results indicate that the
protection of NOD mice from the development of diabetes is not directly
linked to the defective IFN- receptor gene but, rather, is
influenced by the presence of a diabetes-resistant gene(s) closely
linked to the IFN-R loci derived from the 129 mouse
strain. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Genome-wide search for genes responsible for the development of IDDM revealed the close linkage between the MHC locus (especially class II MHC genes) and IDDM development (9, 10, 11, 12). Further studies in both human and mouse demonstrated that diabetes-prone human class II DQ ß-chains and mouse I-A ß-chains share a unique nonaspartic acid residue at position 57 (13, 14). Thus far, more than 15 loci (idd locus) besides MHC have been reported to influence the development of IDDM, and congenic mouse lines carrying several independent idd genes have been established (9). However, most of these non-MHC idd loci alone have a limited effect on the development of diabetes, and mechanisms by which these loci affect the disease process have been difficult to elucidate.
In this report, we demonstrate the presence of a new diabetes-resistant
gene(s) closely linked to the IFN-R gene. Homozygosity of this gene
(derived from the 129 strain) in NOD mice drastically delays the
progression of diabetes. We also demonstrate that lack of
IFN-/IFN-R interaction confers resistance to cyclophosphamide
(CY)-induced diabetes without affecting the natural course of diabetes
development in NOD mice.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The NOD/Lt mice and IFN- ligand-/-
NOD mice were originally purchased from The Jackson Laboratory (Bar
Harbor, ME) and were maintained in our animal facility under specific
pathogen-free conditions. The 129/Sv mice with targeted disruption of
the IFN-R gene (kindly provided by Dr. M. Aguet, Institut Suisse de
Recherches Experimentales sur le Cancer, Lausanne, Switzerland)
(15) were mated to NOD mice. The F1
mice were backcrossed to NOD mice. The offspring are referred to as
backcross N1. Mice were screened for the presence
of disrupted IFN-R gene using PCR as shown in Fig. 1
, and heterozygous mice
(IFN-R+/-) were used for further
backcrossing. In the initial study, N10 and
N11 generation IFN-R+/-
mice were cross-mated to produce IFN-R-/-
and IFN-R+/- NOD mice. Additional experiments
were conducted with N14 backcross mice.
IFN-R-/- mice described by Wang et al.
(16) were a kind gift from Drs. D. Mathis and C. Benoist
(Institut National de la Santé et de la Recherche Médicale,
Strasbourg, France) and were maintained in our animal facility. Mice
(over 12 wk of age) were monitored weekly for the development of
diabetes using Chemsstrip (Boehringer Mannheim, Indianapolis, IN). Mice
with positive urine glucose were tested for blood glucose levels as
described previously (17). Mice with >250 mg/dl of blood
glucose in two consecutive measurements over 1 wk were considered
diabetic.
|
PCR screening of IFN-R-deficient genotype was conducted using
a combination of primers P1, TTTCTGTCATCATGGAAAGGAGGGATACAG;
P2, CCCATTTAGATCCTACATACGAAACATACG; and Pneo, GCGCATCGCCTTCTATCG with
DNA samples prepared from tail biopsy as shown in Fig. 1
A.
Representative results for each genotype are shown in Fig. 1B. Genotyping for microsatellite markers were conducted by
PCR using commercially supplied primer pairs for chromosome 10
(Research Genetics, Huntsville, AL). DNA samples from individual mice
were analyzed by the methods recommended by the supplier, and PCR
products were separated on 4% agarose gels.
Surface immunofluorescence analysis of class I MHC on peritoneal macrophages
Peritoneal macrophages were collected from mice receiving 3%
thyoglycolate (1.5 ml/mouse i.p. 4 days before the harvest) and
cultured in 5% FCS DMEM (1 x 105/ml) in
the presence or absence of recombinant mouse IFN- (100 U/ml; kindly
provided by Dr. R. Schreiber; Washington University School of Medicine,
St. Louis, MO). After 48 h of incubation, cells were stained with
biotinylated anti-Kd class I MHC mAb
Sf1.1.1.1 (American Type Culture Collection, Manassas, VA) and then
with FITC-coupled streptavidin (Biomedia, Foster City, CA). Stained
samples were analyzed by FACScan analyzer using the CellQuest program
(Becton Dickinson, Mountain View, CA).
