|
|
||||||||






*
Laboratoire de Recherche sur le Cancer et les Maladies du Sang, Luxembourg, Luxembourg;
Department of Internal Medicine, Innsbruck University Hospital, Innsbruck, Austria;
Department of Immunology and Allergology, Centre Hospitalier, Luxembourg, Luxembourg;
§
Institute for Biochemistry, University of Innsbruck, Innsbruck, Austria;
¶
Department of Hematology/Oncology, University of Leipzig, Leipzig, Germany; and
||
Institute for Anthropology and Human Genetics, Munich, Germany
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
9 kb centromeric of the TNF-
gene
(TNFA), and it is flanked telomerically at a distance of 4
kb by LTB, which codes for lymphotoxin ß and forms a
heterotrimer with TNF-ß (2, 5). Centromerically, the
LST1 gene is flanked by the 1C7 gene which is
located immediately adjacent to LST1, encoded by the opposite DNA
strand such that the 3' ends of the two mRNA templates come within a
few bases of overlapping (6). Several polymorphisms have
been identified thus far within the LST1 gene: intron 4
encompasses the polymorphic microsatellites TNFd and TNFe; and a
polymorphic PvuII site is located downstream of the LST1
polyadenylation signal that is linked to 1C7 (2, 7, 8). The d3 allele of TNFd has been associated with severe grade
acute graft-vs-host disease in HLA-identical sibling transplants,
whereas TNFd4 was negatively associated with rejection of renal
transplants, implicating a role of LST1 in the immune response
(9, 10).
Northern blot analysis has shown constitutive expression of the LST1
cDNA in T cells, macrophages, and U937 cells and strong induction of
transcription by stimulation of monocytic cell lines with IFN-
(2). Transcription was also detected in human tonsil,
lung, and placenta, the liver cell lines Hep G2 and Hep 3B, and by
means of expression-tagged sequences in fetal liver/spleen and adult
brain. Because the hybridization signal of
800 nucleotides is very
broad in the Northern blot analysis, a variation in length of the LST1
mRNA has been suspected. In fact, previous studies have identified four
protein-encoding exons and five alternative noncoding exons 1 leading
to eight different transcripts expressed in various cell lines which
encode five different proteins (2, 11).
To characterize the complex LST1 expression pattern, we analyzed LST1 transcription and protein expression in freshly isolated PBMC, T cells, and B cells and after incubation of these cells with various cytokines. We describe essential parts of the biological function of two LST1 protein isoforms representing the two groups of LST1 polypeptides.
| Materials and Methods |
|---|
|
|
|---|
PBMC were isolated from buffy coats of healthy volunteer donors by density gradient centrifugation on Lymphoprep (Nycomed, Oslo, Norway). T cells, monocytes, and B cells were separated from PBMC by positive selection with the immunomagnetic bead system using the respective Dynabeads M-450 (CD4), M-450 (CD8), M-450 (CD14), and M-450 (CD19) (Dynal, Oslo, Norway) as described previously (12, 13, 14). After selection, the cells were treated with Detachabeads (Dynal) to remove the CD4, CD8, and CD19 Abs from the membrane receptors (15). The purities of the recovered cells were 98% for CD4+ cells, 99% for CD8+ cells, 99.6% for CD19+ cells, and 8090% for CD14+ cells.
Culture of dendritic cells
Dendritic cells were generated from PBMC as described
(16, 17, 18). Briefly, mononuclear cells were isolated from
leukocyte-enriched buffy coats by standard density gradient
centrifugation on Ficoll-Paque (Pharmacia, Uppsala, Sweden) and
resuspended in complete medium (Biological Industries, Beth Haemek,
Israel; RPMI 1640 supplemented with 10% heat-inactivated FCS (30 min,
56°C), 50 U/ml penicillin, 50 µg/ml streptomycin, 2.5 µg/ml
Fungizone, 2 mM L-glutamine, 10 mM HEPES, 0.1 mM
nonessential amino acids, 1 mM pyruvate, and 5 x
10-5 M 2-ME), and 5.0 x
107 PBMCs were allowed to adhere in
75-cm2 cell culture flasks (2 h, 37°C).
Nonadherent cells were removed, and the adherent fraction of the
mononuclear cells was allowed to detach during overnight incubation in
complete medium in the absence of exogenous cytokines. These cells were
replated at high cell density (5 x 106
cells/ml) resulting in rapid readherence. Nonadherent cells were again
removed, and an equal amount of medium containing 1000 U/ml of each
GM-CSF and IL-4 was added. Dendritic cells were developed under
essentially endotoxin-free conditions as indicated by the absence of
spontaneous TNF-
production (<5 pg/ml TNF-
per 5 x
105 dendritic cells). On day 2, 5 ml of fresh
medium containing 1000 U/ml of GM-CSF and IL-4 were added. After 5 days
of culture, cells were harvested. These dendritic cells were immature
and thus lacked CD83. However, they expressed all markers
characteristic of dendritic cells (forward/side scatter properties,
high levels of MHC class I and II, CD40, CD54, CD58 as well as absence
of CD14) (16, 17, 18).
Cell stimulation
After cell isolation, a fraction of the cells was directly lysed in Trizol (Life Technologies, Paisley, U.K.) for further RT-PCR analysis, and the remaining PBMC, monocytic or lymphatic cells were incubated in McCoys 5A (modified) medium (Life Technologies) with 50 µmol/ml 2-ME, 5 x 10-3 U/ml insulin, and 20% heat-inactivated FCS with or without addition of the indicated stimulating agents.
The following recombinant human cytokines were used in the
concentrations indicated: IL-3 (Novartis, Basel, Switzerland), 25
ng/ml; IL-4 (Schering-Plough, Madison, NJ), 100 ng/ml; G-CSF (Roche,
Basel, Switzerland), 100 U/ml; GM-CSF (Novartis), 100 ng/ml;
thrombopoietin (TPO) (Genentech, South San Francisco, CA), 50 ng/ml;
IFN-
(Bender, Vienna, Austria), 200 U/ml. Further stimulating agents
were: PHA (Difco Bacto, Detroit, MI), 0.02%; LPS
(Escherichia serotype 0111:B4; Sigma, Darmstadt, Germany),
50 ng/ml.
RNA isolation and RT-PCR
With the use of Trizol, total RNA samples were prepared from
cells at each time indicated, according to the manufacturers
instructions. To remove traces of contaminating DNA, 2 µg of total
RNA were digested with 1 IU DNase (Promega, Madison, WI) for 1 h,
phenolized, and precipitated as described previously (19).
One reverse transcription reaction for every cell stimulation was
performed with 2 µg RNA using avian myeloblastosis virus reverse
transcriptase, oligo(dT)15, and RNasin (all
purchased from Promega) for 1 h at 37°C (19). The
revealed cDNA was used for all PCR amplifications of the respective
cell stimulations and control amplifications with G3PDH-specific
oligonucleotides (Clontech, Palo Alto, CA) using the sense primer
5'-TGAAGGTCGGAGTCAACGGATTTGGT-3' and antisense primer
5'-CATGTGGGCCATGAGGTCCACCAC-3' of the cDNA and of DNase-treated not
reverse transcribed RNA were performed. LST1 transcripts were amplified
with the oligomers 5'-plst1 5-'ATGAGGAACTTGAGGCAAGTC-3' encoded in
exon 2 (nucleotides 10011021, Fig. 1
)
and 3'-plst1 5'-TCTCAGCAATGCAGGCATAGTC-3' in exon 5 (nucleotides
24572446). For the PCR reaction mixtures, 80 ng reverse transcribed
RNA were used in 25 µl PCR buffer containing 1 µM concentrations of
each primer, 0.25 mM dNTP (Sigma, Vienna, Austria), and 1 IU
Taq polymerase (Boehringer Mannheim, Vienna, Austria). After
an initial step of denaturation (5 min at 94°C), 35 PCR cycles were
performed (1 min at 94°C, 1 min at 56°C, 2 min at 72°C) followed
by a final extension of 10 min at 72°C. PCR products were loaded on a
2% agarose gel together with a PCR m.w. marker (United States
Biologicals, Cleveland, OH) and photographed.
|
To analyze the splice transcripts expressed in freshly isolated monocytes, we subcloned 2.5 µl of the RT-PCR product that was revealed through amplification of reverse transcribed mRNA from freshly isolated monocytes with the oligonucleotides 5'-plst1 and 3'-plst1 into the TA cloning vector pCR II (Invitrogen, Leek, The Netherlands). The ligation product was transfected into INVa F' bacteria (Invitrogen) following the manufacturers recommendations.
DNA sequencing and data analysis
Plasmid DNA was prepared according to standard protocols, and DNA sequencing was conducted by the dideoxynucleotide chain termination method using either the PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Weiterstadt, Germany) with the Applied Biosystems DNA Sequencing System Model 373A or the Thermo Sequenase fluorescence-labeled primer cycle sequencing with 7-DEACA-DGTT (Amersham, Vienna, Austria) with the Li-Cor 4000L Sequencing System. Sequencing primers were the universal and reverse M13 primers. DNA sequences were analyzed with MacMolly software (Soft Gene, Bocholt, Germany)
Production of a polyclonal rabbit LST1 Ab
The 3' end of the cDNA clone LST1/C (Fig. 3
), which is expressed
in U937 cells (2) and spans exon 2, 3, and 5, was
amplified with the primer open reading frame 6 (ORF6) 5'-ACT
AGATCTTCCGCCTGCCTGTGTT3' containing a BglII
restriction site (underlined) and the 3'-primer ORF4
5'-ACTAAGCTTGTGGGGGGACCATGG3' introducing a
HindIII site (underlined). The BglII- and
HindIII-restricted amplification product that encompasses
exon 5 and the region 3'-terminal of the transmembrane region of exon 3
were cloned into the respective cloning sites of the expression vector
pQE-40, which contains a 6x His affinity tag at the N terminus as well
as the N-terminal mouse dihydrofolate reductase (DHFR) carrier protein
(Fig. 1
) (Qiagen, Hilden, Germany). This construct fused the 4.1-kDa
LST1/C protein encoding the extracytoplasmic region of the 6.8-kDa
LST1/C polypeptide (Fig. 4
A) to the 24.5-kDa DHFR carrier
protein, resulting in expression of a soluble
LST1/C-DHFR fusion
protein with a histidine affinity tag. The expression vector pQE-30 was
used to generate the
LST1/A clone (spans the 3'-end of exon 3, exon
4, and 5') by cloning it into the BamHI site of pQE-30,
enabling the purification of the 8-kDa extracytoplasmic region of the
LST1/A protein(10.8 kDa). The control vector pQE-16
(Qiagen) was used for expression of the 24.5-kDa DHFR control protein
(Fig. 1
). The K-12-derived Escherichia coli strain
M15[pREP4] was used for high level expression of the proteins
LST1/C-DHFR,
LST1/A, and DHFR.
|
|
LST1/C-DHFR protein using Freunds adjuvant. The rabbits were
injected s.c. on days 0, 28, 56, and 70 with a protein solution
containing 880 µg/ml
LST1/C-DHFR. The polyclonal Abs received on
day 85 were purified on a protein A column, and only the Ab LST125
was used for further analyses. This protein A purified Ab did not
detect
LST1/A in Western blot analyses (Fig. 4
LST1/C-specific Abs could pass the column.
After a 3-fold passage of the Ab solution through the DHFR column, we
recovered the
LST1/C-specific Ab LST125-Affi which did not detect
the DHFR protein as well as
LST1/A in Western blot analysis.
The expression vector pQE-30 was used to express the
1 domain (exon
2) of HLA-G with a 6x His N-terminal affinity tag. The purified
recombinant His-tagged
1 polypeptide was used to immunize a rabbit
as described above. The antiserum raised did not recognize native HLA-G
or class I molecules expressed on the cell surface but stained HLA
class I heavy chains only in Western blot analyses. Because HLA-G is
not recognized on the cell surface of U937, Molt-4, and THP-1 cells
with this rabbit antiserum, it was used as control Ab in our
experiments (Fig. 5
).
|
All functional assays with the LST1 proteins described in this
work were conducted with solubilized proteins. For solubilization of
the LST1 proteins
LST1/C-DHFR, DHFR, and
LST1/A, a single-step
purification/refolding procedure based on modification of existing
solid phase solubilization procedures was performed (20).
Briefly, the pellet from 1 liter bacterial expression culture was lysed
in 50 ml lysis buffer (6 M guanidine, 20 mM Tris-HCl (pH 7.9), 500 mM
NaCl, 4 mM octylglucoside), sonicated, and centrifuged at 20,000
x g for 30 min. The Ni-NTA agarose column was equilibrated
with the lysis buffer and the supernatant was applied to the column.
After a washing with 50 ml buffer 2 (6 M urea, 20 mM Tris-HCl (pH 7.9),
500 mM NaCl, 20 mM imidazole), the protein was eluted with buffer 2
containing 50 mM EDTA.
Flow cytometric measurement of surface Ag expression
To determine surface LST1 expression, cells (510 x
105) were suspended in FACS buffer (PBS
containing 1% BSA), labeled with the protein A-purified primary Ab
LST125 (see above) for 30 min at 4°C followed by a second labeling
step with PE-conjugated Fab fragments of a goat anti-rabbit Ig
(Southern Biotechnology, Birmingham, AL). In parallel, a single
labeling without the primary Ab was performed as control as well as a
two-step labeling with a rabbit Ig control as primary Ab. It was raised
against the recombinant
1 sequence of HLA-G expressed in the
expression vector pQE-30 containing a 6x His N-terminal affinity tag.
Because HLA-G is not recognized on the cell surface of U937, Molt-4,
and THP-1 cells with this rabbit antiserum, this primary Ab was used as
control Ab in our experiments. Labeling of the cells with this Ab was
followed by staining with the secondary anti-rabbit Ab used in all
of our experiments.
All positive results were controlled with the LST125-Affi Ab as primary Ab. The following FITC-conjugated murine mAbs (Becton Dickinson, Mountain View, CA) were utilized in a third labeling step: Leu2/CD8, Leu-3/CD4, Leu-12/CD19, and Leu-M3/CD14. After each incubation, cells were washed in FACS buffer and then analyzed after three final washings. To determine cell purities, the same respective FITC-conjugated mAbs were used.
Lymphocyte proliferation assay after stimulation with PHA and candidin
PBMC were isolated on Lymphoprep as described. Cells were
resuspended in RPMI 1640 medium containing 1% L-glutamine
(ICN, Asserelegem, Belgium), 1% penicillin/streptomycin (Sigma,
Bornem, Belgium), and 10% autologous (assays 1 and 2) or pooled human
AB serum (ICN) in assays 35. Triplicate cultures were set up in a
200-µl volume in 96-well round-bottom plates (Nunc, Mereldeke,
Belgium) at a concentration of 5 x 105
cells/ml. Cultures were incubated either in medium alone or with
optimally stimulating doses of PHA (1/100 dilution of reconstituted
Bactohemagglutinin P (Difco Bacto)) or 50 µg/ml candidin
(Stallergènes, Fresnes, France) as a control. To evaluate an
immunomodulatory activity of the LST1 variants, 550 ng of the
renaturated proteins
LST1/C-DHFR,
LST1/A, DHFR, or the buffer
used for elution of these proteins from the Ni-NTA column as negative
control were added either to medium alone, or together with PHA or
candidin at the onset of triplicate cultures. After incubation for 6
days in a humidified 5% CO2, 95%
air atmosphere, DNA synthesis was measured by adding 0.5 µCi
[3H]thymidine (4060 Ci/mmol; Amersham,
Arlington Heights, IL) during the final 12 h of culture. Cells
were harvested with a semiautomatic cell harvester, and thymidine
incorporation was assayed in a liquid scintillation counter (Beckmann
LS 1801, Galway, Ireland). Proliferation is given as the mean of
triplicates ± SE.
Mixed leukocyte reaction
Proliferative responses of PBMC to allogeneic stimulation were
determined in one-way MLR, as described (21). Briefly,
5 x 104 responder PBMC were cocultured with
5 x 104 mitomycin C-treated (Sigma, St.
Louis, MO) allogeneic PBMC for 6 days at 37°C in a humidified 5%
CO2, 95% air atmosphere at a volume of 150 µl
culture medium in U-bottom 96-well microtiter plates (Costar,
Cambridge, MA). The medium was composed of RPMI 1640 supplemented with
2 mM L-glutamine (Biochrom, Berlin, Germany), 100 U/ml
penicillin (Biochemie, Vienna, Austria), 100 µg/ml streptomycin
(Grünenthal, Stolberg, Austria), and 10% heat-inactivated human
pooled AB serum. Various final concentrations of the renaturated
proteins
LST1/C-DHFR and DHFR were added at the onset of triplicate
cultures, whereas the buffer used for elution of these proteins from
the Ni-NTA column was used as negative control. During the last 1216
h, each well was exposed to 2 µCi
[3H]thymidine and harvested, as described
above. The proliferation was displayed as mean of triplicates
± SE.
| Results |
|---|
|
|
|---|
RT-PCR analysis of a freshly isolated monocyte-enriched cell
population (85% CD14+ cells) was used to detect
four different LST1 splice variants 220, 265, 286, and 381 bp long
(Fig. 2
). Constitutive LST1 transcription
was observed in positively selected CD4+,
CD8+, and CD19+ cells, as
well as in dendritic cells (Fig. 2
).
|
After stimulation of the PBMC, B cell, and T cell populations, no
significant change in length of the LST1 mRNAs was detected by RT-PCR
in comparison with freshly isolated cells (Fig. 2
). After stimulation
with various cytokines and agents (IL-3, IL-4, G-CSF, GM-CSF, TPO,
IFN-
, PHA, or LPS) for up to 96 h, the same transcripts 221,
265, 286, and 381 bp long were amplified in the monocyte-enriched cell
population tested.
Sequencing of different protein-encoding transcripts in PBMC
To characterize the transcripts amplified by RT-PCR, the
amplification products of an unstimulated monocyte-enriched cell
population (80% CD14+ monocytic cells) were
subcloned and sequenced. By analyzing 30 different cDNA clones, we
identified 7 different transcripts (Fig. 3
A), of which 243-, 309-, and
358-bp mRNAs had not been detected by gel electrophoresis. Only two of
these seven different transcripts had been previously described (LST1/A
and LST1/DE (Fig. 3
)). According to the proposed nomenclature of de
Baey et al. (11), we named the newly detected variants
LST1/J (248 nt), LST1/K (297 nt), LST1/L (182 nt), LST1/M (225 nt), and
LST1/N (202 nt); (Fig. 3
A). Because we amplified only the
protein-coding sequences of the LST1 transcripts (exons 25), we could
not distinguish between the variants LST1/D (exons 1A, 2, 5') and
LST1/E (exons 1C, 2, 5') differing only in the noncoding exon 1.
Therefore, the transcript spanning exon 2 and 5'' was called LST1/DE. We
confirm the presence of a third alternative splicing acceptor site of
exon 5 in our cDNA clones that had only been presumed previously (Fig. 4
A) (11).
However, expression of the splice variant LST1/C (2, 11)
was not identified in PBMC. The sequences of the isoforms
LST1/JLST1/N have been submitted to the EMBL database under the
respective submission numbers Y18486Y18490.
LST1 transcripts encode different proteins
Only two of the transcripts expressed in PBMC contain exon 3 (LST1/A, LST1/K), which encodes a stretch of 23 hydrophobic amino acids spanning the transmembrane region (2). Thus, all the remaining transcripts probably constitute soluble cytoplasmic isoforms, because they do not contain a signal sequence necessary for secretion. Only the cDNA clones LST1/A, LST1/DE, and LST1/J encompass exon 4. As exon 4 spans 23 nt, its presence in LST1 transcripts leads to a frame shift. Thus, an alternative open reading frame (ORF) is present in the C terminus of the clones spanning exon 4 in comparison with the remaining transcripts, LST1/KLST1/N. The two different ORFs encode putative soluble as well as transmembrane isoforms, which further increase the LST1 protein spectrum.
LST 1/C is expressed on the cell surface of U937 and THP1 cells
To analyze whether cells express the LST1 protein at the cell
surface, we used LST1-specific antisera raised against recombinant LST1
polypeptides in FACS analysis. The Ab LST125 showed specific binding
of the proteins
LST1/C and DHFR and did not detect the
LST1/A
protein in Western blot analysis (Fig. 4
B). FACS analysis
revealed no surface expression of the LST1/C protein in PBMC from
healthy individuals, and it was not induced after in vitro stimulation
of the cells with the following substances or combinations for up to
72 h: PHA, TNF-
, IL-2 plus IFN-
, IL-4, IL-4 plus LPS (data
not shown). We also observed no constitutive or inducible (PHA, IL-2,
IFN-
) LST1/C cell surface expression in the T-lymphocytic cell line
Molt 4. The histiomonocytic cell line U937, however, showed
constitutive expression of the LST1/C protein (Fig. 5
), which was not clearly up-regulated by
incubation of these cells with LPS. All positive results were confirmed
by performing the flow cytometric measurements with the
LST1/C-specific LST125-Affi Ab. Constitutive expression of the
LST1/C protein was also observed in the monocytic cell line THP1
(Fig. 5
).
Inhibition of lymphocyte proliferation exerted by LST1
To identify immunomodulatory activities of the variants
LST1/A
and
LST1/C-DHFR, the proliferative response of PBMC stimulated with
PHA, candidin, or allogeneic stimulator cells in the MLR was tested
with regard to these proteins.
The PHA-induced proliferation rate of PBMC (Fig. 6
A) was significantly reduced
by the addition of 10 or 50 ng/ml
LST1/C-DHFR at the beginning of
the culture period from 100% to 56 and 15%, respectively. In
contrast, DHFR and
LST1/A showed no significant inhibitory effect on
PHA-induced stimulation. Thus, the LST1/C portion is responsible for
the observed inhibition whereas the recombinant proteins
LST1/A and
DHFR that were isolated by the same procedure had no effect.
|
LST1/C-DHFR and to a lesser extent by
LST1/A,
whereas no significant change was effected by DHFR (Fig. 6
A highly significant immunosuppressive response was also detected when
LST1/C-DHFR was added to MLCs, revealing a dose-dependent inhibition
of the alloantigen-induced proliferation of lymphocytes. A
concentration of 1 ng/ml reduced proliferation by 38%. In the presence
of 50 or 100 ng/ml
LST1/C-DHFR, the proliferative response was
totally blocked (Fig. 6
C). Addition of DHFR to the MLR did
not show a significant inhibition. Only at the highest concentrations
(50 and 100 ng/ml) was proliferation reduced.
| Discussion |
|---|
|
|
|---|
Although splicing of the LST1 RNA seems to be complex, no difference
can be found in freshly isolated PBMC, B and T lymphocytes or after
stimulation of these cells in vitro for up to 96 h (Fig. 2
). We
found no change in expression of the different splice variants in
CD8+ cells after stimulation with IFN-
or PHA
for up to 48 h. These results contrast the results of de Baey et
al. (11), who observed a loss of the putative
membrane-anchored isoforms containing exon 3 in the monocytic cell
lines U937 and MonoMac 6 and exclusively detected the LST1/A cDNA after
activation of a CD8+ T cell clone with IFN-
.
These differences can be explained by the different primers used. The
primer pair of de Baey et al. coded in the most 5' of the alternative
noncoding exon 1 sequences (exon 1A) and in exon 5', which allowed
detection only of LST1 transcripts controlled by the first promoter of
the LST1 gene causing the alternative exons 1A', 1B, 1C, and
1D not to be amplified. In contrast, the oligonucleotides of our RT-PCR
studies were located in exon 2 and exon 5''. All splice variants
analyzed thus far span these exons, because exon 2 contains the start
codon and exon 5'' contains the stop codons of both alternative
ORFs.
Also, preferential expression of various isoforms in certain cells does
exist. No surface expression of the LST1/C variant was seen in
peripheral monocytes, T cells, and B cells in our FACS studies, whereas
the monocytic cell lines THP1 and U937 show constitutive expression of
this protein. These data are in good correlation with the fact that
LST1/C mRNA was detected in U937 cells but not in PBMC. No clear
influence on the cell surface expression has been observed by treating
THP1 and U937 cells with IFN-
, IL-2, or GM-CSF.
Because the LST1 gene is located within the TNF complex in
close vicinity to the genes for TNF-
, TNF-ß, and lymphotoxin-ß
and its transcription is induced by IFN-
, an immunomodulatory
function has been suspected (2). Also, a positive as well
as a negative association with bone marrow and renal transplant
rejection was found with two different alleles of TNFd microsatellites
which are located in intron 4 (9, 10). To examine an
immunomodulatory effect of LST1, we expressed the two LST1 variants
LST1/A and
LST1/C as soluble molecules with an N-terminal His
epitope in E. coli (Fig. 1
). These two isoforms only share
nine amino acids at the N terminus but differ completely in the
remaining molecule. They represent the two groups of LST1 proteins with
regard to the two alternative ORFs used in the last exon caused by
presence or absence of exon 4. The DHFR sequence does not exert an
immunomodulatory effect enabling its use for elongation of the 4.1 kDa
protein
LST1/C, which was indispensable for its expression.
Therefore, the 8-kDa
LST1/A and the 28.6 kDa
LST1/C-DHFR proteins
were used for studying their effect on lymphocyte function.
We found that the two groups of LST1 polypeptides differ in function.
The
LST1/C-DHFR molecule inhibited the PHA- and candidin- as well as
alloantigen-stimulated lymphocyte proliferation highly significantly.
This inhibition was dose dependent and exerted at low concentrations
(110 ng/ml), whereas a significant effect was exerted by
LST1/A
only with regard to the stimulation of PBMC with candidin but not
with PHA.
These results show that PBMC do not present the LST1/C protein on their
cell surface, whereas they respond to the presence of this protein in
soluble form. Interestingly, only two monocytic cell lines expressed
LST1/C on their cell membrane, but it was not detected on peripheral
monocytes of 24 individuals or after in vitro stimulation of these
cells with various cytokines. This is in good correlation with the
failure to amplify the LST1/C transcript in these cells. The LST1/M
variant (Fig. 3
), however, which constitutes the soluble homologue of
LST1/C, is transcribed in PBMC. This demonstrates the complex splicing
of the LST1 transcripts and its distinct regulation in different cell
types.
Although
LST1/A and
LST1/C show only a short amino acid homology
of nine amino acids, both isoforms inhibit the proliferation at a
varying extent. Therefore, alternative splicing seems to result in LST1
isoforms of a probably varying immunosuppressive function. However,
further studies of the various LST1 variants must be done to analyze
the regulation of alternative splicing and the difference in function
of all 10 LST1 polypeptides identified.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. I. Rollinger-Holzinger, Recherche sur le Cancer et les Maladies du Sang, Centre Universitaire, Avenue de la Faïencerie 162A, L-1511 Luxembourg, Luxembourg. E-mail address: ![]()
3 Abbreviations used in this paper: LST1, leukocyte-specific transcript 1; TPO, thrombopoietin; DHFR, dihydrofolate reductase; ORF, open reading frame. ![]()
Received for publication January 6, 1999. Accepted for publication January 6, 2000.
| References |
|---|
|
|
|---|
. J. Exp. Med. 179:1109.This article has been cited by other articles:
![]() |
D. Greetham, C. D. Ellis, D. Mewar, U. Fearon, S. N. a. Ultaigh, D. J. Veale, F. Guesdon, and A. G. Wilson Functional characterization of NF-{kappa}B inhibitor-like protein 1 (NF{kappa}BIL1), a candidate susceptibility gene for rheumatoid arthritis Hum. Mol. Genet., December 15, 2007; 16(24): 3027 - 3036. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. C. Macaulay, M. R. Tijssen, D. C. Thijssen-Timmer, A. Gusnanto, M. Steward, P. Burns, C. F. Langford, P. D. Ellis, F. Dudbridge, J.-J. Zwaginga, et al. Comparative gene expression profiling of in vitro differentiated megakaryocytes and erythroblasts identifies novel activatory and inhibitory platelet membrane proteins Blood, April 15, 2007; 109(8): 3260 - 3269. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lei and I. Vorechovsky Identification of Splicing Silencers and Enhancers in Sense Alus: a Role for Pseudoacceptors in Splice Site Repression Mol. Cell. Biol., August 15, 2005; 25(16): 6912 - 6920. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Xie, L. Rowen, B. Aguado, M. E. Ahearn, A. Madan, S. Qin, R. D. Campbell, and L. Hood Analysis of the Gene-Dense Major Histocompatibility Complex Class III Region and Its Comparison to Mouse Genome Res., December 1, 2003; 13(12): 2621 - 2636. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Barthel and A. E. Goldfeld T Cell-Specific Expression of the Human TNF-{alpha} Gene Involves a Functional and Highly Conserved Chromatin Signature in Intron 3 J. Immunol., October 1, 2003; 171(7): 3612 - 3619. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yu and S. M. Weissman Characterization of the Promoter of Human Leukocyte-specific Transcript 1. A SMALL GENE WITH A COMPLEX PATTERN OF ALTERNATIVE TRANSCRIPTS J. Biol. Chem., October 27, 2000; 275(44): 34597 - 34608. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |