The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lantelme, E.
Right arrow Articles by Giachino, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lantelme, E.
Right arrow Articles by Giachino, C.
The Journal of Immunology, 2000, 164: 3455-3459.
Copyright © 2000 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: Recombinase-Activating Gene Expression and V(D)J Recombination in CD4+CD3low Mature T Lymphocytes1

Erica Lantelme*, Belinda Palermo*, Luisa Granziero*, Stefania Mantovani*, Rita Campanelli*, Virginia Monafo{dagger}, Antonio Lanzavecchia{ddagger} and Claudia Giachino2,*,§

* S. Maugeri Foundation, Instituto di Ricovero e Cura a Carottere Scientifico (IRCCS) Pavia, Italy; {dagger} Department of Pediatric Sciences, University of Pavia, IRCCS Policlinico San Matteo, Pavia, Italy; {ddagger} Basel Institute for Immunology, Basel, Switzerland; and § Department of Clinical and Biological Sciences, University of Turin, Orbassano, Italy


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The recombinase-activating genes, RAG-1 and RAG-2, can be expressed by a subset of B cells within germinal centers, where they mediate secondary V(D)J rearrangements. This receptor revision mechanism could serve either receptor diversification or tolerance-induced functions. Alternatively, it might rescue those cells the receptors of which have been damaged by somatic mutation. Less is known about the occurrence of similar mechanisms in T cells. Here we show that mature T cells with defective TCR surface expression can express RAG genes and are capable of initiating secondary V(D)J rearrangements. The possibility that a cell rescue mechanism based on the generation of a novel Ag receptor might be active in peripheral T cells is envisaged.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The recombinase-activating genes (RAG)3 RAG-1 and RAG-2 (1) have long been considered to be expressed only in immature lymphocytes in bone marrow and thymus and readily down-regulated in mature IgD+ B cells and TCR+ T cells (2, 3, 4). However, expression of RAG genes in germinal center (GC) B cells was demonstrated to mediate secondary V(D)J rearrangements (5, 6, 7, 8, 9, 10, 11, 12, 13, 14). Two recent papers suggested that lymphocytes with a pre-B cell phenotype accounted for RAG gene expression in the GC (15, 16), thus indicating a persistent, rather than reinduced, RAG gene expression in some GC B cells. The significance of secondary rearrangements is debated: in early stages of the immune response receptor revision may represent a tolerance-induced mechanism to edit self-reactive B cells. In later stages, it can represent an additional means of somatic receptor diversification. In addition, it may rescue those B cells the receptors of which have been damaged by somatic mutations.

We observed RAG expression in surface Ig- (sIg-) human GC B cells (14), and other authors previously demonstrated up-regulated RAG gene expression in sIg- variants of a human mature B cell line undergoing secondary rearrangements in vitro (17). Furthermore, several groups have shown a potential link between the surface expression of Ag receptors and RAG expression, as the latter can be turned off by cross-linking the Ag receptors of mature B or T cells (12, 13, 18, 19). This could suggest that a signal generated by the Ag receptor is required to inhibit or terminate RAG expression actively (4).

Less is known on the occurrence of similar receptor revision events in T cells. Recently, RAG reexpression and DNA recombination in peripheral CD4+ T cells have been described in a murine TCR ß-chain transgenic model (20). Interestingly, RAG reexpression was observed only in those cells that had down-regulated transgenic Vß expression (Vß5- to Vß5int). On the hypothesis that RAG expression might be more likely in cells with defective TCR expression, as we observed in B cells, we asked whether peripheral T cells with decreased TCR surface expression were capable of expressing RAG genes and of undergoing secondary rearrangements.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell staining and cell sorting

PBMC were obtained from two normal donors through Ficoll-Hypaque (Pharmacia Biotech, Upsala, Sweden) density gradient centrifugation. Indirect double staining using anti-human CD3 (OKT3, IgG2a) and anti-human CD4 (6D10, IgG1) mAbs were performed to sort the CD4+CD3low cells. As second Abs, we used PE-labeled goat anti-mouse IgG2a and FITC-labeled goat anti-mouse IgG1 (Southern Biotechnology Associates, Birmingham, AL). PE-anti-CD1a, FITC-anti-CD2, PE-anti-CD8, FITC-anti-CD11b, FITC-anti-CD16, FITC-anti-CD20, FITC-anti-CD56 (all from Becton Dickinson, Mountain View, CA) and anti-TCR PAN {alpha}ß (Immunotech, Marseille, France) were also used. The stained cells were analyzed by flow cytometry on a FACScalibur (Becton Dickinson) with CELLQUEST software. Cell sorting experiments were performed with FACSVantage (Becton Dickinson).

T cell cloning

The sorted cells were cloned at 0.3 cell/well in Terasaki plates in the presence of irradiated PBMC (0.5 x 106/ml) in complete RPMI 1640 supplemented with 5% human serum (EuroClone Ltd., U.K.), 1 µg/ml PHA and 200 U/ml IL-2.

Northern blot analysis

10 µg total RNA was electrophoresed through a 1.2% denaturing agarose gel, alkali blotted onto Hybond-N+ membrane (Amersham, Arlington Heights, IL) following the manufacturer’s instructions and hybridized with Cß and C{alpha} probes obtained by RT-PCR with the following primers: Cß 5', TGAGCCATCAGAAGCAGA; Cß 3', ATCTCATAGAGGATGGTGG; C{alpha} 5', ATATCCAGAACCCTGACCCT; C{alpha} 3', CTTTTCTCGACCAGCTTGAC.

Reverse transcription PCR and oligotyping

Total RNA was extracted with RNAzol B (Tel-test, Friendswood, TX) following the manufacturer’s instructions. First-strand cDNA was synthesized using oligo(dT) and murine Moloney leukemia virus-RT (Promega, Madison, WI) in 20 µl final volume, and 1 µl was used in each PCR reaction. The primers were as follows: ß-actin 5', ACACTGTGCCCATCTACGAGGGG; ß-actin 3', ATGATGGAGTTGAAGGTAGTTTCGTGGAT; RAG-1 forward 5', CCAAATTGCAGACATCTCAAC (corresponding to the 5'-untranslated sequence); RAG-1 reverse 5', CAACATCTGCCTTCACATCGATCC (corresponding to the coding region); RAG-2 forward 5', ATACCTGGTTTAGCGGCAAA (corresponding to the 5'-untranslated sequence); RAG-2 reverse 5', CCAGCCTTTTTGTCCAAAGAA (corresponding to the coding region). The PCR profile was 2 min at 94°C, 30 cycles at 94°C for 15 s, 60°C for 20 s, 72°C for 40 s, followed by a 10-min extension. Nested PCR (20 cycles) was performed using 1 µl of the first PCR and the following primers: RAG-1 internal 5', CAGCCTGCTGAGCAAGGTAC; RAG-2 internal, 5', ATGTCTCTGCAGATGGTAACAGT.

The PCR samples were electrophoresed and blotted. Filters were prehybridized in BLOTTO solution (6x SSC, 1% milk, 5 mM EDTA, 0.1% SDS) at 42°C for 3 h and hybridized overnight at 42°C with the following internal oligonucleotides: RAG-1 5', CAGTTCTGCCCCAGATGAAAT; RAG-2 5', TCAGCCAGGCTTCTCACTGA.

Ligation-mediated PCR (LM-PCR)

The assay was performed as previously described (21). The PCR samples were blotted, and filters were hybridized overnight at 37°C with the specific internal oligonucleotides. The primers were as follows: for the 5' Dß1: 5'-GCAGCTGCTCTGGTGGTC-3' (first PCR); 5'-TCTGGTGGTCTCTCCCAG-3' (nested); 5'-GGCTGTTTTTGTACAAAGC-3' (probe); for the 3' Dß1: 5'-CTGACATGTGATCAGGAGTGA-3' (first PCR); 5'-AAGACCTGTGACCCAGGA-3'(nested);5'-GAAGAGGACTCTGGGAGT-3' (probe); for the 5' Dß2: 5'-CAGTCAGACTAACCTCTGCCA-3' (first PCR); 5'-GCTTCCTGCCGCTGCCCA-3' (nested); CTAGCAGGGAGGAAACATT-3' (probe); for the 3' Dß2: 5'-AAGACCACAGCTGGGACCA-3' (first PCR); 5'-CCCACCTGGTAGCTGCATT-3' (nested); 5'-ATGCTTACTGCATCAGGGTT-3' (probe). Control reactions to determine the relative amounts of DNA were performed with primers to IL-5 gene: forward, 5'-GTGAAAGAGACCTTGGCACTG-3'; reverse, 5'-GGCAAAGTGTCAGTATGCCTG-3'.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
RAG gene expression in CD4+CD3low mature T cells

In the present study, we asked whether RAG expression could be found in mature T cells. No RAG-specific PCR products were observed when either PBMC or T cell lines from normal donors were analyzed (data not shown). On the hypothesis that RAG expression might be more likely in cells with absent or decreased expression of TCR from the cell surface, as we observed in B cells, we decided to isolate the TCR variant cells with a CD4+CD3low phenotype that arise spontaneously in the periphery. These variant cells exist in detectable numbers (average, 2.4 x 10-4) among in vivo mature T cell populations and were reported to increase significantly with age (22, 23).

Two-color fluorescence analysis of PBL from two normal donors stained with anti-CD3 and anti-CD4 Abs was performed with a cell sorter. The sorting window was set in the region for variant CD4+CD3low cells and ~2000 cells were sorted and cloned by limiting dilution. Of the 110 clones that could be established from these healthy donors, 34 were selected because they possessed a CD3 fluorescence intensity below the second log, at variance from normal T cell clones in which CD3 fluorescence is >102 (Fig. 1GoA). All 34 clones turned out to be CD1a-, -2+, -3low, -4+, -8-, -11b-, -16-, -20-, -56-, and TCR{alpha}ßlow (data not shown). Northern blot analysis indicated that most variant clones expressed full length TCR{alpha} and TCRß mRNA (Fig. 1GoB and data not shown). In two clones, defective TCR{alpha} mRNA expression was found as compared with TCRß mRNA, which might explain the diminished surface TCR/CD3 complex expression (BC 10 and BC 17, Fig. 1GoB). In the other clones, either small deletions or point mutations in the TCR mRNA or, alternatively, defects in CD3 chains expression could be the cause of the defective TCR/CD3 surface expression.



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 1. Isolation of variant CD4+CD3low T cell clones. A, two-color fluorescence analysis of PBMC from two normal donors using anti-CD3 and anti-CD4 Abs was performed; a sorting window was set in the region for variant CD4+CD3low cells. One normal CD4+CD3+ T cell clone and five variant clones established from the sorted cells by limiting dilution are shown. B, Northern blot analysis of seven variant clones using TCR{alpha} and TCRß probes. An actin probe was used as a control for the integrity and relative quantity of RNA loaded in the different lanes. Migration of the 18S (1.9-kb) rRNA is shown.

 
Using primers that span the single intron in the RAG genes, we asked whether these clones exhibited RAG gene expression. Although none of 15 normal, CD4+CD3+ clones obtained from the same individuals showed any detectable RAG products, 11 variant clones (11 of 34, 32%) exhibited RAG-1 (clones BC 27, BC 79, LD202, and LD319), RAG-2 (clones BC 34, BC 88, BC 91, LD259, LD448,) or both RAG-1 and RAG-2 expression (clones BC 36 and BC 68) (Fig. 2Go and data not shown). The level of expression was low (103–104-fold less than CD4-CD8- thymocytes) but reproducible in independent experiments. On repeated in vitro stimulation with irradiated PBMC and PHA, 3 of the 11 RAG-expressing clones (BC 68, BC 79, and BC 88) became CD3+ and lost RAG gene expression (data not shown).



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 2. RAG gene expression in CD4+CD3low T cell clones. RAG-1 and RAG-2 expression in CD4+CD3low clones was assessed by nested RT-PCR (30 + 20 cycles) and oligotyping with internal primers. As a positive control, CD4-CD8- double-negative thymocytes were used. Lane 1, results of RT-PCR-oligotyping on 103 double-negative thymocytes, followed by 10-fold dilutions in lanes 2–4. In the other lanes, 105 variant T cell clones were used. The strong RAG1 expression of clone BC 36 could be appreciated with ethidium bromide staining. The ethidium bromide-stained gels in the lower part of the figure show the actin RT-PCR products (25 cycles) obtained from the nineteen variant clones and from the positive control.

 
Ongoing rearrangements of TCR genes in CD4+CD3low T cells

To assess whether the RAG proteins expressed by the variant clones were capable of activating V(D)J recombination, we used the sensitive and highly specific LM-PCR assay (21). We searched for rearrangement intermediates, i.e., double-stranded signal end breaks (SE breaks), in the TCRß locus using primers specific for the 5' and 3' sides of both Dß1 and Dß2. The presence of signal end intermediates is a stringent test of RAG activity, because recombination requires not only functional RAG-1 and RAG-2 proteins but also DNA accessibility. As expected, SE breaks associated with all four sites were detected in human thymic DNA (Fig. 3Go, lanes 1, 9, 10, and 18) but neither in a human B cell clone DNA (lanes 8 and 17) nor in four RAG- T cell clones (lanes 2, 6, 7, 11, 15, 16, and not shown). In contrast, SE breaks associated with the 3' side of Dß2 were clearly detected in the RAG-1+/RAG-2+ clone BC 36 (Fig. 3Go, lane 13); after longer exposure, SE breaks associated with the 5' side of Dß2 were also detected in the same clone and SE breaks associated with the 3' side of Dß1 were detected in the RAG-1+/RAG-2+ clone BC 68 (lane 5). No SE breaks could be detected in three clones which expressed only RAG-2 (Fig. 3Go, lanes 3, 12, and data not shown), nor in one RAG1+/RAG2- clone (not shown). Taken together, these data indicate the presence of ongoing rearrangements at the TCRß locus in both clones exhibiting simultaneous expression of RAG genes. In the case of clone BC 36 LM-PCR indicated the occurrence of a complete secondary V(D)J rearrangement, whereas in the case of clone BC 68 a partial D-J rearrangement was evidenced.



View larger version (54K):
[in this window]
[in a new window]
  		FIGURE 3. Ongoing rearrangements of TCR genes in CD4+CD3low T cells. LM-PCR assay was used to assess the presence of functional RAG proteins capable of initiating V(D)J recombination in the variant clones. Genomic DNA from human fetal thymus (positive control, lanes +), from a B cell clone (E37) and from six CD4+CD3low variant clones (BC 10, RAG-1-/RAG-2-; BC 34, RAG-1-/RAG-2+; BC 36, RAG-1+/RAG-2+; BC 68, RAG-1+/RAG-2+; BC 72, RAG-1-/RAG-2-; BC 74, RAG-1-/RAG-2-) was ligated to the BW linker as described (21 ) and used as a template in PCR reactions with primers to detect signal ends associated with Dß1 (5'Dß1 and 3'Dß1) and Dß2 (5'Dß2 and 3'Dß2). To avoid signal interference with the negative control (lane 8), a 10-fold dilution of the positive control was loaded in lane 9 of the 3'Dß1 panel. Exposure lengths were 2.5 h for 3'Dß2 and 3 days for all the other sites. Control PCR reactions with IL-5 gene are shown as an ethidium bromide-stained gel (30 cycles).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Overall, our data indicate that mature, CD4+CD3low T lymphocytes can express RAG genes and are capable of initiating secondary V(D)J rearrangements.

Ligand-mediated positive selection is required for entrance and persistence of T cells in the peripheral pool (24, 25). Thus, a lymphocyte that loses its Ag receptor becomes useless, and like anergic cells that have down-regulated their Ag receptors due to chronic exposure to a self Ag, must be eliminated. Similarly, it has been demonstrated that receptorless B cells obtained by artificial B cell receptor ablation, like anergic B cells, up-regulate Fas and die (26). The RAG expression found in the CD3low lymphocytes could suggest the interesting possibility that a mechanism of cellular rescue based on the generation of a novel Ag receptor through secondary rearrangements is active in these situations. Such a phenomenon would be analogous to the receptor-editing mechanism identified in bone marrow autoreactive cells (27, 28, 29) and in GC B cells (5, 6, 7, 8, 9, 10, 11, 12, 13).

On a first analysis, two observations seemed to argue against a functional role of RAG genes in the CD4+CD3low variant cells: their low level of expression and the very rare coexpression of RAG-1 and RAG-2 observed in the variant clones. Thus, it was essential to demonstrate the functionality of RAG proteins in mediating V(D)J recombination. On the one hand, the presence of signal end intermediates, a stringent test of RAG activity, clearly indicated the occurrence of ongoing rearrangements in both two RAG-1+/RAG-2+ clones studied. On the other hand, it is difficult to explain why the majority of the clones seemed to express only one of the two RAG genes. The regulation of RAG-1 and RAG-2 expression is known to be very complex and involves both transcriptional and posttranscriptional controls (30, 31). It is possible that expression of these genes in mature lymphocytes may be even more tightly regulated by the cell to avoid deleterious recombination errors, thus diminishing the probability of detecting both genes simultaneously.

In 3 of the 11 RAG-expressing clones, including one with SE breaks, we observed reappearance of a CD3+ phenotype after repeated stimulation in vitro. Although the possibility that a successful secondary rearrangement occurred in these clones is appealing, we cannot yet formally prove that this was the case.

Recently, RAG reexpression and DNA recombination in peripheral CD4+ T cells have been described in a murine TCR ß-chain transgenic model (20). In this model, tolerogen-mediated chronic peripheral selection against cells expressing the transgene led to RAG gene reexpression and resulted in surface expression of endogenous TCR ß-chains. Consistent with our data, RAG reexpression was observed only in those cells with down-regulated transgenic Vß expression (Vß5- to Vß5int).

The possibility of secondary Ag receptor rearrangements can now be extended to human peripheral T cells. If the expression of RAG genes is a common feature of a subset of both B and T lymphocytes, it must confer significant benefit to immune function. However, it might also carry appreciable risks, including that of malignant transformation due to illegitimate recombination.


   Acknowledgments
 
We acknowledge the contribution of Mark Dessing (BII Basel) for help in cell sorting experiments; and Dr. Paolo Ghia (Institute for Cancer Research and Treatment, Candiolo) and Prof. Mario De Marchi (Department of Clinical and Biological Sciences, University of Turin) for careful critical reading.


   Footnotes
 
1 The Basel Institute for Immunology was founded and is supported by F. Hoffman-La Roche & Co. Ltd., Basel, Switzerland. Back

2 Address correspondence and reprint requests to Dr Claudia Giachino, Salvatore Maugeri Foundation, IRCCS Laboratory of Experimental Medicine-Immunology, Via Ferrata 8, 27100 Pavia, Italy. E-mail address: Back

3 Abbreviations used in this paper: RAG, recombinase-activating gene; GC, germinal center; sIg, surface Ig; LM-PCR, ligation-mediated PCR; SE break, signal end break. Back

Received for publication November 23, 1999. Accepted for publication January 11, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Schatz, D. G., M. A. Oettinger, M. S. Schlissel. 1992. V(D)J recombination: molecular biology and regulation. Annu. Rev. Immunol. 10:359.[Medline]
  2. Wilson, A., W. Held, H. R. MacDonald. 1994. Two waves of recombinase gene expression in developing thymocytes. J. Exp. Med. 179:1355.[Abstract/Free Full Text]
  3. Grawunder, U., T. M. Leu, D. G. Schatz, A. Werner, A. G. Rolink, F. Melchers, T. H. Winkler. 1995. Down-regulation of RAG1 and RAG2 gene expression in preB cells after functional immunoglobulin heavy chain rearrangement. Immunity 3:601.[Medline]
  4. Ghia, P., A. Gratwohl, E. Signer, T. H. Winkler, F. Melchers, A. G. Rolink. 1995. Immature B cells from human and mouse bone marrow can change their surface light chain expression. Eur. J. Immunol. 25:3108.[Medline]
  5. Hikida, M., M. Mori, T. Takai, K-I. Tomochika, K. Hamatani, H. Ohmori. 1996. Reexpression of RAG-1 and RAG-2 genes in activated mature mouse B cells. Science 274:2092.[Abstract/Free Full Text]
  6. Han, S., B. Zheng, D. G. Schatz, E. Spanopoulou, G. Kelsoe. 1996. Neoteny in lymphocytes: Rag1 and Rag2 expression in germinal center B cells. Science 274:2094.[Abstract/Free Full Text]
  7. Papavasiliou, F., R. Casellas, H. Suh, X. F. Qin, E. Besmer, R. Pelanda, D. Nemazee, K. Rajewsky, M. C. Nussenzweig. 1997. V(D)J recombination in mature B cells: a mechanism for altering antibody responses. Science 278:298.[Abstract/Free Full Text]
  8. Han, S., S. R. Dillon, B. Zheng, M. Shimoda, M. S. Schlissel, G. Kelsoe. 1997. V(D)J recombinase activity in a subset of germinal center B lymphocytes. Science 278:301.[Abstract/Free Full Text]
  9. Hikida, M., M. Mori, T. Kawabata, T. Takai, H. Ohmori. 1997. Characterization of B cells expressing recombination activating genes in germinal centers of immunized mouse lymph nodes. J. Immunol. 158:2509.[Abstract]
  10. Hikida, M., H. Ohmori. 1998. Rearrangement of {lambda} light chain genes in mature B cells in vitro and in vivo: function of reexpressed recombination-activating gene (RAG) products. J. Exp. Med. 187:795.[Abstract/Free Full Text]
  11. Hikida, M., Y. Nakayama, Y. Yamashita, Y. Kumazawa, S.-I. Nishikawa, H. Ohmori. 1998. Expression of recombination activating genes in germinal center B cells: involvement of interleukin 7 (IL-7) and the IL-7 receptor. J. Exp. Med. 188:365.[Abstract/Free Full Text]
  12. Meffre, E., F. Papavasiliou, P. Cohen, O. de Bouteiller, D. Bell, H. Karasuyama, C. Schiff, J. Banchereau, Y. J. Liu, M. C. Nussenzweig. 1998. Antigen receptor engagement turns off the V(D)J recombination machinery in human tonsil B cells. J. Exp. Med. 188:765.[Abstract/Free Full Text]
  13. Hertz, M., V. Kouskoff, T. Nakamura, D. Nemazee. 1998. V(D)J recombinase induction in splenic B lymphocytes is inhibited by antigen-receptor signaling. Nature 394:292.[Medline]
  14. Giachino, C., E. Padovan, A. Lanzavecchia. 1998. Re-expression of RAG-1 and RAG-2 genes and evidence for secondary rearrangements in human germinal center B lymphocytes. Eur. J. Immunol. 28:3506.[Medline]
  15. Yu, W., H. Nagaoka, M. Jankovic, Z. Misulovin, H. Suh, A. Rolink, F. Melchers, E. Meffre, M. C. Nussenzweig. 1999. Continued RAG expression in late stages of B cell development and no apparent re-induction after immunization. Nature 400:682.[Medline]
  16. Monroe, R. J., K. J. Seidl, F. Gaertner, S. Han, F. Chen, J. Sekiguchi, J. Wang, R. Ferrini, L. Davidson, G. Kelsoe, F. W. Alt. 1999. RAG2:GFP knockin mice reveal novel aspects of RAG2 expression in primary and peripheral lymphoid tissues. Immunity 11:201.[Medline]
  17. Stiernholm, N. B. J., N. L. Berinstein. 1993. Up-regulated recombination-activating gene expression in sIg- variants of a human mature B cell line undergoing secondary Ig{lambda} rearrangements in cell culture. Eur. J. Immunol. 23:1501.[Medline]
  18. Turka, L. A., D. G. Shatz, M. A. Oettinger, J. J. M. Chun, C. Gorka, K. Lee, W. T. McCormack, C. B. Thompson. 1991. Thymocyte expression of RAG-1 and RAG-2: termination by T cell receptor cross-linking. Science 253:778.[Abstract/Free Full Text]
  19. Ma, A., P. Fisher, R. Dildrop, E. Oltz, G. Rathburn, P. Achacosco, A. Stall, F. W. Alt. 1992. Surface IgM mediated regulation of RAG gene expression in E mu-N-myc B cell lines. EMBO J. 11:2727.[Medline]
  20. McMahan, C. J., P. J. Fink. 1998. RAG reexpression and DNA recombination at T cell receptor loci in peripheral CD4+ T cells. Immunity 9:637.[Medline]
  21. Schlissel, M., A. Constantinescu, T. Morrow, M. Baxter, A. Peng. 1993. Double-strand signal sequence breaks in V(D)J recombination are blunt, 5'-phosphorylated, RAG-dependent, and cell cycle regulated. Genes Dev. 7:2520.[Abstract/Free Full Text]
  22. Kyoizumi, S., M. Akiyama, Y. Hirai, Y. Kusunoki, K. Tanabe, S. Umeki. 1990. Spontaneous loss and alteration of antigen receptor expression in mature CD4+ T cells. J. Exp. Med. 171:1981.[Abstract/Free Full Text]
  23. Akiyama, M., S. Kyoizumi, Y. Hirai, Y. Kusunoki, K. S. Iwamoto, N. Nakamura. 1995. Mutation frequency in human blood cells increases with age. Mutat. Res. 338:141.[Medline]
  24. Kisielow, P., H. von Boehmer. 1995. Development and selection of T cells: facts and puzzles. Adv. Immunol. 58:187.
  25. Takeda, S., H. R. Rodewald, H. Arakawa, H. Bluethmann, T. Shimizu. 1996. MHC class II molecules are not required for survival of newly generated CD4+ T cells, but affect their long-term life span. Immunity 5:217.[Medline]
  26. Lam, K-P., R. Kuhn, K. Rajewsky. 1997. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell 90:1073.[Medline]
  27. Tiegs, S. L., D. M. Russell, D. Nemazee. 1993. Receptor editing in self-reactive bone marrow B cells. J. Exp. Med. 177:1009.[Abstract/Free Full Text]
  28. Radic, M. Z., J. Erikson, S. L. Litwin, M. Weigert. 1993. B lymphocytes may escape tolerance by revising their antigen receptors. J. Exp. Med. 177:1165.[Abstract/Free Full Text]
  29. Radic, M. Z., M. Zouali. 1996. Receptor editing, immune diversification, and self-tolerance. Immunity 5:505.[Medline]
  30. Neale, G. A., T. J. Fitzgerald, R. M. Goorha. 1992. Expression of the V(D)J recombinase gene RAG-1 is tightly regulated and involves both transcriptional and post-transcriptional controls. Mol. Immunol. 29:1457.[Medline]
  31. Lin, W. C., S. Desiderio. 1994. Cell cycle regulation of V(D)J recombination-activating protein RAG-2. Proc. Natl. Acad. Sci. USA 91:2733.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
D. Zehn, M. J. Bevan, and P. J. Fink
Cutting Edge: TCR Revision Affects Predominantly Foxp3 Cells and Skews Them toward the Th17 Lineage
J. Immunol., November 1, 2007; 179(9): 5653 - 5657.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. S. Bynoe, C. Viret, R. A. Flavell, and C. A. Janeway Jr.
T cells from epicutaneously immunized mice are prone to T cell receptor revision
PNAS, February 22, 2005; 102(8): 2898 - 2903.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. J. Cooper, G. L. Turk, M. Sun, A. G. Farr, and P. J. Fink
Cutting Edge: TCR Revision Occurs in Germinal Centers
J. Immunol., December 1, 2004; 173(11): 6532 - 6536.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Bas, S. G. Hammarstrom, and M.-L. K. C. Hammarstrom
Extrathymic TCR Gene Rearrangement in Human Small Intestine: Identification of New Splice Forms of Recombination Activating Gene-1 mRNA with Selective Tissue Expression
J. Immunol., October 1, 2003; 171(7): 3359 - 3371.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. J. Cooper, M. T. Orr, C. J. McMahan, and P. J. Fink
T Cell Receptor Revision Does Not Solely Target Recent Thymic Emigrants
J. Immunol., July 1, 2003; 171(1): 226 - 233.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
E. Kondo, H. Wakao, H. Koseki, T. Takemori, S. Kojo, M. Harada, M. Takahashi, S. Sakata, C. Shimizu, T. Ito, et al.
Expression of recombination-activating gene in mature peripheral T cells in Peyer's patch
Int. Immunol., March 1, 2003; 15(3): 393 - 402.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
P. Serra, A. Amrani, B. Han, J. Yamanouchi, S. J. Thiessen, and P. Santamaria
RAG-dependent peripheral T cell receptor diversification in CD8+ T lymphocytes
PNAS, November 26, 2002; 99(24): 15566 - 15571.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
F. Lambolez, O. Azogui, A.-M. Joret, C. Garcia, H. von Boehmer, J. Di Santo, S. Ezine, and B. Rocha
Characterization of T Cell Differentiation in the Murine Gut
J. Exp. Med., February 11, 2002; 195(4): 437 - 449.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
N. Meru, A. Jung, I. Baumann, and G. Niedobitek
Expression of the recombination-activating genes in extrafollicular lymphocytes but no apparent reinduction in germinal center reactions in human tonsils
Blood, January 15, 2002; 99(2): 531 - 537.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. J. McMahan and P. J. Fink
Receptor Revision in Peripheral T Cells Creates a Diverse V{beta} Repertoire
J. Immunol., December 15, 2000; 165(12): 6902 - 6907.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. D. Klonowski and M. Monestier
Heavy Chain Revision in MRL Mice: A Potential Mechanism for the Development of Autoreactive B Cell Precursors
J. Immunol., October 15, 2000; 165(8): 4487 - 4493.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lantelme, E.
Right arrow Articles by Giachino, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lantelme, E.
Right arrow Articles by Giachino, C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS