The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tellier, M. C.
Right arrow Articles by Schnapp, L. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tellier, M. C.
Right arrow Articles by Schnapp, L. M.
The Journal of Immunology, 2000, 164: 3236-3245.
Copyright © 2000 by The American Association of Immunologists

Superfibronectin, a Multimeric Form of Fibronectin, Increases HIV Infection of Primary CD4+ T Lymphocytes1

Marinka C. Tellier2,*, Giampaolo Greco2,*, Mary Klotman{dagger}, Arevik Mosoian{dagger}, Andrea Cara{dagger}, Wadih Arap3,{ddagger}, Erkki Ruoslahti{ddagger}, Renata Pasqualini3,{ddagger} and Lynn M. Schnapp4,*

Divisions of * Pulmonary and Critical Care Medicine and {dagger} Infectious Disease, Mount Sinai School of Medicine, New York, NY 10029; and {ddagger} Cancer Research Center, The Burnham Institute, La Jolla, CA 92037.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The ability of viruses and bacteria to interact with the extracellular matrix plays an important role in their infectivity and pathogenicity. Fibronectin is a major component of the extracellular matrix in lymph node tissue, the main site of HIV deposition and replication during the chronic phase of infection. Therefore, we asked whether matrix fibronectin (FN) could affect the ability of HIV to infect lymphocytes. To study the role of matrix FN on HIV infection, we used superfibronectin (sFN), a multimeric form of FN that closely resembles in vivo matrix FN. In this study we show that HIV-1IIIB efficiently binds to multimeric fibronectin (sFN) and that HIV infection of primary CD4+ lymphocytes is enhanced by >1 order of magnitude in the presence of sFN. This increase appears to be due to increased adhesion of viral particles to the cell surface in the presence of sFN, followed by internalization of virus. Enzymatic removal of cell surface proteoglycans inhibited the adhesion of HIV-1IIIB/sFN complexes to lymphocytes. In contrast, Abs to integrins had no effect on binding of HIV-1IIIB/sFN complexes to lymphocytes. The III1-C peptide alone also bound HIV-1IIIB efficiently and enhanced HIV infection, although not as effectively as sFN. HIV-1IIIB gp120 envelope protein binds to the III1-C region of sFN and may be important in the interaction of virus with matrix FN. We conclude that HIV-1IIIB specifically interacts with the III1-C region within matrix FN, and that this interaction may play a role in facilitating HIV infection in vivo, particularly in lymph node tissue.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
During the initial phase of HIV infection, viral particles in lymph nodes are predominantly found intracellularly (1). Following this phase, HIV becomes sequestered extracellularly and is found in association with the follicular dendritic cell (FDC)5 network (1, 2, 3). This pool of virus makes up the major reservoir of HIV (4, 5). Presentation of viral particles by the FDC network is thought to facilitate de novo infection of T lymphocytes (6, 7, 8, 9, 10). The extracellular environment of lymph node tissues also contains multimeric FN, a major component of the extracellular matrix. Following HIV infection, extensive lymph node remodeling occurs, and FN deposition is increased in lymph node tissues of HIV-infected patients (11, 12). We hypothesized that matrix FN may play a role in the extracellular trapping of HIV particles and facilitate de novo infection of T lymphocytes circulating through the lymphoid tissues.

In vivo, FN is secreted into the plasma as soluble dimeric fibrils. Fibronectin fibrils can then be incorporated into the extracellular matrix as insoluble multimers. The assembly of FN into a matrix is a complex process that requires interaction of FN fibrils with cell surface receptors (13, 14, 15, 16, 17). Fibronectin is a modular protein, and the first type III repeat (III1-C) plays an important role in matrix assembly in vivo (18, 19). The addition of a recombinant III1-C fragment to soluble FN results in spontaneous cross-linking of FN dimers in vitro (18, 19) to form superfibronectin (sFN), a multimeric form of FN. The matrix (multimeric) form of FN is structurally and functionally different from plasma (dimeric) FN. sFN closely resembles matrix FN and is functionally different from dimeric plasma FN in that it has enhanced cell-adhesive properties, inhibits cell migration, and displays antimetastatic properties (19, 20, 21). For these reasons, we used sFN, the in vitro generated multimeric form of FN, to study the role of matrix FN in HIV infection of T lymphocytes.

We show that multimeric sFN, but not soluble FN, increased HIV infection of primary CD4+ T lymphocytes by 10- to 15-fold. The observed increase in the presence of multimeric FN required binding of HIV particles to sFN. Viral particles were shown to bind efficiently to sFN, and the HIV-1IIIB/sFN complex had increased adhesion and internalization in T lymphocytes. Interestingly, the III1-C fragment alone also bound HIV particles effectively and enhanced HIV infection by severalfold. Additionally, we show that the III1-C epitope of FN is exposed in lymph node tissue and thus is available to interact with extracellular viral particles in vivo. Together, our data support a role for matrix FN in enhancing HIV infectivity in vivo by facilitating and stabilizing the interaction of HIV with its target cell.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells and virus

PBMC were isolated from whole blood by Ficoll-Hypaque density gradient centrifugation and were depleted of monocytes by several rounds of adherence to tissue culture plastic. CD4+ T lymphocytes were isolated from this population using magnetically labeled anti-CD4 Abs (Miltenyi Biotec, Auburn, CA) and were maintained in RPMI 1640 medium supplemented with 5% FCS, penicillin-streptomycin, and 50 U/ml IL-2 (Proleukin, Chiron, Emeryville, CA). Cells were verified as >95% CD4+ and CD3+ T lymphocytes by flow cytometric analysis. In some experiments CD4+ T lymphocytes were activated for 2 days with PHA (5 µg/ml). Unless otherwise noted, all experiments were performed using unstimulated primary CD4+ T lymphocytes.

HIV-1IIIB was purchased from Advanced Biotechniques (Rockville, MD). A 1-µl aliquot of this stock corresponded to ~6 ng of p24 Ag with a multiplicity of infection of 0.01 when titrated on 1 x 106 human PBMC.

Abs and reagents

sFN was generated as described by incubating human FN with recombinant III1-C fragment at a ratio of 1 µM/1 µg/ml FN (18, 19). Purified human FN and recombinant III1-C fragment and III11-C (control fragment) were obtained as previously described (19, 21). Vitronectin (VN) was prepared from human plasma according to the methods of Yatohgo et al. (22).

Abs P5D2 (anti-ß1) (23) and P1F6 (anti-{alpha}vß5) (24) were gifts from Dr. Elizabeth Wayner (University of Minnesota, Minneapolis, MN). L230 (anti-{alpha}v) (24) was prepared from hybridoma cells obtained from the American Type Culture Collection (Manassas, VA). CD18 (anti-ß2) was purchased from Caltag (Burlingame, CA). P1B5 (anti-{alpha}3) (25, 26) was obtained from Telios (San Diego, CA), and P3D10 (anti-{alpha}5) was a gift from Dr. William Carter (Fred Hutchinson Cancer Center, Seattle, WA). All of the above Abs are function-blocking Abs. Abs were used at concentrations that block cell adhesion to matrix proteins. The 12G5 Ab (anti-CXCR4) was a gift from Dr. James Hoxie (University of Pennsylvania, Philadelphia, PA) (27). FITC-conjugated Ab to MHC class II Ag was obtained from Becton Dickinson (Mountain View, CA), FITC-conjugated Ab to CD25 was obtained from PharMingen (San Diego, CA). Ab to CD38 (OKT10) was a gift from Dr. Karen Zier (Mount Sinai School of Medicine, New York, NY).

The anti-III1-C polyclonal Ab was made by immunizing mice with a histidine-tail III1-C fusion protein bound to Ni beads (Qiagen, Valencia, CA) (28) to facilitate slow release and Ag presentation by macrophages. Six injections were given biweekly, i.p. and s.c. The first injection and the boosters used 500 µg of protein. The immune response was evaluated by ELISA and Western blot using FN, the III1-C fragment, and other FN fragments (including III11-C) as controls. Anti-III1-C polyclonal serum was affinity purified on a protein G column.

Full-length HIV-1IIIB gp120 and anti- HIV-1IIIB gp120 Ab were obtained from the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Arthritis and Infectious Diseases, National Institutes of Health. HIV-1IIIB gp120 peptide 295–328(295–328) and HIV-1IIIB gp120 peptide (418–441) were obtained from the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Arthritis and Infectious Diseases, National Institutes of Health, and contributed by Dr. Seth Pincus. Heparan sulfate (bovine intestinal mucosa; m.w., 7500), GRGDSP peptide, heparatinase, and chondroitinase ABC were purchased from Sigma (St. Louis, MO). Endo-ß-galactosidase was purchased from Seikagaku (Tokyo, Japan).

HIV infection in the presence of immobilized matrix proteins

To determine HIV infectivity in the presence of immobilized matrix proteins, 24-well tissue culture plates were coated overnight at 4°C with 1% BSA, VN (10 µg/ml), FN (10 µg/ml), sFN (10 µg/ml FN plus 10 µM III1-C), or III1-C (10 µM) and blocked with 1% BSA for 30 min at 37°C. Coating efficiencies for FN, III1-C, and sFN were equal, as determined by ELISA (R. Pasqualini, unpublished observations). HIV-1IIIB was added to each well in 1-ml aliquots containing ~6 ng of p24 Ag and were allowed to attach for 15 min at 37°C. Following incubation, wells were washed three times with PBS to remove unbound virus. PHA-stimulated, primary CD4+ T lymphocytes were added at 1 x 106 cells/well. Cell-free supernatants were collected at 1, 3, 10, and 17 days postinfection, and the amount of virus was quantitated by p24 ELISA. Data are reported as the mean p24 Ag levels of triplicate wells ± SD (nanograms per milliliter).

In some experiments PHA-stimulated CD4+ T lymphocytes were infected at a multiplicity of infection of 0.01. Three days after infection, cells were plated onto 24-well plates coated with III1-C, sFN, FN, VN, or BSA. Six days after plating, virus production was quantitated in supernatants by p24 ELISA.

HIV infection in the presence of soluble proteins

Virus was incubated with FN (50 µg), III1-C fragment (25 µM), or sFN (50 µg FN plus 25 µM III1-C) for 15 min at room temperature, then mixed with PHA-stimulated CD4+ T lymphocytes and incubated at 37°C. After 2 h, cells were washed and incubated in 24-well tissue culture plates. Cell-free supernatants were collected at 1, 4, and 7 days postinfection, and the amount of virus was quantitated by p24 ELISA. Data are reported as the mean p24 Ag levels of triplicate wells ± SD (nanograms per milliliter).

Detection of HIV viral DNA by PCR

Cells treated as described for HIV infection studies were tested for HIV DNA at 1 and 4 days postinfection. Total cellular DNA was obtained using a Qiagen DNA isolation kit. DNA concentrations were determined by spectrophotometric analysis of samples at 260 nm and ethidium bromide staining after gel electrophoresis. Approximately 500 ng of DNA was amplified from each sample. The presence of HIV-1IIIB viral DNA was determined using the following primers: sense, 5'-GTGACTCTGGTAACTAGAGA-3' (nt 477–497); and antisense, 5'-CCACAGATCAAGGATATCTTGTC-3' (nt 539–516), which amplify a 120-bp product in the long terminal repeat (LTR) coding region of circularized, extrachromosomal HIV DNA. PCR reactions were conducted in 50-µl reaction mixtures containing PCR buffer (Perkin-Elmer, Palo Alto, CA), 2 mM MgCl2, 0.2 mM dNTPs, 50 pmol of each primer, and 1.25 U of Taq DNA polymerase (Taq Gold, Perkin-Elmer). The reaction mixture was incubated for 10 min at 95°C and subjected to 40 cycles, consisting of 1 min at 94°C, 1 min at 62°C, and 1 min at 72°C, followed by a single cycle of 10 min at 72°C. The PCR-amplified products were analyzed by 2% agarose Tris-acetate gel electrophoresis. Known concentrations of plasmid DNA containing the PCR-generated fragment (103, 102, 101, and 100 copies/reaction) were amplified simultaneously to generate a standard curve. Agarose gel was transferred to Nytran (Schleicher & Schuell, Keene, NH) and then hybridized with a radiolabeled PCR fragment (amplified from control plasmid and labeled with Ready-To-Go dCTP (Pharmacia, Piscataway, NJ)) overnight at 65°C. After the membrane was washed, autoradiography was performed. Densitometry was performed using ImageQuant version 1.11 (Becton Dickinson, Mountain View, CA), and a standard curve was generated by simple linear regression using StatView 4.01 (Abacus Concepts, Berkeley, CA) (r = 0.994). In addition, nested amplification was performed on DNA samples using original primers, sense 5' primer (CCACAGATCAAGGATATCT TGTC), and antisense 5' primer (GTGACTCTGGTAACTAGAGA). To verify equal loading of DNA, ß-globin sequences were simultaneously amplified from the DNA samples (sense 5' primer, ACACAACTGTGT TCACTAGC; antisense 5' primer, CAACTTCATCCACGTTCACC).

Binding of HIV-1IIIB to immobilized matrix proteins

Binding of HIV-1IIIB to immobilized proteins was assessed as follows. Ninety-six-well plates were coated overnight at 4°C with 1% BSA or with increasing concentrations (0.01–180 µg/ml) of FN, sFN, or III1-C fragment. Before adding virus, all wells were blocked with 1% BSA in PBS. HIV-1IIIB was added in 100-µl aliquots containing ~1.2 ng of p24 HIV Ag and was allowed to attach for 20 min at 37°C. Wells were then washed three times with PBS to remove unbound virus. Attached virus was lysed in PBS containing 1% Triton X-100 and was quantitated by p24 ELISA. Data are reported as the mean amount of p24 (nanograms per milliliter) ± SD measured in triplicate samples minus the mean p24 level measured in wells coated with BSA.

To confirm that the III1-C region was involved in binding of sFN to HIV, adhesion assays were performed as described above, except that wells were incubated with increasing concentrations of III1-C polyclonal Ab or nonimmune serum for 1 h at 37°C before addition of virus.

Attachment of HIV-1IIIB to cell surface

To determine attachment of HIV-1IIIB to cells, HIV-1IIIB was incubated with FN (10 µg), sFN (10 µg FN plus 10 µM III1-C), or III1-C fragment (10 µM) for 15 min at room temperature. The HIV-1IIIB/protein mix was then added to primary CD4+ T lymphocytes and incubated for 30 min at 0°C. This temperature allows attachment of virus to the cell surface, but not internalization (29). Following incubation, cells were washed three times with PBS and lysed in 1% Triton X-100. Virus levels were quantified by p24 ELISA. Results are shown as the fold increase in p24 levels ± SD compared with p24 levels detected on cells exposed to HIV alone.

Internalization of HIV-1IIIB in the presence of matrix proteins

Virus was incubated with FN (10 µg), III1-C fragment (10 µM), or sFN (10 µg FN plus 10 µM III1-C) for 15 min at room temperature, then mixed with CD4+ T lymphocytes and incubated at 37°C for 1–2 h. In some experiments, CD4+ T lymphocytes were incubated with FN, III1-C fragment, or sFN for 15 min at room temperature, then mixed with virus and incubated for 1–2 h at 37°C. Following incubation, cells were washed in PBS and treated with trypsin (25 µg/ml) for 20 min at room temperature to remove attached, noninternalized viral particles (29). Cells were lysed in 1% Triton X-100, and the amount of internalized virus was quantitated by p24 ELISA. Results are presented as the fold increase in p24 levels ± SD compared with p24 levels detected in cells exposed to HIV alone.

HIV-LTR activity

The cell line 1G5, a Jurkat derivative, contains a stably integrated HIV-LTR-luciferase construct and was obtained from the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Arthritis and Infectious Diseases, National Institutes of Health, and contributed by Drs. Estuardo Aguilar-Cordova and John Belmont. Cells were incubated for 4 h in wells coated with FN, sFN, and III1-C. The preparation and assay of cell extract was performed using the luciferase assay system with reporter lysis buffer (Promega, Madison, WI). Luciferase activity was measured by luminometer (Bio-Orbit, Turko, Finland).

Heparan sulfate competition assay

HIV-1IIIB (~6 ng) was mixed with increasing concentrations of heparan sulfate (0.001, 0.01, 0.1, and 1 µg/ml) before incubation with sFN (10 µg FN plus 10 µM III1-C). The HIV-1IIIB/sFN mix was added to 5 x 105 CD4+ T lymphocytes and allowed to attach for 30 min at 0°C. Cells were washed three times in PBS and then lysed in 1% Triton X-100. The number of viral particles bound to the cell surface was quantitated by p24 ELISA. Results are shown as the percentage of viral attachment detected in cells incubated with the HIV-1IIIB/sFN mix alone.

gp120 ELISA

Ninety-six-well microtiter plates were coated overnight at 4°C with 1% BSA or with increasing concentrations of FN, sFN, or III1-C fragment. Wells were blocked with 1% BSA in PBS. Full-length HIV-1IIIB-gp120 (1 µg/ml) was added and allowed to attach for 3 h at 37°C. Unbound protein was removed by washing with PBS/1% BSA. Anti-gp120 Ab (1:1000) was added to wells, allowed to attach for 1 h, and then washed three times with PBS. HRP-conjugated goat anti-mouse Ab (1:1000; Dako, Carpenteria, CA) was added for 2 h at room temperature and then washed with PBS. Color development was performed using the TMB Microwell Peroxidase Substrate System (Kirkegaard & Perry Laboratories, Gaithersburg, MD) and was read at 450 nm. The data were reported as the mean absorbance of triplicate wells ± SD.

To evaluate inhibition by gp120 peptides, HIV-1IIIB was mixed with increasing concentrations of HIV-1IIIB gp120 peptide aa 418–441 or peptide aa 295–328 (1.25–125 µg/ml) and then added to 96-well plates coated with III1-C peptide. Virus particles were allowed to adhere for 1 h at 37°C. Following incubation, wells were washed five times with PBS to remove unbound virus. Attached virus was lysed in PBS containing 1% Triton X-100 and quantitated by p24 ELISA. Data are shown as the mean p24 levels (nanograms per milliliter) ± SD of triplicate samples.

Ab blocking studies

Primary CD4+ T lymphocytes (1 x 106) were incubated for 15 min at room temperature with the indicated anti-integrin Abs, GRGDSP peptide (5 mM), or EDTA (10 mM). Cells were then mixed with HIV-1IIIB/sFN and incubated for 1–2 h at 37°C, washed, treated with trypsin (25 µg/ml) for 20 min at room temperature, and lysed in 1% Triton X-100. The amount of internalized virus particles was quantitated in cell lysates by p24 ELISA. Results are shown as the percentage of viral entry detected in cells incubated with HIV-1IIIB/sFN mix alone.

Enzymatic treatment

Primary CD4+ T lymphocytes were washed in PBS, resuspended at 2 x 106/200 µl PBS containing 0.1% glucose and 0.1 mg/ml BSA, and treated with 50 mIU/ml heparitinase, 50 mIU/ml chondroitinase ABC, or 15 mIU/ml endo-ß-galactosidase for 1 h at 37°C. Following treatment, cells were washed and incubated with HIV-1IIIB/sFN mix for 30 min at 0°C, and viral attachment was measured as described.

Immunohistochemistry

Dissected rat lymph nodes were fixed in 4% paraformaldehyde followed by immersion in 15% sucrose. Tissues were embedded in OCT (Miles, Elkhart, IN) and frozen in liquid nitrogen-chilled isopentane. Cryostat sections (5 µm) of tissue were air-dried and washed in PBS. Endogenous peroxidase activity was blocked by incubation with Peroxoblock (Zymed, San Francisco, CA) for 45 s. Sections were incubated in 3% BSA for 10 min at room temperature and then incubated with the anti-III1-C polyclonal mouse serum (1:200) for 1 h at 37°C. As a control, sections were incubated with preimmune serum (1:200). After washing in PBS, sections were incubated with the biotinylated horse anti-mouse preabsorbed in rat (Vector, Burlingame, CA) for 30 min at 37°C, followed by 30-min incubation with avidin-biotinylated HRP (Vectastain ABC kit; Vector Laboratories, Burlingame, CA). The reaction product was visualized by incubation of the sections with diaminobenzidine (DAB Plus kit, Zymed). Sections were counterstained with hematoxylin, sequentially dehydrated in ethanol solutions, transferred to xylene, and mounted with Permount (Fisher, Fairlawn, NJ).

Statistical analysis

Data were initially analyzed by one-way ANOVA to test for differences involving three or more treatment protocols. Differences between individual conditions were assessed using a post-hoc analysis with Fisher’s protected least significant difference test. The level of statistical significance was set at p < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Multimeric FN increases HIV infection of T lymphocytes

We evaluated the role of immobilized and soluble multimeric FN on the infection of T lymphocytes with HIV. To test the effect of immobilized proteins, 24-well tissue culture plates were coated with various matrix proteins, including sFN, the multimeric form of FN, and were incubated with HIV-1IIIB followed by washing and the addition of PHA-stimulated CD4+ T lymphocytes. Cell-free supernatants were taken at various days postinfection and tested for virus levels by p24 ELISA. By days 10 and 17, wells coated with sFN showed significantly higher p24 levels than wells coated with FN (Fig. 1Go). No significant levels of p24 were detected in wells coated with VN or BSA. Thus, immobilized multimeric FN significantly enhanced HIV levels. Interestingly, the III1-C peptide alone, the FN fragment used to generate multimeric FN, also showed a significant increase in virus levels compared with soluble FN on days 10 and 17 postinfection.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 1. Infectivity of HIV-1IIIB in the presence of immobilized matrix proteins. Infection of CD4+ T lymphocytes with HIV-1IIIB was assessed in the presence of immobilized BSA, FN, III1-C, sFN, and VN. Stimulated CD4+ T lymphocytes were added to matrix protein-coated wells that had been preincubated with HIV-1IIIB. Culture supernatants were taken at the indicated days postinfection and tested for virus by p24 ELISA. Data are shown as the mean p24 levels (nanograms per milliliter) ± SD measured in supernatants of triplicate samples.

 
To test the effects of soluble proteins, we incubated HIV with soluble sFN, FN, BSA, or III1-C proteins for 15 min and added the mixture to PHA-stimulated lymphocytes. Accordingly, cells were exposed to equal amounts of virus. Cell-free supernatants were taken on various days postinfection and tested for virus levels by p24 ELISA. By day 4, significantly higher p24 levels were found in sFN-treated cells than in cells treated with soluble FN (Fig. 2GoA). p24 levels were undetectable in wells coated with BSA. By day 7, sFN and III1-C both enhanced infection of lymphocytes by 3- to 4-fold compared with FN or BSA. Thus, incubation of HIV with multimeric FN significantly enhanced the productive infection of lymphocytes compared with the effect of BSA or FN.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 2. Infectivity of HIV-1IIIB in the presence of soluble matrix proteins. A, p24 Ag production. HIV-1IIIB was preincubated with BSA, FN, III1-C, or sFN and then added to PHA-stimulated CD4+ T lymphocytes. After 2 h unbound virus was removed by washing, and cells were incubated at 37°C. Culture supernatants were taken on the indicated days postinfection and were tested for virus by p24 ELISA. Data are shown as the mean p24 levels (nanograms per milliliter) ± SD measured in supernatants of triplicate samples. B, PCR detection of viral DNA. Total cellular DNA was extracted from PHA-stimulated lymphocytes infected with HIV-1 in the presence of soluble BSA, FN, III1-C, or sFN (in parallel with p24 Ag detection) on day 1 (left panel) and day 4 (right panel) after infection. DNA was amplified by PCR using HIV-LTR-specific primers. PCR products were separated on 1.5% agarose gel, transferred to nylon membrane, and probed with radiolabeled PCR-generated fragment. On day 1 the expected 120-bp amplification product was only detected in sFN-treated samples. On day 4 the 120-bp product was detected in all samples. The approximate copy number of viral DNA was determined by the standard curve generated from amplification of known copy numbers of plasmid. PCR amplification with ß-globin-specific primers is shown in the bottom panels to verify equal loading of DNA samples. ND, not detected.