Histology
Mice (16 wk old) were sacrificed and the pancreases were fixed in 10% buffered formalin for 24 h. Paraffin-embedded samples were cut and stained with hematoxylin and eosin. Histological evaluation of pancreas was done by counting more than 200 islets from three different mice and scoring each islet for the degree of cellular infiltrate (noncellular, peri-islet, and intraislet infiltration and destruction of islet cells).
Induction of diabetes with CY
Mice (8–10 wk old) received i.p. injections of 200 mg/kg CY (Sigma, St. Louis, MO) on days 0 and 14, and the development of diabetes was monitored as described above.
Adoptive transfer of diabetes
Spleen cells from freshly diabetic NOD mice were injected i.v. into irradiated (650 rad) nondiabetic mice as described previously (17). The development of diabetes was monitored as described above.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
response in IFN-R-/- NOD mice
The N10 and N11
backcross mice were screened for the presence of the disrupted IFN-R
gene by the method shown in Fig. 1. Heterozygous
(IFN-R+/-) mice were intercrossed to produce
homozygous receptor-negative mice
(IFN-R-/-). Peritoneal exudate cells from
IFN-R+/- and
IFN-R-/- mice were cultured with IFN- and
tested for expression of class I MHC Kd. As shown
in Fig. 2, class I MHC up-regulation was
lacking in macrophages from IFN-R-/- mice,
whereas cells from IFN-R+/- mice exhibited
IFN- responsiveness as is evident in an increase of surface class
I MHC.
|
R-/- NOD
mice
Cohorts of IFN-R-/- and
IFN-R+/- female mice (both
N10 and N11 backcross mice
were used to generate these mice) were monitored for the development of
diabetes as described in Materials and Methods. Heterozygous
mice developed diabetes starting around 20 wk of age, and more than
80% of mice were diabetic at 35 wk (Table I). This incidence is similar to that of
female NOD mice maintained in our colony. In contrast, no
IFN-R-/- mouse was diabetic at 25 wk, and
only one was found to be diabetic at 35 wk (Table I).
|
R-/- and
IFN-R+/- mice prompted us to determine
whether diabetes can be induced in IFN-R-/-
mice with CY treatment (18).
IFN-R-/- and
IFN-R+/- male mice generated by intercross of
N11 heterozygous mice were treated with CY twice,
on days 0 and 14, and the development of diabetes was monitored for 28
days. Eight of 19 IFN-R+/- mice were diabetic
at 14 days after initial CY treatment, and incidence increased to 95%
after the second treatment (Table II).
Again, only one IFN-R-/- NOD mouse developed
diabetes, and the rest remained diabetes-free during an extended
observation period (up to 8 wk after initial treatment).
|
R-/- NOD mice
The histological analysis of pancreas from 16-wk-old
IFN-R-/- mice revealed limited cellular
infiltration into the islet (peri-insulitis) and no evidence of
destruction of islets. In contrast, an extensive cellular infiltrate
and destruction of pancreatic islets were found in the pancreas of
age-matched IFN-R+/- mice (Table III). These results clearly demonstrate
that cellular infiltrate into islets is significantly delayed in
IFN-R-/- NOD mice.
|
R-/- NOD mice
Diabetes can be induced in young nondiabetic NOD mice by transfer
of spleen cells from overtly diabetic mice (6). Using this
system, we tested whether diabetes can be induced in
IFN-R-/- NOD mice by spleen cells from
diabetic wild-type NOD mice. Both IFN-R-/-
and IFN-R+/- mice were irradiated (650 rad)
and received 2 x 107 spleen cells from
diabetic NOD mice. As shown in Table IV,
all of IFN-R+/- mice developed diabetes
within 3 wk after cell transfer. The
IFN-R-/- NOD mice also developed diabetes
after cell transfer, but the onset of diabetes was significantly
delayed (Table IV). Some of the IFN-R-/- NOD
mice became diabetic more than 5 wk after cell transfer.
|
R-/- genotype and diabetes
resistance
After 13 generations of backcrossing, a single male
IFN-R+/- mouse was used to establish an
IFN-R-/- NOD subline. This mouse was mated
to NOD females, and offspring with heterozygocity for defective
IFN-R genes were selected to generate
IFN-R-/- NOD mice. This
IFN-R-/- NOD subline, to our surprise,
developed diabetes with similar onset and penetrance to that of control
heterozygous mice (80% diabetic at age 35 wk; Fig. 3). The homozygocity of the defective
IFN-R gene was confirmed in all of these offspring by PCR and lack
of response to IFN- in vitro by the methods described in Figs. 1 and 2. These results clearly indicate that defect in IFN-/IFN-R
interaction is not sufficient to confer the resistance to diabetes
development.
|
R-/- NOD mice were used as controls for
CY-induced diabetes. However, all of the
IFN-R-/- NOD mice continued to be resistant
to CY-induced diabetes, whereas in contrast, all of the
IFN-R+/- and wild-type NOD mice developed
diabetes 4 wk after CY treatment (Table V). The discrepancy between natural
development of diabetes and CY-induced diabetes in
IFN-R-/- NOD mice prompted us to investigate
the role of IFN-/IFN-R interaction in the development of
CY-induced acceleration of diabetes.
IFN--/-, diabetes-susceptible
IFN-R-/-, and control NOD mice received two
injections of CY 2 wk apart and were monitored for the development of
diabetes. As shown in Table V, all of the control mice developed
diabetes within 4 wk after initial CY treatment, whereas none of the
IFN--/- or
IFN-R-/- mice developed diabetes. They
remained diabetes-free for an extended time of observation (up to 8
wk). Thus, lack of IFN-/IFN-R interaction confers resistance to
CY-induced diabetes. Because these NOD sublines showed normal
development of diabetes (Fig. 3 and Ref. 19), resistance
to CY-induced diabetes is not linked to resistance to the normal
development of diabetes.
|
R-/- NOD mice, we
obtained the diabetes-resistant IFN-R-/- NOD
mouse line described by Wang et al. (16). DNA from these
mice were analyzed using microsatellite markers, which detect the
genetic differences on chromosome 10 between 129 and NOD mice. As
summarized in Table VI, a majority of
markers did not discriminate between the two sublines of NOD mice.
However, diabetes-susceptible and diabetes-resistant lines showed a
difference with the D10 Mit 87 marker. This marker is located at 1
centimorgan of the teromeric region of IFN-R gene, and the
susceptible subline carried the NOD-derived gene, whereas the resistant
line had the 129-derived gene. Thus, chromosome crossover must have
occurred at the centromeric site of this marker in the
diabetes-susceptible line. As expected, both lines carry the
129-derived gene near the IFN-R gene, and no difference was detected
with the other markers located at the centromeric region of chromosome
10 (Table VI).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
R gene
from the 129 mouse are resistant to the development of diabetes.
However, after extended backcrossing, we were able to separate the
IFN-R-/- genotype and diabetes resistance.
Because NOD mice carrying IFN-R-/- genotype
developed diabetes with kinetics similar to those of normal NOD mice, a
lack of IFN-/IFN-R interaction does not directly confer
resistance to diabetes development. This is in agreement with a
previous report that a lack of functional IFN- gene had only a minor
effect on the development of diabetes in NOD mice (19).
These results strongly suggest the presence of a gene(s) in the
franking region of the 129 IFN-R structural gene that affects the
development of diabetes. In contrast to the natural development of
diabetes, mice carrying either the IFN- ligand-deficient or
IFN-R-deficient genotype are resistant to CY-induced diabetes,
indicating that IFN-/IFN-R interaction plays a key role in the
acceleration of disease induced by an exogenous factor such as
CY.
The phenotype of our IFN-R-/- NOD mice with
limited backcrossing was the delayed onset of insulitis and diabetes
and resistance to CY-induced diabetes. The initial event in the
development of diabetes in the NOD mouse is a nondestructive cellular
infiltrate into pancreatic islets. MHC congenic NOD mice (NOD mice
carrying non-H-2g7 MHC) also exhibit significant cellular infiltrate
(20), although these mice do not develop diabetes. In
contrast, B6 mice carrying H-2g7 showed little, if any, cellular
infiltrate into islets (21). These results indicate that,
in the NOD mice, the initial cellular infiltrate into pancreatic islets
is controlled by a non-MHC gene(s). This initial cellular infiltrate is
drastically delayed in diabetes-resistant NOD
IFN-R-/- mice. These results are compatible
with the findings reported by Wang et al. (16). However,
in their study, transfer of diabetogenic CD4 T cells failed to induce
diabetes in NOD IFN-R-/- mice. In contrast,
in our study, spleen cells from diabetic NOD mice did transfer diabetes
into the diabetes-resistant IFN-R-/- mice,
although the onset of diabetes is slightly delayed. The transfer of
disease by diabetic spleen cells has been shown to be dependent on both
CD4 and CD8 T cell populations (6). These results suggest
that transfer of disease in the IFN-R-/-
mice by CD4+ T cells from TCR transgenic mice
(22) and by a combination of CD4 and CD8 T cells from
normal diabetic NOD mice (6) have very distinct outcomes.
However, it is not clear whether this difference is due to a lack of
IFN-/IFN-R interaction affecting T cell function or due to
factors associated with another resistance gene(s).
The segregation between the IFN-R-/-
genotype and the diabetes-resistant phenotype in
N13 backcrossed mice clearly demonstrates the
presence of an additional gene(s) from 129 mice responsible for
diabetes resistance. The resistant gene(s) introduced in the NOD
IFN-R-/- mice may also play an important
role in the suppression of the initial cellular infiltration into
islets. Our analysis using microsatellite marker PCR detected the
difference between diabetes-susceptible and diabetes-resistant
IFN-R-/- mouse lines. These two lines
exhibited a difference in the genetic locus as evidenced by D10 Mit 87
marker PCR analysis. Diabetes-susceptible
IFN-R-/- mice have the NOD-derived gene at
this location, whereas the diabetes-resistant line has the 129-derived
gene. Thus, it is likely that the 129-derived gene located between two
crossing-over events (upstream of the D10 Mit 87 for the
diabetes-susceptible subline and between D10 Mit 87 and D10 Mit 255 for
the diabetes-resistant line) is responsible for the phenotypic
difference between these two IFN-R-/- NOD
lines (Fig. 4). It should also be noted
that the diabetes-resistant mice shown in Table I had a crossing-over
event similar to those shown in Table VI. Detailed analysis of this
region of the chromosome using these two lines of
IFN-R-/- NOD mouse will facilitate the
identification and characterization of the gene(s) involved in
protection from diabetes.
|
R
gene) and diabetes development was found in the previous genome-wide
search for genes influencing IDDM (9). Furthermore, the
introduction of the 129-derived IFN-R loci into NOD mice did not
show any protective effect on the development of diabetes
(16). Therefore, it is possible that the homozygocity of
the gene(s) derived from the 129 mouse may not exhibit a protective
effect by itself. However, all of the NOD mice that did not develop
diabetes in this study were also carrying the defective IFN-R gene
on both chromosomes. Thus, it is possible that a gene(s) introduced
into NOD mice together with the defective IFN-R gene from the 129
strain may require defective IFN-/IFN-R interaction to
mediate a protective effect on diabetes. This possibility is now being
tested by introducing 129-derived IFN-R gene loci into
IFN--negative NOD mice. This will reveal a possible role of
IFN-/IFN-R interaction in the regulation of diabetes
development.
The mechanisms by which CY rapidly induces diabetes in NOD mice are not
well understood. However, CY induces diabetes only in NOD mice and not
in any other strain of mouse, including MHC congenic NOD mouse lines
(20). These results indicated that induction of diabetes
by CY requires the presence of diabetogenic cellular responses. It is
also assumed that CY eliminates cell populations that down-regulate
diabetogenic T cell populations (18). Absolute resistance
of diabetes-susceptible IFN-R-/- and
IFN--/- to CY-induced diabetes indicated
that induction or acceleration of diabetes process by CY requires
IFN-/IFN-R interaction. It is possible that the mechanisms by
which lack of IFN-/IFN-R-/- interaction
protects mice from CY-induced diabetes also play an important role in
resistance to the natural development of diabetes. Thus,
characterization of the 129-derived gene linked to the IFN-R gene as
well as understanding of the resistance of
IFN-R-/- mice to CY-induced diabetes are
needed to fully understand the mechanisms by which diabetogenic process
can be abrogated in the NOD mouse model of IDDM.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Osami Kanagawa, Department of Pathology, Washington University Medical School, Box 8118, 660 South Euclid Avenue, St. Louis, MO 63110. E-mail address:
3 Abbreviations used in this paper: IDDM, insulin-dependent diabetes mellitus; NOD, nonobese diabetic; CY, cyclophosphamide.
Received for publication November 18, 1999. Accepted for publication January 14, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
genes. Science 259:1739. impacts at multiple points during the progression of autoimmune diabetes. Proc. Natl. Acad. Sci. USA 94:13844.-interferon delays but does not prevent diabetes in NOD mice. Diabetes 45:812.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  H. Ohta, Y. Ohinata, M. Ikawa, Y. Morioka, Y. Sakaide, M. Saitou, O. Kanagawa, and T. Wakayama Male Germline and Embryonic Stem Cell Lines from NOD Mice: Efficient Derivation of GS Cells from a Nonpermissive Strain for ES Cell Derivation Biol Reprod, December 1, 2009; 81(6): 1147 - 1153. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Mori, T. Kodaka, T. Kato, E. M. Kanagawa, and O. Kanagawa Critical role of IFN-{gamma} in CFA-mediated protection of NOD mice from diabetes development Int. Immunol., November 1, 2009; 21(11): 1291 - 1299. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kamanaka, D. Rainbow, K. Schuster-Gossler, E. E. Eynon, A. V. Chervonsky, L. S. Wicker, and R. A. Flavell Amino acid polymorphisms altering the glycosylation of IL-2 do not protect from type 1 diabetes in the NOD mouse PNAS, July 7, 2009; 106(27): 11236 - 11240. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Esensten, M. R. Lee, L. H. Glimcher, and J. A. Bluestone T-bet-Deficient NOD Mice Are Protected from Diabetes Due to Defects in Both T Cell and Innate Immune System Function J. Immunol., July 1, 2009; 183(1): 75 - 82. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. H. Leiter, P. C. Reifsnyder, R. Wallace, R. Li, B. King, and G. C. Churchill NOD x 129.H2g7 Backcross Delineates 129S1/SvImJ-Derived Genomic Regions Modulating Type 1 Diabetes Development in Mice Diabetes, July 1, 2009; 58(7): 1700 - 1703. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. K. Turner, J. L. Xu, and R. I. Tapping Substrains of 129 Mice Are Resistant to Yersinia pestis KIM5: Implications for Interleukin-10-Deficient Mice Infect. Immun., January 1, 2009; 77(1): 367 - 373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Calderon, A. Suri, X. O. Pan, J. C. Mills, and E. R. Unanue IFN-{gamma}-Dependent Regulatory Circuits in Immune Inflammation Highlighted in Diabetes J. Immunol., November 15, 2008; 181(10): 6964 - 6974. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Mori, T. Kato, T. Kodaka, E. M. Kanagawa, S. Hori, and O. Kanagawa Protection of IFN-{gamma} signaling-deficient NOD mice from diabetes by cyclophosphamide Int. Immunol., September 1, 2008; 20(9): 1231 - 1237. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Duffy, S. M. Sparshott, C.-p. Yang, and E. B. Bell Transgenic CD4 T Cells (DO11.10) Are Destroyed in MHC-Compatible Hosts by NK Cells and CD8 T Cells J. Immunol., January 15, 2008; 180(2): 747 - 753. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Cain, J. A. Smith, J. K. Ondr, B. Wang, and J. D. Katz NKT Cells and IFN-{gamma} Establish the Regulatory Environment for the Control of Diabetogenic T Cells in the Nonobese Diabetic Mouse J. Immunol., February 1, 2006; 176(3): 1645 - 1654. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Salam, K. Matin, N. Matsumoto, Y. Tsuha, N. Hanada, and H. Senpuku E2f1 Mutation Induces Early Onset of Diabetes and Sjogren's Syndrome in Nonobese Diabetic Mice J. Immunol., October 15, 2004; 173(8): 4908 - 4918. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Matos, R. Park, D. Mathis, and C. Benoist Progression to Islet Destruction in a Cyclophosphamide-Induced Transgenic Model: A Microarray Overview Diabetes, September 1, 2004; 53(9): 2310 - 2321. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Sarween, A. Chodos, C. Raykundalia, M. Khan, A. K. Abbas, and L. S. K. Walker CD4+CD25+ Cells Controlling a Pathogenic CD4 Response Inhibit Cytokine Differentiation, CXCR-3 Expression, and Tissue Invasion J. Immunol., September 1, 2004; 173(5): 2942 - 2951. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. W. Chong, Y. Chen, R. Darwiche, N. L. Dudek, W. Irawaty, P. Santamaria, J. Allison, T. W. H. Kay, and H. E. Thomas Suppressor of Cytokine Signaling-1 Overexpression Protects Pancreatic {beta} Cells from CD8+ T Cell-Mediated Autoimmune Destruction J. Immunol., May 1, 2004; 172(9): 5714 - 5721. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Esteban, T. Tsoutsman, M. A. Jordan, D. Roach, L. D. Poulton, A. Brooks, O. V. Naidenko, S. Sidobre, D. I. Godfrey, and A. G. Baxter Genetic Control of NKT Cell Numbers Maps to Major Diabetes and Lupus Loci J. Immunol., September 15, 2003; 171(6): 2873 - 2878. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Cenci, G. Toraldo, M. N. Weitzmann, C. Roggia, Y. Gao, W. P. Qian, O. Sierra, and R. Pacifici Estrogen deficiency induces bone loss by increasing T cell proliferation and lifespan through IFN-{gamma}-induced class II transactivator PNAS, September 2, 2003; 100(18): 10405 - 10410. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Trembleau, G. Penna, S. Gregori, N. Giarratana, and L. Adorini IL-12 Administration Accelerates Autoimmune Diabetes in Both Wild-Type and IFN-{gamma}-Deficient Nonobese Diabetic Mice, Revealing Pathogenic and Protective Effects of IL-12-Induced IFN-{gamma} J. Immunol., June 1, 2003; 170(11): 5491 - 5501. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. V. Serreze, M. A. Pierce, C. M. Post, H. D. Chapman, H. Savage, R. T. Bronson, P. B. Rothman, and G. A. Cox Paralytic Autoimmune Myositis Develops in Nonobese Diabetic Mice Made Th1 Cytokine-Deficient by Expression of an IFN-{gamma} Receptor {beta}-Chain Transgene J. Immunol., March 1, 2003; 170(5): 2742 - 2749. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Minamino, T. Yujiri, N. Terada, G. E. Taffet, L. H. Michael, G. L. Johnson, and M. D. Schneider MEKK1 is essential for cardiac hypertrophy and dysfunction induced by Gq PNAS, March 19, 2002; 99(6): 3866 - 3871. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Potter, S. R. Rittling, D. T. Denhardt, R. J. Roper, J. H. Weis, C. Teuscher, and J. J. Weis Role of Osteopontin in Murine Lyme Arthritis and Host Defense against Borrelia burgdorferi Infect. Immun., March 1, 2002; 70(3): 1372 - 1381. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. E. Thomas, R. Darwiche, J. A. Corbett, and T. W.H. Kay Interleukin-1 Plus {gamma}-Interferon-Induced Pancreatic {beta}-Cell Dysfunction Is Mediated by {beta}-Cell Nitric Oxide Production Diabetes, February 1, 2002; 51(2): 311 - 316. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M.W. Chong, H. E. Thomas, and T. W.H. Kay {gamma}-Interferon Signaling in Pancreatic {beta}-Cells Is Persistent but Can Be Terminated by Overexpression of Suppressor of Cytokine Signaling-1 Diabetes, December 1, 2001; 50(12): 2744 - 2751. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Y. Savinov, F. S. Wong, and A. V. Chervonsky IFN-{gamma} Affects Homing of Diabetogenic T Cells J. Immunol., December 1, 2001; 167(11): 6637 - 6643. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. P.L. Chiu, D. V. Serreze, and J. S. Danska Development and Function of Diabetogenic T-cells in B-cell-Deficient Nonobese Diabetic Mice Diabetes, April 1, 2001; 50(4): 763 - 770. [Abstract] [Full Text]
|
|
|
|
|
|
D. V. Serreze, H. D. Chapman, C. M. Post, E. A. Johnson, W. L. Suarez-Pinzon, and A. Rabinovitch Th1 to Th2 Cytokine Shifts in Nonobese Diabetic Mice: Sometimes an Outcome, Rather Than the Cause, of Diabetes Resistance Elicited by Immunostimulation J. Immunol., January 15, 2001; 166(2): 1352 - 1359. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Radu, N. Noben-Trauth, J. Hu-Li, W. E. Paul, and C. A. Bona A targeted mutation in the IL-4Ralpha gene protects mice against autoimmune diabetes PNAS, November 7, 2000; 97(23): 12700 - 12704. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) and control
heterozygous female mice (13 mice, closed circle) were monitored for
the development of diabetes for 35 wk.