The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, M. G.
Right arrow Articles by Schwartz, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, M. G.
Right arrow Articles by Schwartz, R. H.
The Journal of Immunology, 2000, 164: 3185-3192.
Copyright © 2000 by The American Association of Immunologists

A Putative 12 Transmembrane Domain Cotransporter Expressed in Thymic Cortical Epithelial Cells

Moon Gyo Kim1, Francis A. Flomerfelt, Kee-Nyung Lee2, Chuan Chen and Ronald H. Schwartz3

Laboratory of Cellular and Molecular Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda MD 20892


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 References
 
We have isolated a full-length cDNA clone (thymic stromal origin (TSO)-1C12) from a SCID thymus library using a probe from a PCR-based subtractive library enriched for sequences from fetal thymic stromal cells. TSO-1C12 mRNA is expressed mainly in the thymic cortex and is highly enriched in SCID thymus. Expression per cell is highest during fetal thymus development and decreases after day 16. Antipeptide Abs immunoprecipitated a hydrophobic, plasma membrane glycoprotein (thymic stromal cotransporter, TSCOT) whose translated sequence has weak homology to bacterial antiporters and mammalian cation cotransporters with 12 transmembrane domains. TSCOT represents a new member of this superfamily that is highly expressed in thymic cortical epithelial cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 References
 
Normal thymopoiesis is a tightly regulated multistep process that involves interactions between thymocytes at different developmental stages and surrounding cells localized in particular compartments of the thymic microenvironment (reviewed in Refs. 1 and 2). At each step, genetic programs for thymocyte survival, traffic, lineage commitment, and selection are regulated by the stromal cells. The molecules on or secreted by these cells are directly or indirectly responsible for inducing or modifying all of these processes. Thus, knowledge of the identity and expression of the genes that encode such molecules is important for understanding how T cell differentiation takes place.

The few spontaneous (e.g., nu/nu)) (3, 4, 5) and gene-targeted (e.g., IL-7 and MHC class II) (6, 7, 8, 9) mutations of thymic stromal cell genes have provided important insights into the mechanisms by which stromal cells function. In an attempt to identify more such molecules, we have created a PCR-based subtracted cDNA library from stromal cells prepared from fetal thymic organ cultures (FTOC)4 treated with 2-deoxyguanosine (2-dGuo) (10). The library was found to contain a large fraction of unknown genes upon limited random screening by DNA sequencing. The expression of one of those genes, thymic stromal origin (TSO)-1C12, was detected by Northern blotting only in the thymus and was greatly enriched in the SCID thymus. In the present work we sequenced a full-length cDNA clone from a SCID thymus library, examined the protein it encodes with several antipeptide antisera, and determined where and when the molecule was expressed in the thymus.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 References
 
Mice

Fetal thymi of 14.5-day gestation were obtained from timed matings of C57BL/6 (B6) mice (National Cancer Institute, Frederick, MD). C.B-17 mice bearing the SCID mutation were bred in our animal facility (National Institute of Allergy and Infectious Diseases, Frederick, MD). Mice bearing the following gene-targeted mutations were derived into our breeding colony at Taconic Farms (Germantown, NY) by embryo transfer and backcrossed when necessary to C57BL/6 or C57BL/10 mice. The N number is the number of crosses at the time the mice were used: the recombinase activating gene 2 (RAG2)-/- (N11) (11), ß2-microglobulin-/- (N11) (12), invariant chain-/- (N10) (13), IFN-{gamma}-/- (GKO) (N7) (14), and TCR-{alpha}-/- (N12) (15).

Antibodies

Abs against the HPLC-purified (99%) peptides acetyl-Gln-Asp-Lys-Gln-Asn-Val-Pro-Arg-Asn-Pro-Arg-Thr-Pro-Arg-Lys-Gly-Cys-amide (from the cytoplasmic loop) and acetyl-Cys-Val-Pro-Arg-Ser-Gln-Gln-Gly-Glu-Cys[Acm]-Ala-Glu-Lys-Gln-Pro-Ser-COOH (C terminus) were generated by immunizing rabbits with both peptides (Quality Controlled Biochemicals, Hopkinton, MA). The antisera were purified on peptide affinity columns.

Ab staining

Deparaffinized thymic sections were treated with a methanol-acetone mixture for 2 min at 22°C, washed with 0.2% Tween in PBS, and stained with 10 µg/ml of antiloop or anti-C-terminal peptide Abs for 1 h at 22°C. After washing four times with Tween-PBS, a goat anti-rabbit HRP conjugate (Vector Laboratories, Burlingame, CA) was added and the color was developed with an ImmunoPure metal-enhanced diaminobenzidine (DAB) substrate kit (Pierce, Rockford, IL). Thymic stromal cells prepared from 2-dGuo-treated FTOC were trypsinized and cultured for 2wk in IMDM containing 10% FBS. The cells were then subcultured into chamber slides and fixed and stained as above.

Northern blotting analysis

Total RNAs were prepared by using the Triozol reagent (Molecular Research Center, Cincinnati, OH). Poly(A)+ RNAs were prepared using a FastTrack 2.0 kit (Invitrogen, Carlsbad, CA). Ten micrograms of total or 2 µg of poly(A)+ RNA were electrophoresed on a 1% agarose-formamide gel, blotted onto a nylon membrane, and hybridized with a 32P-labeled probe using QuikHyb (Stratagene, La Jolla, CA). The membrane was then washed with 2x SSC and 0.1% SDS followed by 0.1x SSC and 0.1% SDS, and analyzed on a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).

Isolation of the cDNA

A SCID cDNA library (16) was screened using a [32P]dATP-labeled 0.7-kb fragment isolated from the PCR-based subtractive library as previously described (10).

In situ hybridization

Sense and antisense RNA probes containing the 3' 240 bases of the TSO-1C12 cDNA were generated using the MEGA-SCRIPT kit (Ambion, Austin, TX), and photobiotinylated using a psoralin cross-linking system (Schliecher & Schuell, Keene, NH). The specific activities of the probes were determined on a slot blot using a chemiluminescent assay and only those sets of equal activity were used.

Deparaffinized slides of thymus sections were treated for 10 min at 60°C with unmasking solution (Dako, Carpinteria, CA), rinsed in water, and treated with acetic anhydride (10 min with 0.25% acetic anhydride, 100 mM triethylamine/HCl, and 0.09% NaCl followed by addition of more 0.25% acetic anhydride for another 10 min). After washing with 2x SSC, the slides were prehybridized for 4 h at 42°C with an RNA hybridization solution (Dako), and then hybridized with 400 µl of fresh solution containing 1 ng/ml of biotinylated probe (heated to 90°C for 3 min and then incubated at 42°C overnight). The slides were then washed twice in 2x SSC followed by a wash in 0.1x SSC at 45°C, and finally developed using the In Situ hybridization detection system K600 (Dako).

RT-PCR

MHC class II+ and MHC class II- thymic stromal cells were prepared by sorting cell suspensions made from 2-dGuo-treated FTOC (10). CD45+ thymocytes were prepared by sorting cells from parallel FTOC not treated with 2-dGuo (16). Total RNA was prepared and resuspended at a concentration equal to 1000 cells/µl. Twenty-five microliters of these RNAs or 10 µg of total RNA from a 2-dGuo-treated thymus were reverse transcribed using Mouse Mammary Tumor Virus reverse transcriptase (Stratagene) in a total volume of 50 µl. 0ne microliter of cDNA product was then amplified for 36 cycles with the DNA polymerase Tag2000 (Stratagene) using TSO-1C12-specific primers (5' primer, nt 787–808, TTGTGCTGAAGGTCCCTGAGTC; and 3' primer, nt 1277–1256, TGTGATCGGAATAAGCGCAAAC). The PCR product obtained with these primers can include a 1.15-kb intron, which allows one to distinguish between genomic and cDNA. The sequences of primers used for the GAPDH controls are GGTGAAGGTCGGTGTGAACGGA for the 5' primer, and TGTTAGTGGGGTCTCGCTCCTG for the 3' primer.

Quantitative competitive PCR

The method was adapted from Scheuerman and Bauer (17) and is described in detail in Ambion’s Technical Report 151 (Austin, TX). Primers F84 (CAGTCTTCCAATAACCTGCTTTGGCCT) and B83 (CGATTCCATGTGCCCCATTG) were used to create a 310bp amplicon from the TSO-1C12 cDNA. The 10% smaller competitor fragment was generated with deletion primer one (GAACACCTGTGCAAGCAGCTCAGAGGCATCTGAGAACTAGG) paired with the F84 fragment and deletion primer two (CCTAGTTCTCAGATGCCTCTGAGCTGCTTGCACAGGTGTTC) paired with the B83 fragment. The same procedure was used to prepare primers specific for mouse cyclophilin. Here the amplicon was a 322-bp fragment generated with F14 (TGTGCCAGGGTGGTGACTTTACACGC) and B15 (TCAAAAGAAATTAGAGCTGTCCACAGTCGG). The deletion consisted of 39 bp and was generated with deletion primer five (CACCTTCCCAAAGACCACATGGCAGATAAAAAACTGGGAACCG) paired with F14 and deletion primer three (CGGTTCCCAGTTTTTTATCTGCCATGTGGTCTTTGGGAAGGTG) paired with B15.

Total RNA (5 µg) of each sample was converted to cDNA with Superscript II (Life Technologies, Gaithersburg, MD) and a mixture of random hexamer and oligo(dT) primers. The cDNA was combined with a complete PCR master mix containing the primers and a series of 2-fold dilutions of the competitor. The PCR was conducted for 30 cycles, the products run on a 10% acrylamide gel, and the point of equivalence determined with an Eagle Eye video system (Stratagene). To control for genomic DNA contamination, samples were run without reverse transcriptase. The data obtained with cyclophilin primers were used for normalization; typically, the correction factor was less than 2-fold.

Biochemistry of the protein

In vitro translation of the protein was performed using 35S-labeled methionine (Amersham, Arlington Heights, IL) and a TNT T3 coupled reticulocyte lysate system (Promega, Madison, WI). Immunoprecipitation was conducted by mixing the radiolabeled protein with 0.5 µg of an antipeptide Ab ± peptide in 500 µl. Protein A-Sepharose CL 4B beads were added for 2 h at 4°C and the eluted supernatant analyzed on 12% gels by SDS-PAGE. Glycosylation was performed by adding a canine microsomal fraction (Promega) to the in vitro translation system. For endoglycosidase H (Endo-H) (New England Biolabs, Beverly, MA) treatments, the radiolabeled glycoproteins were resuspended in 50 mM sodium citrate (pH 5.5) and incubated with 10 units of Endo-H for 1 h at 37°C.

Surface biotinylation was performed using an enhanced chemiluminescence (ECL) biotinylation module (Amersham). Thymic stromal cotransporter (TSCOT+) rat basophilic leukemia cells (107) were washed twice with cold PBS, resuspended in 3 ml of 40 mM bicarbonate buffer, and biotinylated for 30 min at 4°C. The reaction was stopped by washing twice with cold PBS and the cells lysed in 3 ml of lysis buffer (250 mM NaCl, 25 mM Tris-HCl (pH 7.5), 5 mM EDTA (pH 8.0), 1% Nonidet P-40, 2 µg/ml aprotinin, and 100 µg/ml PMSF) for 20 min at 4°C. For immunoprecipitation, the cell lysate was spun (10,000 x g) to remove the nuclei and the remaining extract precleared with a preimmune serum. After separating the immunoprecipitated proteins by SDS-PAGE, the proteins were transferred to a nitrocellulose membrane (Novex, San Diego, CA). Biotinylated proteins were detected by incubation with a Streptavidin-HRP conjugate and a chemiluminescence substrate (Amersham). The protein bands were examined by exposing the membranes to x-ray film for 1–10 min.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
TSO-1C12 is expressed in cortical thymic stromal cells

Fig. 1GoA shows a Northern blot with 2 µg of poly(A)+ RNA isolated from several different tissues of normal mice. TSO-1C12 message was only found in the thymus. Two major mRNA species were observed, a strong band at 2 kb and a weaker one at 4 kb. The expression of both was 10-fold higher in the thymus of SCID mice and RAG2-/- mice, which lack TCR-bearing double-positive and single-positive thymocytes (Fig. 1Go, A and B). Conversely, enrichment was not seen in thymuses from ß2-microglobulin-/-, invariant chain-/-, or IFN-{gamma}-/- mice, which have mostly normal thymocyte numbers. Thymuses from TCR{alpha}-/- mice showed a slight enrichment (Fig. 1GoB). TSO-1C12 mRNA was not detected in five SV40-transformed thymic stromal cell lines (10, 18), five thymic epithelial cell lines derived from p53-/- mice, or a kidney epithelial cell line, even after adding IFN-{gamma} or conditioned medium from a T cell clone (data not shown).



View larger version (107K):
[in this window]
[in a new window]
  		FIGURE 1. The tissue-specific expression of TSO-1C12 detected by Northern blotting. A, Poly(A)+ RNA from different tissues was hybridized with a 0.7-kb TSO-1C12 probe. B, Total RNAs from thymus (T) and spleen (S) of normal, SCID, and RAG2, ß2-microglobulin chain of MHC class I (ß2M), invariant chain of MHC class II molecule (Ii), IFN-{gamma} (GKO), and TCR {alpha}-chain (TCR{alpha}) deficient mice are shown. The signals from a GAPDH probe of the same blot are shown at the bottom.

 
To localize the expression of the TSO-1C12 gene in the thymus, in situ hybridization was employed (Fig. 2Go, A–D). An antisense TSO-1C12 probe stained mainly the cortical areas of the thymus, although there was some scattered staining of cells within the medulla (Fig. 2GoB). The staining was specific because a TSO-1C12 sense probe did not stain the thymus (Fig. 2Go, A and C). Staining of RAG2-/- thymus showed TSO-1C12 expression throughout the organ (Fig. 2GoD). This result is consistent with the enrichment seen in Northern blots and may reflect the fact that the medulla in these mutant mice is underdeveloped (19, 20).



View larger version (73K):
[in this window]
[in a new window]
  		FIGURE 2. The location of TSO-1C12 expression in the thymus. A–D, In situ hybridization of TSO-1C12 on thymic sections (magnification, x100). A and B, Sense and antisense probes on a normal adult thymus section. C and D, Sense and antisense probes on a RAG2-/- adult thymus section. E, RT-PCR of FACS-sorted cells from 2-dGuo-treated FTOC. The amount of RNA used in these reactions was equivalent to the average yield from 500 cells of either MHC class II+ or II- stroma or CD45+ thymocytes. The positive control shows the signal following 36 cycles of PCR from 0.2 µg of total RNA extracted from 2-dGuo-treated FTOC. RT-PCR products for GAPDH are shown at the bottom. F, A Northern blot showing the levels of TSO-1C12 expression during thymic development. The ratio of TSO-1C12 expression (2 kb mRNA) to that of GAPDH in the same sample is shown at the bottom, normalized relative to the signal from adult thymus which is set to one. RNAs were prepared from pools of thymic tissue at different ages before and after birth. The last lane is RNA extracted from a thymocyte cell suspension derived from adult thymus, which shows no detectable signal.

 
To be certain that TSO-1C12 was only expressed in stromal cells, double FACS purification of MHC class II- CD25+ thymocytes (99.3% pure) from RAG2-/- mice was performed. Quantitative RT-PCR on this population revealed a 320-fold depletion of TSO-1C12 mRNA relative to intact RAG2-/- thymus. In contrast, 6-Bq whole body radiation of RAG2-/- mice, which depletes about 95% of the double-negative thymocytes by 24 h, enriched for the expression of TSO-1C12 by 2-fold (data not shown). Finally, MHC class II+ stromal cells (98%) from 2-dGuo-treated fetal thymuses showed a detectable signal after 30 cycles of PCR amplification, whereas MHC class II- stromal cells (98%) and CD45+ thymocytes (99%) did not, even at 36 cycles (Fig. 2GoE). Overall, these observations demonstrate that TSO-1C12 is expressed in MHC class II+ stromal cells and not in the RAG2-/- double-negative thymocyte population. Based on the in situ hybridization results, the most likely cell type to be expressing this gene is the cortical epithelial nurse cell.

TSO-1C12 gene expression pattern during development

Using a quantitative RT-PCR technique, we followed the expression of the TSO-1C12 gene during embryonic development by isolating the RNA of whole fetuses from timed pregnant females at days 9–16 after plug formation (Table IGo). As early as day 9, a very weak signal could be detected in the whole embryo. The amount of TSO-1C12 mRNA began to increase, relative to the level of cyclophilin mRNA (21) beginning at day 13, and peaked at a 125-fold higher level by day 16. In the newborn the message level had dropped 2-fold from that at day 16. The weak signal detected at day 9, before the known existence of thymic stromal cells, suggests that other cells in the embryo are expressing TSO-1C12. A recent Blast search has revealed an expressed sequence tag generated from mouse skin cDNA that matches with the TSO-1C12 sequence. A Northern blot by us of adult skin and intestinal mRNA failed to detect a signal, but a preliminary experiment with day 14 fetal skin did detect the 1C12 message (data not shown). Thus, similar to the nu gene (22, 23, 24), TSO-1C12 might be expressed in both skin and thymus.


View this table:
[in this window]
[in a new window]
  		Table I. TSO-1C12 expression during development

 
Direct examination of the expression in thymuses from fetal, neonatal, and adult mice by Northern blotting (Fig. 2GoF) revealed high levels of TSO-1C12 mRNA at fetal days 13–16. After day 16, when many thymocytes have reached the double-positive stage and the thymic stromal cells have slowed their growth and begun to separate into cortex and medulla (25), the level of TSO-1C12 mRNA begins to decline (relative to GAPDH mRNA). By 2 wk after birth the level had decreased 5-fold. In two other experiments this decline was 2- and 3-fold (data not shown). In contrast, the difference in expression between SCID thymus and normal adult thymus was always greater, 5- to 10-fold (Fig. 1GoA shows 10 fold as quantitated on a PhosphorImager). These observations suggest that the developmental block caused by the SCID mutation results in an enhanced level of expression of the TSO-1C12 message in comparison to expression at a comparable state in development (day 14/15) in the fetus. Overall, these observations suggest that the gene’s primary function is during the early stages of T cell development in both the fetus and the adult.

Cloning of the full-length TSO-1C12 cDNA and the predicted protein structure

Our original TSO-1C12 clone from the PCR-based subtracted cDNA library contained a 0.7-kb insert (16). Using this fragment as a probe, we isolated a full-length cDNA from a library prepared from SCID thymus. The frequency of this cDNA in the library was relatively high (about 1 positive plaque out of 1000). Most of the clones sequenced contained a 2.0-kb insert with a single open reading frame (GenBank accession no. AF148145). This reading frame encodes a 479-aa protein with an estimated molecular mass of 52 kDa, starting from the putative ATG initiation codon at nucleotide position 108 and ending with a stop codon at position 1547 (Fig. 3GoA). The 3' untranslated region is 422 nt long and contains an unconventional poly(A)+ addition signal. This cDNA sequence has recently been verified by genomic sequencing.



View larger version (54K):
[in this window]
[in a new window]
  		FIGURE 3. Sequence analysis and modeling of the protein. A, Nucleotide and deduced amino acid sequence of the full-length TSO-1C12 clone from pBK1C12.35a. The nucleotide sequence was translated using a program published in the Genetic Computer Group (GCG, Madison, WI) package (Wisconsin Sequence Analysis Package, version 8). TM regions predicted by the TopPredII program are underlined. The one "putative" TM region is indicated with a dashed line. B, Prediction of the TM topology by the TopPredII program. The indicator lines for the probability levels of "certain" and "putative" TM regions are shown with arrows. C, A working model for the structure of the TSCOT protein. Two glycosylation sites (N57 and N61) are indicated in the first external loop. The first weak TM region is striped and the regions used to make the antipeptide Abs (loop peptide 251–267, and C-terminal peptide 465–479) are indicated by shaded boxes.

 
The predicted protein from the translation of the open reading frame is extremely hydrophobic. Almost half (48%) of the amino acids are nonpolar and 85% are noncharged. Using the TopPredII program (26), the predicted membrane topology was found to match that of a type III membrane protein, with more than one transmembrane (TM) region. There appear to be 11 certain and one putative TM domains (Fig. 3GoB). The weak TM domain is located near the N terminus of the molecule. There are many examples of transporter proteins that possess 12 TM regions in which the first TM domain is not strongly predicted to insert into the membrane. In some cases this domain acts as a leader sequence and is cleaved after successful integration of the protein into the membrane (reviewed in Ref. 27).

Based on these topological predictions, as well as other predicted structural features (27, 28), a model for the TSO-1C12-encoded protein (TSCOT) is shown in Fig. 3GoC. The protein contains two potential glycosylation sites in the first predicted extracellular loop at amino acid positions Asn57 and Asn61. The predicted N-terminal and C-terminal ends both reside inside of the plasma membrane, and there is a major cytoplasmic loop predicted in the middle of the protein (aa 228–285). These structural features are also found in the family of Na+/Ca2+ cotransporters among the known mammalian transporter families (29). The primary sequence of the protein, however, does not have similarity to any of the known mammalian transporters (Fig. 3GoA). TSCOT also lacks an ATP binding motif, a conserved amino acid sequence that is a prominent feature of ATP-dependent pump proteins with 12 TM spanning regions. The closest match to the primary amino acid sequence in the protein data base is the bacterial tetracycline antiporter, which showed 25% identity at the amino acid level (probability of mismatch = 5.1 x e-7). The homologous regions are spread over the entire protein and mostly reside in the TM regions. The longest stretch of amino acid identity is seven residues. The homology to a bacterial antiporter as well as the structural conservation with the mammalian cotransporters suggests that TSCOT may be a member of a new family of 12 TM spanning transporters.

Biochemical characterization of the TSCOT protein

To investigate the physical nature of the protein, we first produced it by in vitro transcription and translation, labeling the protein with [35S]methionine. As shown in Fig. 4GoA, the recombinant protein, translated from three different constructs using two eukaryotic expression promotor/enhancers or an excised clone from the {lambda} library, migrated with an apparent molecular mass of 45 kDa in reduced SDS-PAGE. This is 7 kDa less than the predicted mass from the cDNA sequence. A construct with a sequence tag at the C-terminal end of the protein showed a slightly slower migration in the gel, indicating that the protein was fully translated to the end of the coding region. The pBK1C12.35a plasmid, which is entirely sequenced, showed exactly the same migration pattern as the eukaryotic expression construct pBKCMV1C12. This indicates that the abnormal migration of the protein is not a cloning artifact that led to the production of a truncated protein. When the sample was boiled before electrophoretic separation, the protein migrated even faster, (Fig. 4GoB, second lane). Furthermore, the protein tended to aggregate when stored in the cold or in a urea containing solution (data not shown). We think that these anomalies are due to the very hydrophobic nature of the protein. Similar gel migration anomalies have been noticed for many integral membrane proteins containing a high percentage of nonpolar residues. For example, lactose permease migrates with an apparent molecular mass of 33 kDa on SDS-PAGE, whereas its calculated molecular mass is 46 kDa (30). The physical explanation for this is thought to be an effect on mobility resulting from either an excess number of SDS molecules binding to the hydrophobic portions of the protein or to an incomplete unfolding of the protein (31).



View larger version (55K):
[in this window]
[in a new window]
  		FIGURE 4. Biochemical characterization of the TSCOT protein. A, SDS-PAGE of the recombinant protein generated by in vitro transcription and translation using different constructs. pBKCMV1C12, TSO-1C12 cDNA under the control of a eukaryotic promotor. pBKCMV1C12Flag, the same construct with an in frame FLAG (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) sequence at the C-terminal end. pBK1C12.35a, a full-length cDNA clone isolated from the SCID library. All were transcribed with T3 RNA polymerase. Note that the flag-tagged protein (open arrow) migrated slightly slower than the other two untagged proteins (filled arrow). B, Immunoprecipitation of the recombinant protein. The first two lanes are in vitro-translated proteins without immunoprecipitation. Immunoprecipitation with the preimmune serum, the immune serum, or affinity-purified, antipeptide Abs are shown on the right. Boiling the samples before electrophoresis increased the mobility of the protein (open arrow) compared with that of unboiled samples (filled arrow). C, Peptide competition of the immunoprecipitation. The amount (nM) of the peptide competitor (loop 251–267 or C-terminal 465–479) used in each immunoprecipitation reaction is shown on the top of each lane. D, In vitro glycosylation and deglycosylation of the protein. The glycosylated form of the protein made in the presence of the microsomal fraction is indicated with the open arrowhead. Endo-H was added to one sample to remove N-linked oligosaccharides before SDS-PAGE. E, The cell surface biotinylation of the protein expressed in rat basophilic leukemia cells by stable transfection. Biotinylated proteins on the cell surface were immunoprecipitated with antiloop or anti-C-terminal peptide Abs and detected by an enhanced chemiluminescent method using streptavidin-HRP. The control vector and the pBKCMV1C12 construct used for transfection are indicated on the top.

 
We next prepared two antisera against peptides that reside in the putative hydrophilic cytoplasmic portion of the protein, as indicated in Fig. 3GoC, and used them to immunoprecipitate the in vitro translated protein. Both of the affinity-purified, antipeptide Abs immunoprecipitated a protein running at 45 kDa, or slightly faster when the samples were boiled (Fig. 4GoB). The preimmune serum did not immunoprecipitate this protein and the immunoprecipitation was selectively inhibited if the specific peptide was added into the reaction mixture, i.e., the loop peptide inhibited precipitation with the antiloop antisera, but not precipitation with the anti-C-terminal antisera, and vice versa for the C-terminal peptide (Fig. 4GoC).

The potential of the protein to be glycosylated was tested in the translation reaction by including a canine microsomal fraction (Fig. 4GoD). This addition generated a larger band with an apparent molecular size of 52 kDa. This band was reduced back down to the original 45-kDa size by Endo-H treatment. These results indicate that the molecule is a glycoprotein.

Finally, we asked whether the protein could be found on the cell surface. A rat basophilic leukemia cell line was stably transfected with the eukaryotic expression construct pBKCMV1C12Flag, which was shown to produce protein in the in vitro translation system (Fig. 4GoA). The surface proteins of this cell were biotinylated and immunoprecipitated after cell lysis with Abs against either the loop or C-terminal peptides (Fig. 4GoE). Reaction with enzyme-conjugated streptavidin revealed two bands on SDS-PAGE gels under reducing conditions, with apparent molecular masses of 65 and 58 kDa. The larger masses compared with the in vitro-translated protein might be related to the presence of N-linked carbohydrates. The two bands could represent differential glycosylation states as the cDNA predicts two N-linked carbohydrate addition sites that are located very close to one another. Alternatively, the protein may have another form of posttranslational modification or be bound to another molecule whose association is stable in SDS-PAGE. Still another possibility is that a second protein co-associates only on the cell surface, where it would be biotinylated and then coprecipitated with TSCOT (32).

Protein expression in the adult thymus and in primary thymic stromal cell lines

TSCOT protein was detected in normal tissues by using the antiloop peptide Ab to stain permeablized paraffin sections of the thymus (Fig. 5Go, A–D). Expression was observed at low magnification mostly in the cortical area (Fig. 5GoB), similar to what was observed for the mRNA by in situ hybridization (Fig. 2GoB). At higher magnification of the cortex a typical thymic stromal staining pattern was observed (Fig. 5GoD). Anti-C-terminal Ab showed the same pattern (data not shown). When no Ab or a normal rabbit IgG fraction was used in place of the primary Ab, there was no staining in consecutive serial sections (Fig. 5Go, A and C, and data not shown).



View larger version (94K):
[in this window]
[in a new window]
  		FIGURE 5. TSCOT protein expression in the thymic cortex of normal adult thymus and in primary thymic stromal cell cultures. A–D, Antiloop peptide staining pattern in paraffin sections of a normal adult thymic lobe. A, Negative control with only secondary Ab staining (x100); B, antiloop peptide staining (x100); C and D, higher magnification (x630) of the same section. E–H, Staining pattern of isolated thymic stromal cells from 2-dGuo-treated thymic rudiments. E, secondary anti-rabbit HRP conjugate without the first Ab; F, antiloop peptide as first Ab; G, normal rabbit IgG as first Ab; and H, anti-C-terminal peptide as the first Ab.

 
Both antipeptide Abs were also used to stain primary thymic stromal cell cultures. Positive staining was observed with either antiloop (Fig. 5GoF) or anti-C-terminal Ab (Fig. 5GoH) in only a fraction of the stromal cells. Control experiments with normal rabbit IgG or no Ab as the first reagent showed no staining (Fig. 5Go, E and G). These results suggest that only a subpopulation of thymic stromal cells express TSCOT; however, the possibility that some of the stromal cells lost their ability to express the protein during the culture period has not been ruled out. Overall, these experiments show that the TSCOT protein is normally expressed in the cortical stromal cells of the thymus.

In conclusion, our analysis shows that TSCOT is a hydrophobic plasma membrane glycoprotein expressed on cortical epithelial cells in the thymus. The topology prediction programs suggest that it has 12 TM domains and other structural features resembling members of the cation cotransporter family. Although TSCOT is only very distantly related to any of the known proteins in this superfamily, it is well known that proteins carrying out a single type of transporter function do not necessarily exhibit homology at the primary amino acid sequence level, even though they have similar secondary and tertiary structures (27, 33). Preliminary experiments undertaken to try and use the TSCOT protein to complement the tetracycline transporting function in a D(+)-arabinose-inducible pBAD expression system were negative (data not shown). Thus, at this point in time, we have no experimental evidence that TSCOT actually has any transporter function.

It is well known that proteins in the transporter families in higher organisms are involved in the energization of nutrient capture and waste efflux in a tissue-specific manner (33). In addition, transporter families play important roles in antibiotic resistance, toxin secretion, and ion balance. These actions are all directly related to critical survival functions at the cell or organismal level. Therefore, we suspect that TSCOT may primarily function for homeostasis of the thymic microenvironment, possibly by providing optimal conditions for the differentiation of early thymocytes. TSCOT might do so by providing yet-to-be identified molecules to thymocytes for their survival or by bringing nutrients to the stromal cells themselves for a self-supporting function. Future work will focus on developing tools to study the function of the protein in the thymus. Approaches will include gene targeting, stromal cell ablation, and mAb production.


   Acknowledgments
 
We thank Drs. Ronald Germain and John Ashwell for critically reading this manuscript. We also thank members of the Laboratory of Cellular and Molecular Immunology for discussions and encouragement on this project.


   Footnotes
 
1 Current address: National Creative Research Initiative Center for Genetic Reprogramming, Institute of Molecular Biology and Genetics, Seoul National University, Seoul, Korea. Back

2 Current address: Protein Design and Control Research Unit, Korea Research Institute of Bioscience and Biotechnology, P.O. Box 115, Yusong, Taejon 305-600, Korea. Back

3 Address correspondence and reprint requests to Dr. Ronald H. Schwartz, Building 4, Room 111, Laboratory of Cellular and Molecular Immunology, National Institutes of Health, Bethesda MD, 20892-0420. E-mail address: Back

4 Abbreviations used in this paper: FTOC, fetal thymic organ culture; 2-dGuo, 2-deoxyguanosine; RAG, recombinase activating gene; TM, transmembrane; Endo-H, endoglycosidase H; TSO, thymic stromal origin; TSCOT, thymic stromal cotransporter. Back

Received for publication October 1, 1999. Accepted for publication January 5, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Boyd, R. L., P. Hugo. 1991. Towards an integrated view of thymopoiesis. Immunol. Today 12:71.[Medline]
  2. Anderson, G., N. C. Moore, J. J. Owen, E. J. Jenkinson. 1996. Cellular interactions in thymocyte development. Annu. Rev. Immunol. 14:73.[Medline]
  3. Nehls, M., D. Pfeifer, M. Schorpp, H. Hedrich, T. Boehm. 1994. New member of the winged-helix protein family disrupted in mouse and rat nude mutations. Nature 372:103.[Medline]
  4. Boehm, T., M. Nehls, B. Kyewski. 1995. Transcription factors that control development of the thymic microenvironment. Immunol. Today 16:555.[Medline]
  5. Nehls, M., B. Kyewski, M. Messerle, R. Waldschutz, K. Schuddekopf, A. J. Smith, T. Boehm. 1996. Two genetically separable steps in the differentiation of thymic epithelium. Science 272:886.[Abstract]
  6. Van Ewijk, W., Y. Ron, J. Monaco, J. Kappler, P. Marrack, M. Le Meur, P. Gerlinger, B. Durand, C. Benoist, D. Mathis. 1988. Compartmentalization of MHC class II gene expression in transgenic mice. Cell 53:357.[Medline]
  7. Laufer, T. M., J. DeKoning, J. S. Markowitz, D. Lo, L. H. Glimcher. 1996. Unopposed positive selection and autoreactivity in mice expressing class II MHC only on thymic cortex. Nature 383:81.[Medline]
  8. Perumal, N. B., Jr T. W. Kenniston, D. J. Tweardy, K. F. Dyer, R. Hoffman, J. Peschon, P. M. Appasamy. 1997. TCR-{gamma} genes are rearranged but not transcribed in IL-7R{alpha}-deficient mice. J. Immunol. 158:5744.[Abstract]
  9. von Freeden-Jeffry, U., N. Solvason, M. Howard, R. Murray. 1997. The earliest T lineage-committed cells depend on IL-7 for Bcl-2 expression and normal cell cycle progression. Immunity 7:147.[Medline]
  10. Kim, M. G., C. Chen, F. A. Flomerfelt, R. N. Germain, R. H. Schwartz. 1998. A subtractive PCR-based cDNA library made from fetal thymic stromal cells. J. Immunol. Methods 213:169.[Medline]
  11. Shinkai, Y., G. Rathbun, K. P. Lam, E. M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. M. Stall, F. W. Alt. 1992. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68:855.[Medline]
  12. Zijlstra, M., E. Li, F. Sajjadi, S. Subramani, R. Jaenisch. 1989. Germ-line transmission of a disrupted ß2-microglobulin gene produced by homologous recombination in embryonic stem cells. Nature 342:435.[Medline]
  13. Bikoff, E. K., L. Y. Huang, V. Episkopou, J. van Meerwijk, R. N. Germain, E. J. Robertson. 1993. Defective major histocompatibility complex class II assembly, transport, peptide acquisition, and CD4+ T cell selection in mice lacking invariant chain expression. J. Exp. Med. 177:1699.[Abstract/Free Full Text]
  14. Dalton, D. K., S. Pitts-Meek, S. Keshav, I. S. Figari, A. Bradley, T. A. Stewart. 1993. Multiple defects of immune cell function in mice with disrupted interferon-{gamma} genes. Science 259:1739.[Abstract/Free Full Text]
  15. Mombaerts, P., A. R. Clarke, M. A. Rudnicki, J. Iacomini, S. Itohara, J. J. Lafaille, L. Wang, Y. Ichikawa, R. Jaenisch, M. L. Hooper, S. Tonegawa. 1992. Mutations in T-cell antigen receptor genes {alpha} and ß block thymocyte development at different stages. Nature 360:225.[Medline]
  16. Kim, M. G., C. Chen, M. S. Lyu, E. G. Cho, D. Park, C. Kozak, R. H. Schwartz. 1999. Cloning and chromosomal mapping of a gene isolated from thymic stromal cells encoding a new mouse type II membrane serine protease, epithin, containing four LDL receptor modules and two CUB domains. Immunogenetics 49:420.[Medline]
  17. Scheuerman, R. H., S. R. Bauer. 1993. Polymerase Chain Reaction-Based mRNA Quantification Using an Internal Standard: Analysis of Oncogene Expression Academic Press, Inc, New York.
  18. Faas, S. J., J. L. Rothstein, B. L. Kreider, G. Rovera, B. B. Knowles. 1993. Phenotypically diverse mouse thymic stromal cell lines which induce proliferation and differentiation of hematopoietic cells. Eur. J. Immunol. 23:1201.[Medline]
  19. Shores, E. W., W. Van Ewijk, A. Singer. 1991. Disorganization and restoration of thymic medullary epithelial cells in T cell receptor-negative scid mice: evidence that receptor-bearing lymphocytes influence maturation of the thymic microenvironment. Eur. J. Immunol. 21:1657.[Medline]
  20. Shores, E. W., W. Van Ewijk, A. Singer. 1994. Maturation of medullary thymic epithelium requires thymocytes expressing fully assembled CD3-TCR complexes. Int. Immunol. 6:1393.[Abstract/Free Full Text]
  21. Hasel, K. W., J. G. Sutcliffe. 1990. Nucleotide sequence of a cDNA coding for mouse cyclophilin. Nucleic Acids Res. 18:4019.[Free Full Text]
  22. Blackburn, C. C., C. L. Augustine, R. Li, R. P. Harvey, M. A. Malin, R. L. Boyd, J. F. Miller, G. Morahan. 1996. The nu gene acts cell-autonomously and is required for differentiation of thymic epithelial progenitors. Proc. Natl. Acad. Sci. USA 93:5742.[Abstract/Free Full Text]
  23. Brissette, J. L., J. Li, J. Kamimura, D. Lee, G. P. Dotto. 1996. The product of the mouse nude locus, Whn, regulates the balance between epithelial cell growth and differentiation. Genes Dev. 10:2212.[Abstract/Free Full Text]
  24. Schlake, T., M. Schorpp, M. Nehls, T. Boehm. 1997. The nude gene encodes a sequence-specific DNA binding protein with homologs in organisms that lack an anticipatory immune system. Proc. Natl. Acad. Sci. USA 94:3842.[Abstract/Free Full Text]
  25. Anderson, K. L., N. C. Moore, D. E. McLoughlin, E. J. Jenkinson, J. J. Owen. 1998. Studies on thymic epithelial cells in vitro. Dev. Comp. Immunol. 22:367.[Medline]
  26. Claros, M. G., G. von Heijne. 1994. TopPred II: an improved software for membrane protein structure predictions. Comput. Appl. Biosci. 10:685.[Free Full Text]
  27. Reithmeier, R. A. F.. 1995. Characterization and modeling of membrane protein using sequence analysis. Curr. Opin. Struct. Biol. 5:491.[Medline]
  28. von Heijne, G.. 1994. Membrane proteins: from sequence to structure. Annu. Rev. Biophys. Biomol. Struct. 23:167.[Medline]
  29. Reithmeier, R. A. F.. 1994. Mammalian exchangers and co-transporters. Curr. Opin. Cell Biol. 6:583.[Medline]
  30. Buchel, D. E., B. Gronenborn, B. Muller-Hill. 1980. Sequence of the lactose permease gene. Nature 283:541.[Medline]
  31. Gennis, R. B.. 1989. Characterization and structural principles of membrane proteins. , ed. Biomembranes, Molecular Strucutre and Function 91. Springer-Verlag, New York.
  32. Mastroberardino, L., B. Spindler, R. Pfeiffer, P. J. Skelly, J. Loffing, C. B. Shoemaker, F. Verrey. 1998. Amino-acid transport by heterodimers of 4F2hc/CD98 and members of a permease family. Nature 395:288.[Medline]
  33. Griffith, J. K., C. E. Sansom. 1998. The Transporter Facts Book Academic Press, San Diego.



This article has been cited by other articles:


Home page
 Hum Mol GenetHome page
M. T. Engelmark, E. L. Ivansson, J. J. Magnusson, I. M. Gustavsson, A. H. Beskow, P. K.E. Magnusson, and U. B. Gyllensten
Identification of susceptibility loci for cervical carcinoma by genome scan of affected sib-pairs
Hum. Mol. Genet., November 15, 2006; 15(22): 3351 - 3360.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. Puthier, F. Joly, M. Irla, M. Saade, G. Victorero, B. Loriod, and C. Nguyen
A General Survey of Thymocyte Differentiation by Transcriptional Analysis of Knockout Mouse Models
J. Immunol., November 15, 2004; 173(10): 6109 - 6118.
[Abstract] [Full Text] [PDF]

Home page
 J AndrolHome page
H. Obermann, A. Wingbermuhle, S. Munz, and C. Kirchhoff
A Putative 12-Transmembrane Domain Cotransporter Associated With Apical Membranes of the Epididymal Duct
J Androl, July 1, 2003; 24(4): 542 - 556.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
C. Kirchhoff
The dog as a model to study human epididymal function at a molecular level
Mol. Hum. Reprod., August 1, 2002; 8(8): 695 - 701.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, M. G.
Right arrow Articles by Schwartz, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, M. G.
Right arrow Articles by Schwartz, R. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS