| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Xcyte Therapies, Seattle, WA 98104; and
Department of Medical Microbiology and Immunology, Cell Cybernetics Laboratory, The Panum Institute, University of Copenhagen, Copenhagen, Denmark
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-1, IL-6, and IL-8) and chemokines (including
RANTES, macrophage-inflammatory protein-1, macrophage-inflammatory
protein-1ß, and mannose chemoattractant protein-1), which have
important effects on both APC and T cell activation and maturation
(1, 2). Humans with a genetic defect in the CD154 gene and
knockout mice lacking either CD40 or CD154 have emphasized the crucial
role of CD40-CD154 interactions for generation of a thymus-dependent
humoral immune response and major parts of the cellular immune response
(3). Not surprisingly, subsequent studies have
demonstrated a central role of CD40-CD154 interactions for generation
of protective T cell-mediated tumor immunity, conversion of tolerant
tumor-specific CD4 and CD8 cells, efficient clearance of viral
infections, and generation of CD8 effector CTLs (4, 5, 6, 7, 8, 9, 10).
Thus, the CD40-CD154 interaction is vital for the initiation and
duration of the delicate process where T cells and APCs undergo
mutually beneficial interactions leading to activation of the acquired
immune system. |
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
PBMC were obtained from healthy human volunteer donors using
standard procedures. Phagocytic cells were depleted by incubation with
uncoated Dynal beads, two beads per cell for 2 h at 37°C,
followed by magnetic depletion (monocytes and macrophages efficiently
phagocytose the beads). Cells were stimulated with Dynal beads coupled
to anti-CD3 (OKT-3) and anti-CD28 (9.3) Abs (11),
three beads per cell. Pure CD4 T cells were obtained by reacting cells
with Abs against human CD8 (10 µg/ml), CD14 (1 µg/ml), CD16 (1
µg/ml), and CD20 (10 µg/ml) followed by two rounds of magnetic
depletion with sheep anti-mouse-coated Dynal beads, six beads per
cell. Neutralizing anti-human IL-2, IL-4, and IFN-
Abs were used
at 10 µg/ml and obtained from PharMingen (San Diego, CA). IL-2 was
obtained from Boehringer Mannheim (Indianapolis, IN).
Flow cytometry
Cells were labeled with PE-coupled anti-human CD154 Ab (Becton Dickinson, Mountain View, CA) or PE-coupled IgG1 isotype control Ab and FITC-coupled anti-human CD4 (Immunotech, Westbrook, ME), washed, and resuspended in 1% paraformaldehyde. For intracellular CD154 staining, cells were first surface labeled as described above, but with a nonconjugated anti-human CD154 Ab or control Ab. Cells were then fixed and permeabilized using a Becton Dickinson intracellular staining kit and labeled with PE-conjugated anti-human CD154 Ab or isotype control Ab. Data acquisition and flow cytometric analysis were performed on a Becton Dickinson FACSCalibur using CellQuest software.
RT-PCR
RNA was purified from 106 cells using Trizol. RT-PCR was run with a CD154 primer set: (CTGCAAGGTGACACTGTTC;CACAGCATGATCGAAACATAC) or (GGTGATTCTAGACACAGCATGATCGAAACATACAAC;GGTGATTCTAGAAGGTGACACTGTTCAGAGTTTGAG) and a GADPH primer set: (CGCTGAGTACGTCGTGGAGTCCAC;GACATCAAGAAGGTGGTGAAGCAG) using Titan one-step RT-PCR (Boehringer Mannheim) with 35 PCR cycles: 94°C for 30 s, 56°C for 60 s, and 68°C for 180 s.
Coculture experiment
Purified CD4 T cells were stained with 5-(and 6)-carboxyfluorescein diacetate succinimidyl ester (CFDA-SE)3 (Molecular Probes, Eugene, OR) for 10 min in PBS, at 25°C, washed, and fixed in 0.5% paraformaldehyde for 15 min at 25°C. After extensive washing, cells were cultured along with the Daudi B cell lymphoma line at a 1:1 ratio for 24 h. Cells were subsequently stained with PE-coupled anti-human CD54 (Coulter, Palo Alto, CA). CD54 expression on Daudi cells was measured by excluding CFDA-SE-positive cells. CD40-Ig fusion protein was used at 10 µg/ml.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Expression of CD154 on CD4 T cells has mainly been studied after TCR or ionomycin/PMA stimulation, which has revealed a very transient expression of CD154 (<24 h) that is dependent on calcineurin/NF-AT activation (12, 13, 14). To study CD154 expression under more physiological conditions, we used Abs against CD3 and CD28 coupled to beads (3x28 beads) as a form of surrogate APC. These beads are more potent than soluble or plate-bound Abs, probably due to their topological resemblance to cells, facilitating polarized interactions; an important factor in cell activation that has recently emerged from several excellent studies (15, 16, 17).
Fig. 1
A shows primary/naive
human PBLs stimulated with 3x28 beads. As expected, there was a rapid
induction of surface CD154 expression on CD4 T cells. The level of
surface CD154 was comparable or slightly higher than previously
reported with plate-bound anti-TCR Abs with or without
anti-CD28 costimulation (13, 18, 19). Effector cells,
generated by 12–14-day expansion of cultures stimulated with 3x28
beads at day 0, also rapidly induced CD154 expression on CD4 cells upon
restimulation with 3x28 beads; however, the level of induction was
substantially higher than in naive cells (Fig. 1A). CD154
expression on both activated naive and effector CD4 cells did not
decline as expected and was still expressed at high levels 4 days after
the initial stimulation (Fig. 1A). Fig. 1B shows
a schematic representation of CD154 expression on CD4 cells from PBL
cultures stimulated with 3x28 beads at day 0 and restimulated at day
14. A similar CD154 profile was seen when purified CD4 cells were
stimulated (data not shown), suggesting that CD8 T cells, B cells, or
NK cells are not positively involved in the regulation of CD154 surface
expression. It has previously been shown that large numbers of
CD40-positive cells can induce down-modulation of CD154 on CD4 cells
(20, 21); however, we did not see this effect in our PBL
cultures, possibly due to the low amount of B cells present
(3–11%).
|
C). Similar results were seen with the non-CsA-related
calcineurin inhibitor FK-506 (data not shown). This suggests that a
signal pathway distinct from CD3/CD28-induced NF-AT activation is, at
least in part, responsible for the sustained CD154 expression. IL-2 and IL-15 induce CD154 expression on previously activated CD4 cells
One of the main responses to CD28 costimulation of T cells is autocrine production of IL-2; intriguingly, TCR engagement without CD28 costimulation does not activate T cells to produce IL-2 (22). The 3x28 bead-stimulated T cells produce up to 150 U/ml of free IL-2 as measured by ELISA (data not shown).
To investigate the influence of IL-2 on the sustained CD154 expression,
naive or effector cell populations were cultured for 3 days with 3x28
beads to induce CD154 expression, and cells were then washed and
cultured an additional 24 h with 1) 3x28 beads and 100 U/ml IL-2;
2) 3x28 beads and a blocking anti-IL-2 Ab; 3) without the 3x28
beads but with 100 U/ml IL-2; and 4) without the 3x28 beads and with
the blocking anti-IL-2 Ab. Fig. 2A shows the results of this
experiment. Combined removal of the 3x28 beads and blocking of IL-2
completely inhibited CD154 expression on activated naive CD4 cells.
Furthermore, the massive CD154 expression on effector cells was
radically reduced; however, not to baseline levels. Interestingly,
blocking of IL-2 in the presence of beads inhibited CD154 expression on
naive cells by 
55% and on effector cells by 70%. The effect was
specific, as blocking Abs against IL-4 or IFN- had no influence
(data not shown). In the absence of 3x28 bead stimulation, IL-2 induced
approximately half of the CD154 expression on activated naive CD4 cells
and induced CD154 expression on the majority of activated effector CD4
cells. Furthermore, 60–90% of the IL-2-induced CD154 expression was
maintained for 2 days in the absence of 3x28 stimulation (data not
shown). To rule out that withdrawal of IL-2 for 24 h was directly
toxic for the cells, we took the activated naive or effector CD4 cells
previously cultured without 3x28 beads and IL-2 and restimulated them
with 100 U/ml IL-2 for 24 h. This could readily reinduce CD154
expression, an effect not seen with 50 ng/ml IL-4 or 1000 U/ml IFN-
(Fig. 2B). Beyond emphasizing the functional integrity of
the IL-2-deprived cells, this also demonstrates that IL-2 by itself
could induce, and not only sustain, CD154 expression on activated CD4 T
cells. Reactivation with IL-2 did not change the constitutive high
HLA-DR expression or induced expression of 4-1BB or CCR5 (data not
shown), demonstrating that IL-2 restimulation did not unspecifically
alter expression of other surface molecules. Subsequent titration
showed that 5–10 U/ml of IL-2 was necessary for maximal CD154
reinduction on naive or effector cells and that 1–2 U/ml induced half
the maximal CD154 expression (Fig. 2C and data not
shown).
|
B) and could also sustain CD40L
in the absence of 3x28 beads and IL-2 (data not shown). IL-2 and IL-15
share many biological activities and their receptors use the same ß-
and -chain, but have individual -chains (23). In
contrast to IL-2, IL-15 is mainly produced by activated professional
APCs including monocytes, macrophages, and dendritic cells; it is
therefore tempting to speculate that IL-15 produced during T cell-APC
interaction might also participate in the regulation of CD40L
expression in vivo.
It is well known that resting CD4 cells have virtually no CD25 (IL-2R
-chain) and low CD122 (IL-2R ß-chain) expression. Furthermore, our
in vitro generated effector CD4 cells had low, but significant, CD25
expression and low IL-2R ß-chain before restimulation (Table I). To investigate the relative
importance of 3x28 beads and IL-2 at different intervals after
activation, we incubated cells in the presence or absence of 3x28 beads
and/or IL-2 (as described in Fig. 2A) from
days 0 to1, 1 to 2, 2 to 3, and 3 to 4. As seen in Fig. 2, D
and E, IL-2, without prior 3x28 bead stimulation, had no
effect on CD154 expression on naive cells and only a limited effect on
effector cells. In line with this, the 3x28 bead activation accounted
for nearly all CD154 expression after 24 h, as the CD154 level was
only very weakly affected by withdrawal of IL-2. However, gradually the
3x28 bead response weakened and IL-2 took over, most strikingly seen in
effector CD4 cells where IL-2 induced 90% of the CD154 expression
after 3–4 days of activation. Subsequent analysis showed that
induction of IL-2 receptor - and ß-chain expression correlated
with the ability of IL-2 to induce CD154 expression (Table I). However,
there were no significant differences between IL-2 receptor levels on
activated naive and effector CD4 cells, suggesting that the notable
higher CD154 expression on effector cells may be due to enhanced
responsiveness.
|
To investigate how IL-2 regulates CD154 expression, we reinduced
CD154 expression on effector CD4 cells previously rested for 24 h
as described in Fig. 2B, but in the presence of various
inhibitors. CD154 expression was measured after 6 h of 3x28 bead
or IL-2 stimulation to limit the toxic effects of the inhibitors. Fig. 3A shows that pretreatment
with actinomycin D, cyclohexamide, or brefeldin A, inhibitors of
transcription, translation, and transport through the Golgi complex,
respectively, blocked IL-2-induced re-expression of CD154 on previously
activated effector CD4 cells, clearly demonstrating that IL-2 induces
CD154 expression by de novo synthesis. Further analysis showed that
rapamycin, an inhibitor of the IL-2-induced p70s6 kinase,
significantly, but not dramatically, inhibited IL-2-induced CD154
expression (Fig. 3A). Rapamycin had only a limited effect on
3x28 bead-induced CD154 expression (when a blocking anti-IL-2 Ab
was included to neutralize the effect of newly produced IL-2). As
expected, CsA completely inhibited 3x28 bead-induced CD154 expression;
however, IL-2-induced CD154 expression was also affected to some degree
(Fig. 3A). Current knowledge in the field suggests that CsA
does not inhibit IL-2-induced signal transduction. Thus, the most
likely explanation would be that a basal level of calcineurin activity
is involved in IL-2-induced CD154 expression. In conclusion, these
results show that IL-2 induces de novo CD154 production by a distinct
and until now unrecognized signal pathway.
|
B shows the CD154 mRNA level, assessed by RT-PCR, of
3-day 3x28 bead-activated naive or effector CD4 cells cultured in the
presence or absence of 3x28 beads and/or IL-2 for 24 h. Generally,
the CD154 mRNA level corresponded to the surface CD154 expression.
However, although it is difficult to directly compare, the CD154 mRNA
level did not seem to be reduced to the same extent as the surface
expression in CD4 cells incubated for 24 h without 3x28 beads and
IL-2. An explanation could be that the residual mRNA is either
nonfunctional or requires complementation from other signals/factors to
be translated, or that it is actively translated to CD154 protein that
is sequestered within the cell. A previous study has shown that memory
cells can store CD154 in intracellular vesicles (24). To
investigate this in greater detail, we stained activated naive and
effector CD4 cells for intracellular CD154 when incubated in the
presence or absence of 3x28 beads and/or IL-2 for 24 h. Cells were
reacted with a nonconjugated anti-CD154 Ab before intracellular
staining to block surface CD154 staining. Fig. 3C shows that
IL-2 and, to a lesser degree, 3x28 bead stimulation induced pronounced
intracellular CD154 protein levels in effector CD4 cells. However, very
low levels of preformed CD154 was observed after 24 h without IL-2
and 3x28 bead stimulation, indicating that the residual CD154 mRNA is
not actively transcribed. This again suggests that IL-2-induced
re-expression of CD154 on the cell surface is dependent on
transcription and translation and is not simply a result of
translocation from preformed intracellular stores. CD154 induced by IL-2 is functionally active
To verify the functional capability of IL-2-induced CD154 on CD4
cells, a 24-h coculture experiment with Daudi B lymphoma cells was
done. Daudi cells markedly up-regulate CD54 (ICAM-1) expression in
response to CD40 engagement. Effector CD4 cells were purified by
negative selection, stained with the fluorescent cell dye CFDA-SE, and
fixed in 0.5% paraformaldehyde before coculture. As seen in Fig. 4, activated effector CD4 cells
previously cultured for 24 h in the presence of 100 U/ml IL-2
alone strongly up-regulated CD54 expression on the Daudi cells, which
could be blocked by inclusion of a CD40-Ig fusion protein. Conversely,
activated effector CD4 cells previously cultured without IL-2 or 3x28
beads for 24 h induced very weak CD54 expression on the Daudi
cells. Essentially, the same results were observed with activated naive
CD4 cells, but their weaker CD154 expression corresponded to a weaker
induction of CD54 expression (data not shown). Control experiments
showed that unstimulated naive CD4 cells had no significant effect on
CD54 expression; in contrast anti-CD40 Abs coupled to beads induced
robust CD54 expression on the Daudi cells (data not shown). These
results demonstrate that the CD154 induced by IL-2 is functionally
active.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this study, we demonstrate that efficient Ag activation and CD28 costimulation of CD4 cells has a dual function in connection with CD154 regulation: 1) induction of transient CD154 expression by NF-AT-dependent signals, and 2) production of IL-2 and up-regulation of its high affinity receptor, which maintains CD154 expression by IL-2-dependent signals. IL-15 produced by activated APC might furthermore enhance CD154 expression. This will produce a highly regulated feedback mechanism and underscores the interdependence of CD28 and CD40 signal pathways during T cell-APC interaction.
These findings might be of possible clinical interest, since the serum level of IL-15 is elevated in patients with rheumatoid arthritis, a disease characterized by elevated CD40L expression on CD4 cells (25, 26). Furthermore, a previous study has shown a strong correlation between diminished CD154 and IL-2 mRNA levels in a large fraction of patients with common variable immunodeficiency (27). Given the present study, it is likely that the diminished CD154 is caused by the lack of IL-2, in particular since these patients have a normal CD154 gene.
With regard to regulation of CD154 expression on activated CD4 T cells
in vivo, future studies with knockout mice lacking either CD25, IL-2,
or IL-15R may give insights into the relative contribution and
importance of IL-2 and IL-15, although interpretation of data obtained
in knockout models may be complicated by the multitude of functions
performed by IL-2 and IL-15.
One of the hallmarks of anergic T cells is their inability to produce IL-2 even after appropriate costimulation. Furthermore, anergic T cells have been shown to express significantly reduced levels of CD154 after activation (28), which is not surprising given the data in the current report. We would like to propose that anergic CD4 cells lack the ability to activate APC, at least in part, due to poor CD154 expression. Since CD40-activated APC have the ability to activate otherwise anergic/tolerant T cells, this establishes a sort of "catch 22," which potentially is of fundamental importance for regulation of anergy/tolerance vs immunity.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Søren Skov, Department of Medical Microbiology and Immunology, Cell Cybernetics Laboratory, The Panum Institute, Blegdamsvej 3, Building 22-5, University of Copenhagen, 2200 Copenhagen N, Denmark. E-mail address:
3 Abbreviations used in this paper: CFDA-SE, 5-(and 6)-carboxyfluorescein diacetate succinimidyl ester; CsA, cyclosporin A; CD40L, CD40 ligand; MFI, mean fluorescence intensity.
Received for publication October 18, 1999. Accepted for publication January 14, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  A. R. Rodriguez, B. P. Arulanandam, V. L. Hodara, H. M. McClure, E. K. Cobb, M. T. Salas, R. White, and K. K. Murthy Influence of interleukin-15 on CD8+ natural killer cells in human immunodeficiency virus type 1-infected chimpanzees J. Gen. Virol., February 1, 2007; 88(2): 641 - 651. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bondanza, V. Valtolina, Z. Magnani, M. Ponzoni, K. Fleischhauer, M. Bonyhadi, C. Traversari, F. Sanvito, S. Toma, M. Radrizzani, et al. Suicide gene therapy of graft-versus-host disease induced by central memory human T lymphocytes Blood, March 1, 2006; 107(5): 1828 - 1836. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Bonyhadi, M. Frohlich, A. Rasmussen, C. Ferrand, L. Grosmaire, E. Robinet, J. Leis, R. T. Maziarz, P. Tiberghien, and R. J. Berenson In Vitro Engagement of CD3 and CD28 Corrects T Cell Defects in Chronic Lymphocytic Leukemia J. Immunol., February 15, 2005; 174(4): 2366 - 2375. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Singh, J. Laughlin, P. A. Kosinski, and L. R. Covey Nucleolin Is a Second Component of the CD154 mRNA Stability Complex That Regulates mRNA Turnover in Activated T Cells J. Immunol., July 15, 2004; 173(2): 976 - 985. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Daoussis, A. P. Andonopoulos, and S.-N. C. Liossis Targeting CD40L: a Promising Therapeutic Approach Clin. Vaccine Immunol., July 1, 2004; 11(4): 635 - 641. [Full Text]
|
|
|
|
|
|
L. Haynes, S. M. Eaton, E. M. Burns, M. Rincon, and S. L. Swain Inflammatory Cytokines Overcome Age-Related Defects in CD4 T Cell Responses In Vivo J. Immunol., May 1, 2004; 172(9): 5194 - 5199. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Watanabe, H. Kagamu, H. Yoshizawa, N. Fujita, H. Tanaka, J. Tanaka, and F. Gejyo The Duration of Signaling through CD40 Directs Biological Ability of Dendritic Cells to Induce Antitumor Immunity J. Immunol., December 1, 2003; 171(11): 5828 - 5836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Skov, K. Rieneck, L. F. Bovin, K. Skak, S. Tomra, B. K. Michelsen, and N. Odum Histone deacetylase inhibitors: a new class of immunosuppressors targeting a novel signal pathway essential for CD154 expression Blood, February 15, 2003; 101(4): 1430 - 1438. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Kosinski, J. Laughlin, K. Singh, and L. R. Covey A Complex Containing Polypyrimidine Tract-Binding Protein Is Involved in Regulating the Stability of CD40 Ligand (CD154) mRNA J. Immunol., January 15, 2003; 170(2): 979 - 988. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. O. Lee, L. Haynes, S. M. Eaton, S. L. Swain, and T. D. Randall The Biological Outcome of CD40 Signaling Is Dependent on the Duration of CD40 Ligand Expression: Reciprocal Regulation by Interleukin (IL)-4 and IL-12 J. Exp. Med., September 2, 2002; 196(5): 693 - 704. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. McDyer, Z. Li, S. John, X. Yu, C.-y. Wu, and J. A. Ragheb IL-2 Receptor Blockade Inhibits Late, But Not Early, IFN-{gamma} and CD40 Ligand Expression in Human T Cells: Disruption of Both IL-12-Dependent and -Independent Pathways of IFN-{gamma} Production J. Immunol., September 1, 2002; 169(5): 2736 - 2746. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Schonbeck and P. Libby CD40 Signaling and Plaque Instability Circ. Res., December 7, 2001; 89(12): 1092 - 1103. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-M. Hsieh, S.-C. Pan, C.-C. Hung, H.-C. Tsai, M.-Y. Chen, C.-N. Lee, and S.-C. Chang Kinetics of Antigen-Induced Phenotypic and Functional Maturation of Human Monocyte-Derived Dendritic Cells J. Immunol., December 1, 2001; 167(11): 6286 - 6291. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. MacDonald, A. D. Straw, B. Bauman, and E. J. Pearce CD8- Dendritic Cell Activation Status Plays an Integral Role in Influencing Th2 Response Development J. Immunol., August 15, 2001; 167(4): 1982 - 1988. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Aringer, G. H. Stummvoll, G. Steiner, M. Koller, C. W. Steiner, E. Hofler, H. Hiesberger, J. S. Smolen, and W. B. Graninger Serum interleukin-15 is elevated in systemic lupus erythematosus Rheumatology, August 1, 2001; 40(8): 876 - 881. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Houtkamp, A. C. van der Wal, O. J. de Boer, C. M. van der Loos, P. A. J. de Boer, A. F. M. Moorman, and A. E. Becker Interleukin-15 Expression in Atherosclerotic Plaques : An Alternative Pathway for T-Cell Activation in Atherosclerosis? Arterioscler Thromb Vasc Biol, July 1, 2001; 21(7): 1208 - 1213. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. H. Hogan, W. Markofski, A. Bock, B. Barger, J. D. Morrissey, and M. Sandor Mycobacterium bovis BCG-Induced Granuloma Formation Depends on Gamma Interferon and CD40 Ligand but Does Not Require CD28 Infect. Immun., April 1, 2001; 69(4): 2596 - 2603. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Yi, M. McNerney, and S. K. Datta Regulatory Defects in Cbl and Mitogen-Activated Protein Kinase (Extracellular Signal-Related Kinase) Pathways Cause Persistent Hyperexpression of CD40 Ligand in Human Lupus T Cells J. Immunol., December 1, 2000; 165(11): 6627 - 6634. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Cerutti, A. Schaffer, R. G. Goodwin, S. Shah, H. Zan, S. Ely, and P. Casali Engagement of CD153 (CD30 Ligand) by CD30+ T Cells Inhibits Class Switch DNA Recombination and Antibody Production in Human IgD+ IgM+ B Cells J. Immunol., July 15, 2000; 165(2): 786 - 794. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or
effector PBL (
) were stimulated for 3 days with 3x28 beads and then
cultured for 24 h without 3x28 beads and IL-2 (as described above
for A, 4) and then restimulated with PBS, 100 U/ml IL-2,
50 ng/ml IL-4, 1000 U/ml IFN-
), IL-2
(
) as described in A from
days 0 to 1, 1 to 2, 2 to 3, or 3 to 4 (for 2–4 days of culture, cells
were stimulated with 3x28 beads up to the last 24 h). CD154 level
on CD4 cells, as MFI corrected for isotype control Ab staining. The
experiment was repeated three times with similar results.
E, Same experiment as in D, but with
effector PBL. The experiment was repeated three times with similar
results.