 
To examine whether the internalized viral particles underwent RT under single-cycle conditions, we extracted DNA in parallel with the above infectivity assay on day 1 following infection. We performed PCR with primers corresponding to the HIV-LTR region. These PCR primers are specific for the presence of extrachromosomal, circularized DNA and will not amplify DNA derived from attached, uninternalized virions (30). This was important because virions can contain virus-specific DNA (31, 32). Therefore, amplification products from these primers indicate that viral entry, RT, and nuclear translocation occurred (33). On day 1, a band of the appropriate size (120 bp) was detected only in sFN-treated samples (Fig. 2GoB). Approximately 14 copies of viral DNA were present in the sFN sample, based on the standard curve generated from amplification of known copy numbers of control plasmid. To increase the sensitivity, PCR products were reamplified using nested primers. Again, a product was only visualized in the sFN-treated sample; no bands were detected in the BSA-, FN-, or III1-C-treated samples (data not shown). PCR performed on DNA extracted from non-PHA-stimulated lymphocytes also showed a product only in sFN-treated samples (data not shown). By day 4, the 120-bp PCR product was detected in all samples (Fig. 2GoB, right panel). However, the sFN- and III1-C-treated samples contained ~2- to 4-fold more copies than FN- or BSA-treated samples. Detectable levels of p24 Ag by ELISA correlated with the presence of HIV-extrachromosomal DNA as analyzed by PCR (Fig. 2Go). However, PCR analysis detected viral DNA at earlier time points than p24 ELISA assay; PCR results from day 1 predicted p24 detection on day 4, and PCR results from day 4 predicted p24 detection on day 7.

Adhesion of HIV particles to matrix FN

We speculated that the observed increase in virus levels in the presence of immobilized sFN and III1-C resulted from an initial difference in the number of viral particles presented to T lymphocytes. Therefore, we compared the ability of HIV-1IIIB particles to bind to surfaces coated with sFN, III1-C, FN, or BSA. To test this, plates coated with increasing concentrations of proteins were incubated with equal amounts of HIV-1IIIB. Unbound viral particles were removed by washing, and p24 Ag levels were measured as an index of the number of adherent viral particles. We found a significant increase in the number of viral particles that bound to sFN compared with FN (Fig. 3GoA). This difference was evident at concentrations as low as 1 µg/ml and persisted at higher coating concentrations of matrix proteins. HIV-1IIIB also adhered to III1-C fragment significantly better than FN (Fig. 3GoA).



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 3. A, Adhesion of HIV-1IIIB to matrix proteins. Ninety-six-well plates were coated with increasing concentrations of FN ({square}), III1-C ({blacksquare}), or sFN ({circ}). Wells were incubated with equal amounts of HIV-1IIIB (~6 ng of p24) for 20 min at 37°C. Following incubation, virus bound to plates was lysed in PBS containing 1% Triton X-100 and quantitated by p24 Ag ELISA. Data are shown as the mean p24 (nanograms per milliliter) ± SD measured in duplicate samples minus the mean p24 (nanograms per milliliter) level measured in wells coated with BSA. B, Specificity of anti-III1-C antisera for sFN. Increasing dilutions of antisera were added to 96-well plates that were coated with FN ({square}), III1-C ({blacksquare}), sFN ({circ}), or 1% BSA ({triangleup}), for 1 h at room temperature. After washing, HRP-conjugated anti-mouse Ab (1:2000) was added, followed by color development with the TMB Microwell Peroxidase Substrate System (KPL). Data are shown as the mean absorbance at OD 450 nm of duplicate wells ± SD. C, Adhesion of HIV-1IIIB to sFN is inhibited by III1-C Ab. Plates coated with 20 µg of FN ({square}), III1-C ({blacksquare}), or sFN ({diamond}) were incubated with increasing concentrations of anti-III1-C Ab for 1 h at 37°C. Wells were incubated with equal amounts of HIV-1IIIB (~6 ng of p24) for 20 min at 37°C. Following incubation, virus bound to plates was lysed in PBS containing 1% Triton X-100 and quantitated by p24 Ag ELISA. Data are shown as the mean p24 (nanograms per milliliter) ± SD measured in triplicate samples.

 
We hypothesized that the III1-C region exposed in sFN was involved in virus binding, since the III1-C peptide supported the adhesion of viral particles. We asked whether an Ab directed against III1-C region could block the interaction of HIV with sFN. The specificity of the Ab was verified by ELISA. The antisera recognized sFN and the III1-C peptide, but not FN or BSA (Fig. 3GoB). Preimmune serum did not recognize any proteins (data not shown). Ab to III1-C peptide or nonimmune serum was added to wells precoated with different matrix proteins. Equal amounts of virus were added to wells and allowed to adhere for 1 h. Unbound virus particles were removed by washing, and p24 levels were measured. We found that Ab directed against III1-C epitope was able to significantly inhibit adhesion of HIV to sFN (and III1-C) in a dose-dependent manner (Fig. 3GoC). We found an 80% inhibition of virus binding to sFN at the highest Ab concentration tested. No significant inhibition of viral adhesion to FN was observed in the presence of III1-C Ab.

Viral attachment to cell surface is enhanced in the presence of sFN

Next, we tested whether the increase in viral infection was the result of increased binding of viral particles complexed with sFN and III1-C to the cell surface. To test this, HIV-1IIIB premixed with FN, sFN, or III1-C fragment was incubated with primary CD4+ T lymphocytes for 30 min at 0°C. This temperature allows viral attachment but not internalization (29). Preincubation of virus with sFN significantly increased the number of viral particles attaching to T lymphocytes compared with preincubation of virus with dimeric FN (8- to 10-fold; p < 0.001; Fig. 4GoA). Preincubation of virus with III1-C fragment also resulted in a significant increase in viral attachment compared with dimeric FN (2- to 3-fold; p < 0.04). Thus, despite equal amounts of viral particles presented to cells, exposure of cells to virus in the presence of sFN and III1-C resulted in increased viral adhesion to the cell surface. As an additional control, HIV/sFN complex did not attach to 293 cells, a human embryonic kidney cell line (data not shown).



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 4. A, Attachment of HIV-1IIIB to cell surface of CD4+ T lymphocytes in the presence of matrix proteins. Virus preincubated with FN, III1-C, or sFN was added to CD4+ T lymphocytes and allowed to attach for 30 min at 0°C. The number of viral particles adherent to the cell surface was quantitated in cell lysates by p24 ELISA. Data represent the average fold increase ± SD in p24 levels of multiple (n = 3) samples compared with p24 levels in control samples in which virus attached in the absence of FN, III1-C, or sFN. B, Internalization of HIV-1IIIB by CD4+ T lymphocytes. HIV-1IIIB was mixed with FN, III1-C, or sFN, then incubated with CD4+ T lymphocytes at 37°C for 1–2 h to allow viral attachment and internalization. Following incubation, cells were washed, treated with trypsin, and lysed. The number of internalized viral particles was quantitated in cell lysates by p24 ELISA. Data are shown as the average fold increase ± SD in p24 levels compared with p24 levels detected in cells incubated with HIV-1IIIB alone. Asterisks indicate significant differences from control values.

 
Internalization of viral particles is enhanced in the presence of sFN

To determine whether internalization of virus followed increased viral adhesion, we measured viral uptake by T lymphocytes that were exposed to equal amounts of viral particles in the presence of sFN, III1-C fragment, and FN. Viral particles were mixed with matrix proteins in solution and then added to lymphocytes for 1–2 h at 37°C to allow viral attachment and internalization. Cells were washed and treated with trypsin to remove uninternalized, attached virus (29). Subsequently, cells were lysed and tested for p24 levels by ELISA to determine the number of internalized viral particles (Fig. 4GoB). As shown, incubation of virus with sFN or III1-C fragment resulted in a significant increase in viral internalization (14 ± 5- and 9 ± 4-fold, respectively). Thus, the increase in the number of viral particles attaching to the cell surface correlated with an increase in viral internalization in the presence of sFN and III1-C fragment.

In the previous experiments virus was incubated with matrix proteins before incubation with T lymphocytes. We asked whether prior incubation of cells with sFN or III1-C resulted in enhanced HIV internalization or infection. However, preincubation of cells with either sFN or the III1-C fragment did not result in enhanced levels of viral internalization (data not shown). Thus, exposure of cells alone to sFN or the III1-C fragment did not render cells more susceptible to infection with HIV-1IIIB.

Differences in infection are not due to differences in activation state of CD4+ lymphocytes

To determine whether sFN or III1-C was exerting its effect by inducing the activation of CD4+ lymphocytes, we asked whether incubation of CD4+ lymphocytes with BSA, FN, sFN, or III1-C resulted in up-regulation of surface markers of T cell activation such as MHC class II (34), CD25 (IL-2R{alpha}, Tac Ag) (35), or CD38 (36). We incubated lymphocytes with BSA, FN, sFN, or III1-C for 2–4 h and then performed flow cytometry on the cells 24 and 48 h after treatment. As a positive control, cells were treated with PHA alone. We observed low level activation in all cell populations, most likely a result of positive selection and culture conditions. However, the surface profiles of class II, CD25, and CD38 were identical on all cells regardless of whether they were treated with BSA, FN, sFN, or III1-C (Table IGo). Thus, the differences we found in infection cannot be attributed to differences in the activation state of the cells.


View this table:
[in this window]
[in a new window]
 
Table I. Treatment of CD4+ cells with sFN does not increase activation compared to BSA or FN1

 
Interaction of T lymphocytes with matrix FN does not up-regulate HIV-LTR activity

Another possibility that could contribute to the observed increase in viral production was that adhesion of lymphocytes to matrix proteins increased viral replication by increasing HIV-LTR promoter activity. Cell-extracellular matrix interactions have previously been shown to influence viral replication. For example, monocytes plated on laminin showed increased viral replication, whereas FN had no effect (37). To evaluate the role of sFN on promoter activity, we used a lymphocyte cell line (Jurkat cells) stably transfected with the luciferase reporter gene under control of the HIV-1-LTR promoter. Cells were plated onto various matrix proteins and allowed to interact for 4 h, after which luciferase activity was measured as an indicator of HIV-LTR activity. Interaction of cells with sFN, III1-C, or FN did not result in up-regulation of HIV-LTR activity (data not shown). As a positive control, cells plated on wells coated with anti-CD3 Ab, which is known to up-regulate HIV-LTR activity, showed a 3-fold up-regulation of luciferase activity.

Heparan sulfate competition assays

In a recent study the HIV envelope protein (gp160) was shown to bind with strong affinity to the heparin binding domain of FN (38). Therefore, we tested whether heparan sulfate could compete with viral binding to sFN and as a result inhibit the sFN-mediated increase in viral attachment. Virus was mixed with increasing concentrations of heparan sulfate before incubation with sFN and then incubated with CD4+ T lymphocytes for 30 min at 0°C. The number of adherent viral particles was quantitated as described. Incubation of HIV with heparan sulfate inhibited the sFN-mediated increase in viral attachment in a dose-dependent manner (Fig. 5Go).



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 5. Heparan sulfate inhibits binding of sFN to HIV-1IIIB. Equal amounts of HIV-1IIIB (~6 ng of p24) were mixed with increasing concentrations of heparan sulfate (0.001–1 µg/ml), then incubated with sFN. The HIV-1IIIB/sFN mixture was then added to CD4+ T lymphocytes and allowed to attach for 30 min at 0°C. Following incubation, cells were washed and lysed. Attached viral particles were quantitated in cell lysates by p24 Ag ELISA. Data are shown as the average (n = 2) percentage of p24 levels detected in cells incubated with HIV-1IIIB/sFN.

 
gp120 envelope mediates binding of virus to III1-C region

To determine whether the interaction of HIV and sFN was mediated through viral gp120, we asked whether full-length gp120 could bind to sFN and III1-C peptide, using an ELISA-based adhesion assay. We found that full-length gp120 of HIV-1IIIB bound significantly better to III1-C peptide and sFN than to FN or BSA at concentrations as low as 0.4 µg/ml (Fig. 6GoA). The V3 region of gp120 envelope has been implicated in the attachment of HIV to cell surface proteoglycans (39, 40). Because FN contains several heparin binding domains, and heparan sulfate inhibited sFN-mediated increased viral attachment, we asked whether the V3 region might be involved in binding. However, neutralizing Abs raised against the V3 region had no effect on HIV adhesion to III1-C or sFN (data not shown). In addition, a synthetic peptide (aa 295–328), that contains the principal neutralizing domain of gp120 (GPGRAF) did not inhibit adhesion of HIV-1IIIB to III1-C (Fig. 6GoB). However, a nonoverlapping gp120 peptide (aa 418–441) that includes the CD4 binding region almost completely inhibited the adhesion of HIV to III1-C at 125 µg/ml (Fig. 6GoB). Thus, the gp120 envelope protein of HIV is involved in binding of virus to the III1-C region of sFN. The binding does not involve the V3 region as originally hypothesized, but instead involves the CD4 binding region within gp120.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 6. A, GP120 envelope protein binds to sFN and III1-C peptide. Full-length recombinant HIVIIIB gp120 protein was added to 96-well plates that were coated with sFN, III1-C, FN, or 1% BSA, followed by incubation with anti-gp120 Ab. After washing, HRP-conjugated anti-mouse Ab was added, followed by color development with the TMB Microwell Peroxidase Substrate System (KPL). Data are shown as the mean absorbance at OD 450 nm of triplicate wells ± SD. B, Binding of HIV-1IIIB to III1-C is inhibited by HIV envelope peptide. Adhesion of HIV-1IIIB to 96-well plates coated with III1-C peptide was measured in the presence of increasing concentrations of HIV-1IIIB gp120 peptide 418–411 ({square}) or peptide 295–328 (•). Following incubation, unbound virus was washed off, and virus bound to plates was lysed in 1% Triton X and quantitated by p24 Ag ELISA. Data are shown as the mean p24 (nanograms per milliliter) levels of triplicate samples ± SD.

 
Integrins do not mediate binding of HIV-sFN complex to cell

Our data suggested that the sFN-mediated increase in HIV infectivity required binding of virus to sFN and subsequent binding of HIV-1IIIB/sFN complex to the cell surface. Integrins are the predominant class of receptors that mediate binding of cells to FN (15, 16, 41). Primary CD4+ T lymphocytes express several FN-binding integrins, including {alpha}4ß1, {alpha}5ß1, and {alpha}v-containing integrins (42). To test whether integrins mediated binding of the HIV-1IIIB/sFN complex to the cells, we incubated cells with various anti-integrin Abs before incubation with HIV-1IIIB/sFN complex. Anti-integrin Abs were not able to block the sFN-mediated increase in viral entry (Fig. 7Go). Similarly, incubation of cells with an RGD-containing peptide, the major motif through which integrins bind FN (41), did not block the sFN-mediated increase in viral entry. Because integrin binding requires the presence of divalent cations, we also tested the effect of the chelating agent EDTA. Treatment of cells with EDTA also failed to block the sFN-mediated enhancement in viral entry. In contrast, an Ab directed at CXCR4 (anti-fusin), a coreceptor used by T lymphotropic HIV strains (27), blocked viral entry by 50%. This is consistent with previous studies that show that the anti-fusin Ab only partially blocks T lymphocyte infection with certain HIV strains (43). Thus, the sFN-mediated increase in viral adhesion involved the interaction of HIV-1IIIB/sFN complex with a class of receptors other than integrins on the cell surface.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 7. Effect of anti-integrin Abs on the uptake of HIV-1IIIB/sFN complex. HIV-1IIIB premixed with sFN was added to CD4+ T lymphocytes that had been preincubated with the indicated anti-integrin Abs (bars 2–7), GRGDSP peptide (bar 8), 10 mM EDTA (bar 9), or anti-fusin Ab (bar 10). Following 1–2 h of incubation at 37°C, cells were washed, treated with trypsin, and lysed. The number of internalized viral particles was quantitated in cell lysates by p24 ELISA. Data are shown as the percentage of p24 levels detected in cells incubated with HIV-1IIIB/sFN. Asterisk indicates significant difference from control values.

 
Proteoglycans mediate binding of HIV-sFN complex to cells

Cell surface proteoglycans have been implicated in adherence of HIV to cells. HIV has been shown to bind to heparan sulfate proteoglycans, and enzymatic removal of heparan proteoglycans interferes with the initial attachment of HIV to T lymphocyte cell lines (44, 45). We investigated whether enzymatic removal of proteoglycans interfered with the attachment of the HIV-1IIIB/sFN complex to cells. Treatment of cells with heparitinase I had no effect on adhesion of HIV-1IIIB/sFN complex (Fig. 8Go). In contrast, treatment of cells with endo-ß-galactosidase or chondroitinase ABC resulted in 25 and 32% decreases (p < 0.002), respectively. A combination of enzymes resulted in a 50% decrease in p24 levels (p < 0.001; Fig. 8Go). Thus, removal of cell surface proteoglycans interferes with the attachment of HIV-1IIIB/sFN complex to the cell surface of T lymphocytes.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 8. Effect of proteoglycan removal on attachment of HIV-1IIIB/sFN complex to cell surface. CD4+ T lymphocytes treated with heparitinase (H), chondroitinase (C), endo-ß-galactosidase (E), or H, C, and E combined were incubated with HIV-1IIIB/sFN. Following 30-min incubation at 0°C, the amount of attached viral particles was quantitated as described in the text. Data are shown as the percent inhibition of p24 levels detected in enzymatically treated cells compared with that in untreated cells. Asterisks indicate significant differences from control values.

 
III1-C epitope is exposed tissue FN

The exposure of cryptic sites within FN after matrix assembly may contribute to functional differences between matrix and soluble FN. Since it was not known whether the III1-C epitope is exposed in lymph node tissue, we performed immunohistochemistry using an Ab that recognizes III1-C peptide. This Ab does not recognize dimeric FN even when immobilized in a solid phase (Fig. 3GoB). Using this Ab, we show immunoreactivity in rat lymph node tissue (Fig. 9GoA). No immunoreactivity was detected in lymph nodes incubated with preimmune serum (Fig. 9GoB). We also detected III1-C immunoreactivity in FN matrix secreted and assembled in vitro by rat embryo fibroblasts (data not shown). Thus, the III1-C epitope is exposed in the matrix of lymph nodes and may contribute to viral binding in vivo.



View larger version (72K):
[in this window]
[in a new window]
 
FIGURE 9. Immunoreactivity of III1-C in rat lymph node tissue. Tissue sections (5 µm) were incubated with mouse polyclonal anti-III1-C immune serum (A) or mouse preimmune serum (B). Sections were counterstained with hematoxylin.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study we show that sFN, a multimeric form of FN, enhances HIV infection of CD4+ T lymphocytes. In contrast, dimeric FN, even when immobilized in a solid state phase, and other matrix proteins tested did not affect the efficiency of HIV infection. sFN (and III1-C) resulted in productive infection of lymphocytes, as measured by increasing p24 production over time and detection of extrachromosomal viral DNA. Levels of extrachromosomal viral DNA are associated with ongoing viral replication and pathogenicity (46). We demonstrate that the interaction of HIV and sFN is mediated in part by III1-C epitope in sFN and gp120 envelope protein of HIV-IIIIB. We hypothesize that the difference between plasma FN and sFN relates to the exposure of the III1-C epitope after multimerization. In sFN, the III1-C region is available to interact with the gp120 envelope protein of HIV. The HIV/sFN complex adheres to lymphocytes via cell surface proteoglycans, followed by internalization of HIV and productive infection.

We speculate that our findings may be relevant to HIV infection in vivo. Following the initial viremic phase of infection, HIV accumulates in lymph node tissue, which serves as the major viral reservoir (4, 5). During the chronic phase of infection, the majority of viral particles are located extracellularly, associated with the FDC network (2, 3, 47). Presentation of HIV by FDCs is thought to aid in bringing viral particles and T lymphocytes in closer proximity and thereby enhancing the efficiency of HIV transfer into T lymphocytes (6, 7, 8, 9, 10). Matrix FN may work in concert with the FDC network to provide the optimal environment for trapping of HIV particles and enhance de novo infection of T lymphocytes by facilitating contact between HIV and the CD4 and chemokine receptor. Similarly, HIV entering the host in the presence of genital lesions is likely to encounter matrix FN as a result of tissue injury and wound healing (48, 49, 50). Matrix FN may provide a surface for viral particles to adhere to and promote their uptake by T lymphocytes.

To our surprise, III1-C fragment, the recombinant peptide used to induce in vitro polymerization of FN, also increased HIV infection. FN is a modular protein that contains multiple type III repeats. Although these repeats show homology, the ability to enhance HIV infection appeared to be specific for the first type III repeat (III1-C), because a peptide corresponding to the 11th type III repeat had no effect on HIV infectivity (data not shown). Interestingly, under certain circumstances the III1-C fragment shares other properties with sFN, including antitumorigenicity (R. Pasqualini and E. Ruoslahti, unpublished observations) and the ability to trigger cell signaling (28). When FN is assembled into a matrix, conformational changes may increase the accessibility of cryptic sites within FN. A recent study showed that application of tension to FN fibrils by cells exposed a cryptic site in FN that included the III1-C region (51) We show that polyclonal serum raised against III1-C recognized the III1-C epitope in rat lymph node tissue, but not in dimeric FN. Thus, it appears that the III1-C epitope is cryptic in soluble FN, becomes exposed during FN matrix assembly, and is available to interact with viral particles. A recent report shows that the pathogenic bacteria, Streptococcus pyogenes, is able to discriminate between matrix and soluble FN and adheres preferentially to matrix FN (52). This may be important in the initial establishment of infection. Likewise, HIV appears to preferentially adhere to matrix FN.

It is also possible that proteolysis of FN during matrix remodeling produces III1-C-containing fragments in vivo. During HIV infection, lymph nodes undergo extensive remodeling. This may lead to the proteolysis of FN, with the release of III1-C-containing peptides. Proteolytic degradation products of several other matrix proteins are known to possess biological activity distinct from that of the parent protein (53, 54, 55, 56, 57, 58, 59). For example, angiostatin and endostatin, fragments derived from proteolytic degradation of plasminogen and collagen XVIII, respectively, inhibit angiogenesis (55, 56, 58, 59). We show that the III1-C fragment bound HIV as effectively as sFN, but was less effective at increasing HIV infection. This could be due to less efficient binding of cells to III1-C, which is supported by data from our laboratory showing that CD4+ T lymphocytes adhere less efficiently to III1-C than to sFN (data not shown).

Binding of HIV to FN is thought to be mediated by the envelope protein of HIV (38). We examined whether this was also true for binding of HIV to sFN or the III1-C peptide. We showed that the full-length gp120 envelope protein of HIV-1IIIB adhered significantly better to sFN and III1-C peptide than to FN (Fig. 6GoA). We initially hypothesized that the V3 loop of the gp120 envelope protein may be involved in binding, because this region carries a positive charge and has been implicated in binding of virus to the proteoglycan-anchored heparan sulfate (40, 60, 61). However, neither an Ab raised against the V3 loop nor a synthetic peptide based on the V3 loop was able to inhibit adhesion of HIV-1IIIB to sFN or III1-C peptide. However, a peptide that included the CD4 binding region of gp120 inhibited adhesion of HIV-1IIIB to III1-C in a dose-dependent manner. Thus, the binding of HIV to III1-C appears to involve the CD4 binding domain of gp120 and not the V3 loop. Others have shown specific binding of the HIV-1IIIB envelope protein (gp160) to the heparin binding domain located in the FN carboxyl terminal (38). We speculate that the heparin cell binding domain that contains the III1-C region mediates binding of HIV to sFN. Conformational changes induced by multimerization of FN may increase the exposure of the III1-C region, explaining our finding that HIV-1IIIB bound more efficiently to sFN than to FN. This is supported by the ability of an Ab specific for III1-C to reduce binding of HIV to sFN.

Increased HIV uptake in the presence of sFN is dependent on cell surface proteoglycans, not integrins. Although FN and FN-derived fragments enhanced the efficiency of retroviral transfer in several studies (62, 63, 64, 65), the enhancement required interaction of FN with integrins, because removal of the RGD and LDV integrin binding sites from the FN-derived fragments resulted in loss of activity (63). In contrast, the ability of sFN to mediate enhanced HIV infection did not depend on the interaction of sFN with integrins. Treatment of cells with various anti-integrin Abs, EDTA, or an RGD-containing peptide did not affect the sFN-mediated increase in viral infection. Thus, the mechanism behind the increased viral uptake in the presence of sFN differs from that in FN fragments. Other studies have suggested that a class of receptors besides integrins may contribute to the adhesion of cells to sFN (19, 21). Our data support a role for cell surface proteoglycans in the adhesion of sFN-viral complex to the cell, because enzymatic removal of proteoglycans decreased the sFN-mediated increase in viral uptake. Interestingly, heparan sulfate-containing proteoglycans did not contribute to binding of HIV/sFN complex to the cells. Previous studies have shown that heparan sulfate proteoglycans can mediate the initial attachment of HIV to lymphocytic cell lines (60). In addition, binding of HIV to HeLa cells transfected with CD4 depends strongly on the presence of cell surface heparan sulfate proteoglycans and not CD4 (66). In our study removal of heparan sulfate proteoglycans did not affect the attachment of HIV-1IIIB/sFN complex to cells. However, we used primary T lymphocytes that express minimal cell surface heparan sulfate proteoglycans compared with the lymphocyte cell lines used in the other studies (60).

Taken together, our data suggest that the sFN-mediated increase in HIV infection was due to enhanced binding of HIV-1IIIB/sFN complex to proteoglycans on the cell surface of T lymphocytes, followed by internalization of virus particles and complete RT of HIV DNA. Additional mechanisms may also have contributed. Internalization of receptors occupied by sFN could lead to simultaneous internalization of HIV bound to sFN, promoting viral entry in addition to viral attachment. Another possibility is that interaction of sFN with cell surface receptors triggered intracellular signaling, affecting the expression and activity of CD4 and CXCR4. However, this is less likely, because preincubation of cells with sFN before exposure to virus did not lead to increased viral uptake (data not shown). Similarly, a role for transcriptional regulation by sFN is less likely, because adhesion of a lymphocyte cell line to sFN had no effect on HIV-LTR promoter activity.

The interaction of HIV and cells with matrix FN may be an important modulator of HIV infection in vivo. The ability of pathogenic organisms to discriminate between forms of FN adds an additional level of complexity to host-pathogen interactions. We propose that the extracellular environment of the lymph nodes may contribute to HIV pathogenicity. Pharmacological approaches targeted at minimizing this interaction may be beneficial in HIV infection prevention and treatment.


    Acknowledgments
 
We thank Yan Wang for her technical support and S. Bourdoulous for sharing unpublished data and for critical reading of the manuscript. We also thank Drs. Karen Zier and Paul Klotman for thoughtful suggestions.


    Footnotes
 
1 This work was supported by grants from the Stony World Herbert Foundation, the National Institutes of Health (R29HL57890 to L.M.S.), and the National Cancer Institute (5P30CA30199 to R.P.). Back

2 M.C.T. and G.G. contributed equally to the preparation of this manuscript. Back

3 Current address: GU Oncology, University of Texas, M. D. Anderson Cancer Center, Houston, TX 77030-4095. Back

4 Address correspondence and reprint requests to Dr. Lynn M. Schnapp, Division of Pulmonary and Critical Care Medicine, Mount Sinai School of Medicine, Box 1232, One Gustave Levy Place, New York, NY 10029. Back

5 Abbreviations used in this paper: FDC, follicular dendritic cell; sFN, superfibronectin; FN, fibronectin; VN, vitronectin; LTR, long terminal repeat. Back

Received for publication May 19, 1999. Accepted for publication January 4, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Pantaleo, G., O. J. Cohen, T. Schacker, M. Vaccarezza, C. Graziosi, G. P. Rizzardi, J. Kahn, C. H. Fox, S. M. Schnittman, D. H. Schwartz, et al 1998. Evolutionary pattern of human immunodeficiency virus (HIV) replication and distribution in lymph nodes following primary infection: implications for antiviral therapy. Nat. Med. 4:341.[Medline]
  2. Haase, A. T., K. Henry, M. Zupancic, G. Sedgewick, R. A. Faust, H. Melroe, W. Cavert, K. Gebhard, K. Staskus, Z. Q. Zhang, et al 1996. Quantitative image analysis of HIV-1 infection in lymphoid tissue. Science 274:985.[Abstract/Free Full Text]
  3. Schmitz, J., J. van Lunzen, K. Tenner-Racz, G. Grossschupff, P. Racz, H. Schmitz, M. Dietrich, F. T. Hufert. 1994. Follicular dendritic cells retain HIV-1 particles on their plasma membrane, but are not productively infected in asymptomatic patients with follicular hyperplasia. J. Immunol. 153:1352.[Abstract]
  4. Fox, C. H.. 1992. Lymphoid germinal centers are reservoirs of HIV infection and account for the apparent latency of infection. AIDS Res. Hum. Retroviruses 8:756.[Medline]
  5. Fox, C. H., K. Tenner-Racz, P. Racz, A. Firpo, P. A. Pizzo, A. S. Fauci. 1991. Lymphoid germinal centers are reservoirs of human immunodeficiency virus type 1 RNA [published erratum appears in 1992, J. Infect. Dis. 165:1161]. J. Infect. Dis. 164:1051.[Medline]
  6. Tsunetsugu, Y. Y., S. Yasuda, A. Sugimoto, T. Yagi, M. Azuma, H. Yagita, K. Akagawa, T. Takemori. 1997. Efficient virus transmission from dendritic cells to CD4+ T cells in response to antigen depends on close contact through adhesion molecules. Virology 239:259.[Medline]
  7. Zoeteweij, J. P., A. Blauvelt. 1998. HIV-Dendritic cell interactions promote efficient viral infection of T cells. J. Biomed. Sci. 5:253.[Medline]
  8. Rosenberg, Y. J., M. G. Lewis, J. J. Greenhouse, A. Cafaro, E. C. Leon, C. R. Brown, K. E. Bieg, V. M. Kosco. 1997. Enhanced follicular dendritic cell function in lymph nodes of simian immunodeficiency virus-infected macaques: consequences for pathogenesis. Eur. J. Immunol. 27:3214.[Medline]
  9. Pope, M., M. G. Betjes, N. Romani, H. Hirmand, P. U. Cameron, L. Hoffman, S. Gezelter, G. Schuler, R. M. Steinman. 1994. Conjugates of dendritic cells and memory T lymphocytes from skin facilitate productive infection with HIV-1. Cell 78:389.[Medline]
  10. Cameron, P., M. Pope, A. Granelli-Piperno, R. M. Steinman. 1996. Dendritic cells and the replication of HIV-1. J. Leukocyte Biol. 59:158.[Abstract]
  11. Paiva, D. D., J. C. Morais, J. Pilotto, V. Veloso, F. Duarte, H. L. Lenzi. 1996. Spectrum of morphologic changes of lymph nodes in HIV infection. Mem. Inst. Oswaldo Cruz 91:371.[Medline]
  12. Castanos, V. E., P. Biberfeld, M. Patarroyo. 1995. Extracellular matrix proteins and integrin receptors in reactive and non-reactive lymph nodes. Immunology 86:270.[Medline]
  13. Akiyama, S. K., S. S. Yamada, W. T. Chen, K. M. Yamada. 1989. Analysis of fibronectin receptor function with monoclonal antibodies: roles in cell adhesion, migration, matrix assembly, and cytoskeletal organization. J. Cell Biol. 109:863.[Abstract/Free Full Text]
  14. Fogerty, F. J., S. K. Akiyama, K. M. Yamada, D. F. Mosher. 1990. Inhibition of binding of fibronectin to matrix assembly sites by anti-integrin ({alpha}5ß1) antibodies. J. Cell Biol. 111:699.[Abstract/Free Full Text]
  15. Mosher, D. F.. 1984. Physiology of fibronectin. Annu. Rev. Med. 35:561.[Medline]
  16. Mosher, D. F., F. J. Fogerty, M. A. Chernousov, E. L. Barry. 1991. Assembly of fibronectin into extracellular matrix. Ann. NY Acad. Sci. 614:167.[Abstract]
  17. Ruoslahti, E.. 1996. Integrin signaling and matrix assembly. Tumour Biol. 17:117.[Medline]
  18. Morla, A., E. Ruoslahti. 1992. A fibronectin self-assembly site involved in fibronectin matrix assembly: reconstruction in a synthetic peptide. J. Cell Biol. 118:421.[Abstract/Free Full Text]
  19. Morla, A., Z. Zhang, E. Ruoslahti. 1994. Superfibronectin is a functionally distinct form of fibronectin. Nature 367:193.[Medline]
  20. Chernousov, M. A., F. J. Fogerty, V. E. Koteliansky, D. F. Mosher. 1991. Role of the I-9 and III-1 modules of fibronectin in formation of an extracellular fibronectin matrix. J. Biol. Chem. 266:10851.[Abstract/Free Full Text]
  21. Pasqualini, R., S. Bourdoulous, E. Koivunen, V. J. Woods, E. Ruoslahti. 1996. A polymeric form of fibronectin has antimetastatic effects against multiple tumor types. Nat. Med. 2:1197.[Medline]
  22. Yatohgo, T., M. Izumi, H. Kashiwagi, M. Hayashi. 1988. Novel purification of vitronectin from human plasma by heparin affinity chromatography. Cell Struct. Funct. 13:281.[Medline]
  23. Dittel, B. N., J. B. McCarthy, E. A. Wayner, T. W. LeBien. 1993. Regulation of human B-cell precursor adhesion to bone marrow stromal cells by cytokines that exert opposing effects on the expression of vascular cell adhesion molecule-1 (VCAM-1). Blood 81:2272.[Abstract/Free Full Text]
  24. Weinacker, A., A. Chen, M. Agrez, R. Cone, S. Nishimura, E. Wayner, R. Pytela, D. Sheppard. 1994. Role of the integrin {alpha}vß6 in cell attachment to fibronectin: heterologous expression of intact and secreted forms of the receptor. J. Biol. Chem. 269:6940.[Abstract/Free Full Text]
  25. Wayner, E. A., W. G. Carter. 1987. Identification of multiple cell adhesion receptors for collagen and fibronectin in human fibrosarcoma cells possessing unique {alpha} and common ß subunits. J. Cell Biol. 105:1873.[Abstract/Free Full Text]
  26. Wayner, E. A., W. G. Carter, R. S. Piotrowicz, T. J. Kunicki. 1988. The function of multiple extracellular matrix receptors in mediating cell adhesion to extracellular matrix: preparation of monoclonal antibodies to the fibronectin receptor that specifically inhibit cell adhesion to fibronectin and react with platelet glycoproteins Ic-IIa. J. Cell Biol. 107:1881.[Abstract/Free Full Text]
  27. Endres, M. J., P. R. Clapham, M. Marsh, M. Ahuja, J. D. Turner, A. McKnight, J. F. Thomas, H. B. Stoebenau, S. Choe, P. J. Vance, et al 1996. CD4-independent infection by HIV-2 is mediated by fusin/CXCR4. Cell 87:745.[Medline]
  28. Bourdoulous, S., G. Orend, D. A. MacKenna, R. Pasqualini, E. Ruoslahti. 1998. Fibronectin matrix regulates activation of RHO and CDC42 GTPases and cell cycle progression. J. Cell Biol. 143:267.[Abstract/Free Full Text]
  29. Harouse, J. M., S. Bhat, S. L. Spitalnik, M. Laughlin, K. Stefano, D. H. Silberberg, F. Gonzalez-Scarano. 1991. Inhibition of entry of HIV-1 in neural cell lines by antibodies against galactosyl ceramide. Science 253:320.[Abstract/Free Full Text]
  30. Cara, A., F. Guarnaccia, M. S. Reitz, R. C. Gallo, F. Lori. 1995. Self-limiting, cell type-dependent replication of an integrase-defective human immunodeficiency virus type 1 in human primary macrophages but not T lymphocytes. Virology 208:242.[Medline]
  31. Lori, F., F. di Marzo Veronese, A. L. de Vico, P. Lusso, Jr M. S. Reitz, R. C. Gallo. 1992. Viral DNA carried by human immunodeficiency virus type 1 virions. J. Virol. 66:5067.[Abstract/Free Full Text]
  32. Trono, D.. 1992. Partial reverse transcripts in virions from human immunodeficiency and murine leukemia viruses. J. Virol. 66:4893.[Abstract/Free Full Text]
  33. Gao, W. Y., A. Cara, R. C. Gallo, F. Lori. 1993. Low levels of deoxynucleotides in peripheral blood lymphocytes: a strategy to inhibit human immunodeficiency virus type 1 replication. Proc. Natl. Acad. Sci. USA 90:8925.[Abstract/Free Full Text]
  34. Caplen, H. S., S. Salvadori, B. Gansbacher, K. S. Zier. 1992. Post-transcriptional regulation of MHC class II expression in human T cells. Cell. Immunol. 139:98.[Medline]
  35. Biselli, R., P. M. Matricardi, R. D’Amelio, A. Fattorossi. 1992. Multiparametric flow cytometric analysis of the kinetics of surface molecule expression after polyclonal activation of human peripheral blood T lymphocytes. Scand. J. Immunol. 35:439.[Medline]
  36. Schuerch, C. D., M. Fleetwood, O. Glidewell. 1987. Lymphocyte subsets and activation antigens in a reference population: a flow cytometric study using single and double antibody staining. Immunol. Invest. 16:345.[Medline]
  37. Dhawan, S., M. Vargo, M. S. Meltzer. 1992. Interactions between HIV-infected monocytes and the extracellular matrix: increased capacity of HIV-infected monocytes to adhere to and spread on extracellular matrix associated with changes in extent of virus replication and cytopathic effects in infected cells. J. Leukocyte Biol. 52:62.[Abstract]
  38. Bozzini, S., V. Falcone, P. G. Conaldi, L. Visai, L. Biancone, A. Dolei, A. Toniolo, P. Speziale. 1998. Heparin-binding domain of human fibronectin binds HIV-1 gp120/160 and reduces virus infectivity. J. Med. Virol. 54:44.[Medline]
  39. Demaria, S., Y. Bushkin. 1996. Soluble CD4 induces the binding of human immunodeficiency virus type 1 to cells via the V3 loop of glycoprotein 120 and specific sites in glycoprotein 41. AIDS Res. Hum. Retroviruses 12:281.[Medline]
  40. Roderiquez, G., T. Oravecz, M. Yanagishita, H. D. Bou, H. Mostowski, M. A. Norcross. 1995. Mediation of human immunodeficiency virus type 1 binding by interaction of cell surface heparan sulfate proteoglycans with the V3 region of envelope gp120-gp41. J. Virol. 69:2233.[Abstract]
  41. Ruoslahti, E., M. D. Pierschbacher. 1987. New perspectives in cell adhesion: RGD and integrins. Science 238:491.[Abstract/Free Full Text]
  42. Shaw, S. 1995. Leukocyte Differentiation Antigen Database, version 1.1. Bethesda: International Workshop on Leukocyte Differentiation Antigens.
  43. McKnight, A., D. Wilkinson, G. Simmons, S. Talbot, L. Picard, M. Ahuja, M. Marsh, J. A. Hoxie, P. R. Clapham. 1997. Inhibition of human immunodeficiency virus fusion by a monoclonal antibody to a coreceptor (CXCR4) is both cell type and virus strain dependent. J. Virol. 71:1692.