The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuura, A.
Right arrow Articles by Sato, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuura, A.
Right arrow Articles by Sato, N.
The Journal of Immunology, 2000, 164: 3140-3148.
Copyright © 2000 by The American Association of Immunologists

NKT Cells in the Rat: Organ-Specific Distribution of NK T Cells Expressing Distinct V{alpha}14 Chains1 ,2

Akihiro Matsuura3, Miyuki Kinebuchi, Hong-Zhi Chen, Shigeo Katabami, Tadakazu Shimizu, Yuji Hashimoto, Kokichi Kikuchi and Noriyuki Sato

Sapporo Medical University, School of Medicine, Department of Pathology, Sapporo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Rat invariant TCR {alpha}-chains and NKT cells were investigated to clarify whether CD1d-mediated recognition by NKT cells is conserved further in evolution. Rats had multiple-copies of TRAV14 genes, which can be categorized into two types according to the diversity accumulated in the CDR2 region. Rats retained invariant TCR{alpha} forms with the homogeneous junctional region similar to mouse invariant TRAV14-J281. The proportion of invariant TCR among V{alpha}14+ clones was 12.9% in the thymus and increased in the periphery, 31% in the spleen and 95% in hepatic sinusoidal cells. The invariant TRAV14-J281 was expressed by liver sinusoidal and splenic NKT cells with CD8, CD44high, and TCR Vß8. Type 1 invariant TCR{alpha} was expressed more frequently in hepatic lymphocytes, while type 2 invariant TCR{alpha} was expressed predominantly in the spleen. Both types of cells cytolyzed to and were stimulated to proliferate by CD1d-expressing cells in a CD1d-restricted manner. These results suggested that rat NKT cells bearing distinct V{alpha}14 chains are distributed in a tissue-specific pattern. NKT cell populations in rats were more variable than those in mice, indicating that they play novel roles in nature. The implication of the molecular interaction between the structurally diverse invariant TCR{alpha} and CD1d/ligand complex in different organs is discussed.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A distinct function for mouse CD1 appears to be as a ligand directly recognized by a population of T cells that express the TCR and NK1.1 (NKR-P1C) Ags (1). Similar NKR-P1-positive T cells, hereafter referred to as NKT5 cells, have been identified in humans and rats (2, 3, 4). Mouse NKT cells and their human counterparts recognized evolutionarily conserved CD1d molecules in the absence of exogenously added Ags. Mouse and human CD1d molecules can also present glycolipids such as {alpha}-galactosylceramide to NKT cells (5, 6, 7). A striking feature of these cells is that they use an invariant TCR {alpha}-chain (V{alpha}14-J{alpha}281 in mice, V{alpha}24-J{alpha}Q in humans) paired preferentially with particular Vß-chains (Vß8, 7, or 2 in mice and Vß11 in humans) (8, 9, 10). NKT cells appear to play an important role in regulating immune responses through their rapid production of large amounts of IL-4 upon stimulation with anti-CD3 Ab in vivo or IFN-{gamma} upon stimulation with anti-NKR-P1 Ab in vitro (11, 12).

The non-MHC-encoded CD1 family has recently emerged as a novel Ag-presenting system that is distinct from either MHC class I or class II molecules. Two classes of CD1 genes have been identified (13, 14). Whereas the classic CD1 genes were absent in rats and mice, CD1D gene has been conserved through mammalian evolution including mice, rats, rabbits, sheep, and humans (14, 15, 16, 17, 18, 19). CD1d molecules, recently referred to as Group 2 CD1 molecules including human CD1d, mouse CD1d, and rat CD1d, are expressed by a wide variety of organs, appearing strongly in the intestinal epithelium, hepatocytes, epidermal cells, and to a lesser extent in thymocytes and hematolymphoid cells (20, 21, 22, 23). On the contrary, Brossay et al. reported that murine CD1d was mainly expressed on hemopoietic cells but not by the epithelium of the digestive tracts (24). Therefore, from a phylogenetic standpoint, several investigators have hypothesized that CD1d molecules have a similar functional significance in various mammalian immune systems (1, 13, 18, 25).

To elucidate the immunological significance of NKT cells and their interaction with CD1d, especially in a variety of unique disease models established in rats, it is very important to obtain information about the rat invariant TCR {alpha}-chain. This is the first report of the nucleotide and predicted amino acid sequences of the invariant TCR {alpha}-chains in species other than mice and humans.6 Furthermore, two novel findings—a certain degree of diversity in the rat TRAV14 genes and their tissue-specific expression—were revealed with regard to the invariant TCR{alpha}. We also showed a culture system to establish the CD1d-reactive cells from heterogenous lymphocytes, including T cells, NKT cells, and NK cells. The significance of the interaction between the two types of invariant TCR {alpha}-chains and CD1d and the organ specificity of invariant TCR {alpha}-chains are discussed.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and cells

Ten- to 14-wk-old and aged (over 12-mo-old) F344/Crj (Fischer, RT1 haplotype; lv1) and F344/Crj nude rats were used. Aged Sprague Dawley (closed colony from Charles River Breeding Laboratories, Wilmington, MA) and Wistar/Smc (RT1l) rats were also used. Cellular DNAs were prepared from 11 different rat strains; F344/Crj (lv1), LEW/Hkm (l), Wistar/Smc (l), NIGIII (q), LEJ/Hkm (j), ALB/Hok (b), BN/Hok (n), ACI/Hkm (av1), TO/Hkm (u), WKAH/Hkm (k), and W/N/Hkm (k), and BALB/c mouse. Single-cell suspensions of hematolymphoid organs were prepared as described previously (26). Hepatic sinusoidal lymphocytes (HL) were isolated by a high pressure perfusion method as described (27). After Ficoll-Conray (density, 1.096) gradient centrifugation, cells in the interface were collected, washed in PBS, and then purified by the modified nylon fiber column method described (28). Histological examination revealed that the meshwork of silver-staining fibers that highlighted endothelial cell linings parallel with liver cell plates was partially destroyed and almost all sinusoidal lymphocytes were perfused, whereas most periportal mononuclear cells remained in the liver.

Primers and probes

Three of the primers were based on originally reported mouse V{alpha}14 and J{alpha}281 sequences (29). Forward primers N323 (CAGAACAACCATGAAAAAGCGCCTGA) and N313 (CTAAGCACAGCACGCTGCACAT) were from exon 1 and exon 2, respectively. The reverse primer N314 (CAGGTATGACAATCAGCTGAGTCC) was from the 3' region of mouse TRAJ281. Rat TRAV14 primers were prepared according to the sequences obtained by this study.7 Forward primers M69 (GGCTGAGGAATCAGGCAGCA) and M70 (GCTTTGGGGCTAGGCTTCTG) were from the 5' region of exon 1, and N388 (GTGGAGCAGAGTCCCCAG) and M15 (GTCCTTCAATGCAATTACAC) was from exon 2. Rat TRAV14 type-specific primers M72 (GACAAACAAGGAAGAGAAA) for type 1 and M73 (TGCATACAAAAAGGAGACG) for type 2 were derived from exon 2. A reverse primer, M71 (CACCACACAGATGTAGGTGG), was from the 3' end of exon 2, where the sequences were conserved among TRAV14s. TRAJ281 reverse primers were M47 (ACTCAGCTGACTGTCACACCTG), M48 (GTTCCAATTCCAAAATACAGC), and M49 (AGCTTCCCTAGAGCTGAACCTC).

Rat TCR {alpha}-chain constant region gene (TRAC) primers were also made according to reported rat TRAC sequences (30); these were a forward primer, N369 (ACCCAGAACCTGCTGGGTACCAG), and reverse primers N325 (TTGCTCTTGGAATCCAGAGC), N324 (AAAGTCGGTGAACATGCAGAGGGT), and N370 (TCAACTGGACCACAGCCTTAGCGT). For screening the TRA and TRAV14 cDNA and genomic clones, two probes, pV14J (N313/N314) and pV14 (M69/M71), were prepared by amplification of HL cDNA from Sprague Dawley rats. A V{alpha}14-J{alpha}281 cDNA clone (FH-II-2) was also used as a probe.

Amplification of rat invariant TRAV14 cDNA

Total RNA or mRNA of hematolymphoid cells were converted to cDNA and subjected to RT-PCR with Tth DNA polymerase (Toyobo, Tokyo, Japan). HL cDNA was used for amplification with the sense primer N323 derived from the 5' region of mouse TRAV14S1 (8) and anti-sense primer N325 from the rat C{alpha} (TRAC) (30). The amplified fragment with an expected length of 590 bp was purified from agarose gel and subcloned into pMOSBlue vector (Amersham Japan, Tokyo, Japan). cDNA clones positive for a V{alpha}14 internal oligonucleotide probe from exon 2 of the mouse TRAV14S1 (N313) were isolated and sequenced. To determine the 5' untranslated regions of TRAV14, rapid amplification of cDNA ends (RACE) method and cycle sequencing were performed. Expressed TRAV14 subfamily genes, TRAV14S1, TRAV14S2, and TRAV14S3, were originally defined by sequencing TRAV14-positive cDNA clones from thymus (30 clones), HL (13 clones), and spleen (33 clones) and by close examination of their sequences. Because errors of nested PCR were sometimes observed, each subfamily was defined as the same group if only one or two nucleotide alterations existed in the amplified segments within 369 bp; moreover consideration was given to differences at the variable positions among rat TRAV14s. These clones were derived from three different lymphocyte preparations from different individual F344 rats. Three subfamilies were confirmed in the latter experiments.

TRAV14 gene analysis

Genomic DNA of F344 rats was first amplified with high-fidelity KOD DNA polymerase (Toyobo) by using M69 from the 5' untranslated region and M71 from the 3' end of TRAV14. Then nested PCR with M70 and M71 was conducted. Amplified fragments with expected length were subcloned and individual clones were isolated and sequenced. To estimate gene numbers and study polymorphism, Southern blot analysis was done as previously described (13).

Analysis of TRAV14 expression

Expression of TRAV14 was analyzed by RACE and RT-PCR. RACE was performed on thymus and HL. TRAC-positive clones were picked up with toothpicks, transferred to new agarose plates (400 colonies/plate), regrown, and blotted onto a Gene Screen Plus blotting membrane (NEN, Daiichikagaku, Tokyo). The blots were hybridized with an FH-II-2 V{alpha}14 cDNA probe. The V{alpha}14-positive clones were sequenced with a TRAC reverse primer (N324 or N328) or primers suitable for the vector. For RT-PCR, cDNAs derived from HL, spleen, thymus, and bone marrow cells were amplified first with N388 forward primer from exon 2 and N325 reverse primer from TRAC, and then with internal primers, M15 from exon 2 and N324 from TRAC. To detect TRAV14 subfamilies and types, sequencing and/or PCR analyses of cDNA clones were conducted with type-specific primers; M72 for type 1 and M73 for type 2.

Semiquantitative analysis of TRAV14 expression was done as previously described (31). Briefly, 5 µg of each total RNA was converted to cDNA by the reverse transcription (RT) step. These cDNAs were resuspended in 50 µl of Tris-EDTA buffer and 1 µl of these, corresponding to 100 ng of total RNA (referred to as 1x) was used for amplification. Because the efficiency of RT seemed to be different in each experiment and in each batch of total RNA, these procedures were done at the same time, in the same experimental conditions. Furthermore, serially diluted samples were amplified with ß-actin primers to evaluate the quality and quantity of cDNA. Based on the intensity of ß-actin bands, the amount of cDNA used for amplification could be adjusted. cDNA used for amplification corresponded to the total RNA as follows: lane 1, 100 ng (1x); lane 2, 50 ng (1/2, one second dilution); lane 3, 25 ng (1/4); lane 4, 12.5 ng (1/8); lane 5, 6.25 ng (1/16); lane 6, 3.125 ng (1/32); lane 7, 1.5625 ng (1/64); lane 8, 0.78125 ng (1/128); lane 9, 0.390625 ng (1/256); and lane 10, 0.1953125 ng (1/512). Because ß-actin content is very high in the RNA preparation, serial dilution was started from a more diluted point: lane 1, 5 ng (1/20); lane 2, 2.5 ng (1/40); lane 3, 1.25 ng; lane 4, 0.625 ng; lane 5, 0.3125 ng; lane 6, 0.15625 ng; lane 7, 0.078125 ng; lane 8, 0.0390625 ng; lane 9, 0.0195312 ng; and lane 10, 0.097656 ng.

51Cr-release assay

51Cr-release assay was done according to the procedure previously described (32). For the cold-target inhibition test, 50 µl of 51Cr-unlabeled cells (cold target cells) was added with 50 µl of 51Cr-labeled CD1d transfectants at ratios of 4:1, 2:1, and 1:1. Then, 100 µl of effector hepatic lymphocytes was added at an E:T ratio of 25:1. The percent specific lysis was calculated as follows: [(mean experimental cpm - mean spontaneous cpm)/(mean maximum cpm - mean spontaneous cpm)] x 100.

Abs and flow cytometry

Monoclonal Abs against rat lymphoid cells for CD3 (1F4), CD5 (R1-3B3), CD4 (W3/25), and CD8 (R1-10B5) were made in our laboratory or obtained from Seikagaku Kogyo (Tokyo, Japan). The mAbs for NKRP-1A (10/78), TCR-Vß8.2 (R78), TCR-Vß8.5 (B73), TCR-Vß10 (G101), FITC-conjugated 10/78, PE-conjugated R73, biotin-conjugated anti-rat CD44 (OX49), and streptavidin Cy-Chrome were purchased from PharMingen (San Diego, CA). The mAbs for TCR-Cß (R73) and TCR-{delta} (V65) were kindly supplied by Dr. T. Hünig (University of Würzburg, Würzburg, Germany). The polyclonal Ab against rat CD1d was described previously (16). Cells were harvested after different periods of time and stained by the indirect immunofluorescence technique as described. Stained cells were analyzed and sorted by FACScan (Becton Dickinson, San Jose, CA) and FACScalibur (Becton Dickinson).

Proliferation assay

Freshly isolated HL or splenic lymphocytes (1 x 104), purified using the modified nylon fiber column method, were combined with the 1 x 104 or 5 x 104 irradiated CD1d transfectants or irradiated parent cells for 24, 48, 72, and 96 h in flat-bottom 24-well plates in the absence of the stimulants. After the specified time, cells were pulsed for 8 h with 1 µCi [3H]thymidine and harvested. Abs to CD1d (2.5 µg/ml) were added to HL at the initiation of the incubation with the CD1d transfectants.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of four rat TRAV14 genes

Four rat TRAV14 genes, referred to as TRAV14S1, TRAV14S2, TRAV14S3, and TRAV14S4, highly similar to each other and to mouse TRAV14 and human TRAV24, were identified. Deduced amino acid sequences are aligned in Fig. 1GoA. Complete 5' untranslated regions of rat TRAV14 were determined for TRAV14S3 by RACE and nucleotide sequencing (data in DDBJ accession no. AB036696). A fourth TRAV14S4 subfamily was found by genomic PCR analysis of F344 strain, but no mRNA was detected by RT-PCR analysis. The predicted TRAV14S4 protein had an amino acid phenylalanine (TTT) at codon 40 instead of cysteine (TGT) in other TRAV14s (Fig. 1GoA). Lack of the cysteine residue may nullify the intrachain disulfhydryl bond affecting the V domain of TRAV14S4, which in turn destroys TCR cell-surface expression or may affect the interaction of TRAV14S4 TCR {alpha}-chain with other molecules important for the trafficking of the TRAV14 to cell-surface membrane. Therefore, TRAV14S4 mRNA might be excluded from the positively selected T cell populations.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 1. Rat TRAV14 and TRAJ281 genes. A, Alignment of amino acid sequences of rat TRAV14s with mouse and human counterparts. The first methionine in the leader peptide was numbered 1. CDR1 region, CDR2 region, and cysteines (at position 40, 44, and 111) are boxed. B, Alignment of TRAJ281 homologues. C, Junctional regions of TRAV14-J281. The junction was estimated according to the protein display of TRA regions in the international Immunogenetics (IMGT) database (http://imgt.cnusc.fr:8104) coordinated by M. P. Lefranc, and close inspection of the junctional region between rat V14 and J281. In the rat, alanine (A) or valine (V) was observed. Mouse germline sequences of TRAV14 and TRAJ281 were also shown (10 by O. Lanz and A. Bendelac, Ref. 48 ). D, Phylogenetic tree of rat TRAV14s, mouse TRAV14s, and human TRAV24 using UPGMA method with the software (SDC, Tokyo, Japan).

 
Southern blot analysis of 11 rat strains indicated that all of them have several TRAV14 genes and that there is some polymorphism of restriction fragment length (Fig. 2GoA). When F344 rat cellular DNA was digested with different restriction enzymes, several bands were seen in each digest (Fig. 2GoB). In contrast, BALB/c mouse has only a single 1.3-kb band. Thus, the existence of multiple (at least four) genes belonging to the TRAV14 family in the F344 rat genome was confirmed.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 2. Southern blot analysis of rat TRAV14 gene. A, TRAV14s in 11 rat strains labeled for each lane and BALB/c mice. Cellular DNAs were digested with HindIII, separated on 0.7% agarose gel, and blotted. The blots were hybridized with a pV14 probe (corresponding to 11bp to 399bp of rTRAV14S3). Restriction fragment length polymorphism was observed. A single 1.3 kb band was seen in BALB/c mice. B, Cellular DNA of F344 strain was digested with the indicated restriction enzymes. The blot was hybridized with the same pV14 probe. Multiple bands were seen with all enzymes except for BamHI.

 
Classification of rat TRAV14 into two types

Eleven amino acid positions, 4, 36, 40, 64, 72, 73, 75, 77, 80, 89, and 90, numbering first methionine as No. 1, were diversified among rat TRAV14 proteins (Fig. 1GoA). Six positions, 4H (histidine), 72T (threonine), 73N (asparagine), 75E (glutamic acid), 77K (lysine), and 80R (arginine), were common to TRAV14S1, TRAV14S2, and TRAV14S4. Amino acids composed of complementarity determining region (CDR) 1, from 47 to 53 (TVTPFNN) according to Chotia et al. (33), were conserved among four families. However, the sequences of the CDR2 region, from 70 to 77, were obviously different and could be grouped into two types. Type 1 included TRAV14S1, TRAV14S2, and TRAV14S4 (VLTNKEEK), and type 2 included TRAV14S3 (VLAYKKET). Four of eight amino acids were diversified. In contrast, only a 3-aa stretch within the CDR2 region was different between the two mouse subfamilies: DQK (position 73–75) in mouse TRAV14S1 was substituted to HEN in mouse TRAV14S2 (Ref. 34 and Fig. 1GoA).

Evolutionary trees constructed by both UPGMA and neighbor-joining methods further support the categorization into two types, because type 1 TRAV14s genes had a common root and type 2 TRAV14 (TRAV14S3) was more related to mouse TRAV14s and human TRAV24 (Fig. 1GoD).

Identification of invariant TCR{alpha} in the rat

The J regions of TRAV14-positive cDNA clones from HL were sequenced. Almost all of the TRAV14s (proportion described in next sections) were rearranged with a new rat J {alpha}-chain, referred to here as rat TRAJ281, which is highly similar to mouse TCR J{alpha}281 (TRAJ15) (Fig. 1GoB). The percent similarity of rat TRAJ281 to its mouse and human counterparts was 76.2 and 80.9%, respectively. The V14-J281 joint consisted of a single small amino acid, alanine (encoded by GCc or GCg) or glycine (GGc, GGt, GGg) (Fig. 1GoC). Whereas the exact origin of these nucleotides could not be determined as no information about rat germline J region is available, the CDR3 region of rat TRAV14-J281 is homogeneous, as is the case with mouse and human invariant TCR {alpha}-chains.

Expression of TRAV14 and invariant TRAV14-J281 in different organs

By RACE performed on thymus and HL, 10 of 384 TCR C{alpha}-positive clones from thymus (2.6%) and 19 of 662 clones from HL (2.87%) contained TRAV14 sequences. Of these, none of the thymus (0%) and five of the HL (0.76%) had homogeneous junctional sequences (invariant TRAV14-J281). Thus, TRAV14 expression is very low in rat T cells. To more accurately determine the level of TRAV14 expression, semiquantitative RT-PCR analysis was performed. It was highest in HL (amount scored 1), followed by spleen (1/32) and then thymus (1/64), as estimated from the visible bands appearing in the series of diluted samples (Fig. 3GoA).



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 3. Expression of rat TRAV14 and TRAV14-J281 in different organs. A, Semiquantitative analyses of TRAV14 expression (a–c). cDNA used for amplification corresponded to the total RNA of: lane 1, 100 ng (1x); lane 2, 50 ng (1/2, one second dilution); lane 3, 25 ng (1/4); lane 4, 12.5 ng (1/8); lane 5, 6.25 ng (1/16); lane 6, 3.125 ng (1/32); lane 7, 1.5625 ng (1/64); lane 8, 0.78125 ng (1/128); lane 9, 0.390625 ng (1/256); and lane 10, 0.1953125 ng (1/512). Semiquantitative analyses of control ß-actin expression (d–f). cDNA used for amplification was the same as a–c; however, total amounts of cDNA were reduced. Lane 1, 5 ng (1/20); lane 2, 2.5 ng (1/40); lane 3, 1.25 ng (1/80); lane 4, 0.625 ng (1/160); lane 5, 0.3125 ng (1/320); lane 6, 0.15625 ng (1/640); lane 7, 0.078125 ng (1/1280); lane 8, 0.0390625 ng (1/2560); lane 9, 0.0195312 ng (1/5120); and lane 10, 0.097656 ng (1/10240). a and d, in HL; b and e, in thymocytes; c and f, in spleen cells. B, Percentages of invariant TRAV14-J281 (left) and of conventional TRAV14-Jx (right) in different organs were shown. Actual numbers of TRAV14-TRAC-positive clones sequenced for this analysis were as follows: thymus 54 (7 TRAV14-J281, 12.9%; and 47 TRAV14-Jx, 87.1%), spleen 132 (41 invariant, 31.1%; and 91 conventional, 68.9%), and liver 167 (158 invariant, 94.6%; and 9 conventional, 0.054%).

 
The proportion of invariant TCR{alpha} among expressed TRAV14 genes was investigated for HL, spleen, thymus, and bone marrow by RT-PCR amplification using TRAV14 and TRAC primers. The results are summarized in Fig. 3GoB. In the thymus, only 12.9% of V{alpha}14+ clones had invariant TCR{alpha}. The proportion of invariant TCR{alpha} among V{alpha}14+ clones was increased in the periphery, 31.1% in spleen, and extremely high, up to 94.6%, in HL.

We then asked whether the two types of rat TRAV14 were expressed in a tissue-specific manner. Almost the same proportion of type 1 and type 2 transcripts were found in the thymus, liver, and bone marrow (Fig. 4GoA). In particular, type 2 TRAV14S3 gene was expressed predominantly in spleen. Sixty-seven of 82 (81.7%) TRAV14 clones from the spleen were in the type 2 category. The proportion of type 1 and type 2 invariant TCR{alpha} in each organ is summarized in Fig. 4GoB. In the liver, type 1 invariant TRAV14-J281 (type 1 invariant TCR{alpha}) clones were more frequently observed than type 2 (type 2 invariant TCR{alpha}) clones; 69 type 1 and 44 type 2 clones. Almost the same number of type 1 and type 2 invariant TCR{alpha} clones were observed in bone marrow (26 type 1 and 24 type 2). Of particular interest, type 2 invariant TCR{alpha} was most frequently observed in spleen (81.5%, 22 of 27 invariant TCR{alpha}, Fig. 4GoB). From these results, we concluded that the rat TRAV14s and their invariant derivatives showed a certain degree of tissue-specific expression.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 4. Differential expression of type 1 and type 2 TRAV14 and their invariant derivatives in different organs. A, Proportion of type 1 and type 2 TRAV14s. Actual numbers of sequenced clones were as follows: thymus 20 (10 type 1, 50%; and 10 type 2, 50%), spleen 82 (15 type 1, 18.3%; and 67 type 2, 81.7%), liver 122 (71 type 1, 58.2%; and 51 type 2, 41.8%), and bone marrow 77 (41 type 1, 53.2%; and 36 type 2, 46.8%). B, Proportion of type 1 and type 2 TRAV14s in invariant TRAV14-J281. Actual numbers of invariant TRAV14-J281 were as follows: thymus 6 (5 type1 invariant, 1 type 2 invariant), spleen 27 (5 type 1 invariant, 22 type 2 invariant), liver 113 (69 type 1 invariant, 44 type 2 invariant), and bone marrow 50 (26 type 1 invariant, 24 type 2 invariant).

 
Phenotypic characterization of rat NKT cells

Because little is known about lymphocyte subpopulations in the normal rat liver, we analyzed the surface phenotypes of lymphocytes isolated from the liver sinusoids, and spleen, staining them with a set of mAbs. In the studies described below we used lymphocytes, purified using a modified nylon fiber column method, which contained T cells, NK cells, and NKT cells, but not B cells or macrophages. Nearly half of the total of hepatic and splenic lymphocytes were {alpha}ßT cells, 3–7% were NKT cells, and 10% were NK cells (Table IGo). Furthermore, the fluorescence intensity of NKR-P1A had two-peak patterns for rat T cells and NKT cells in the liver and the spleen (Fig. 5GoA), like that of TCR for mouse NKT cells in the liver and the thymus (35). NKT cells existed both in the NKRhigh and NKRdull subsets. Interestingly, hepatic NKT cells existed mainly in NKRdull subsets. The ratio of NKRhigh-NKT cells to NKRdull-NKT cells in the hepatic sinusoids and the spleen was 1:10 and 1:3, respectively. Approximately 80% of hepatic T cells expressed CD4, 17% of them expressed CD8, and 1.5% expressed neither CD4 nor CD8. Half of splenic T cells expressed CD4, and the majority of the other splenic T cells expressed CD8 (Table IIGo). Unexpectedly, most rat hepatic and splenic NKT cells expressed CD8. Thus, most hepatic and splenic NKT cells expressed CD8 and CD44high.


View this table:
[in this window]
[in a new window]
 
Table I. Two-color analysis with anti-{alpha}ßTCR mAb and anti-NKR-P1A mAb using FACScan1

 


View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 5. Phenotypic characteristics of rat NKT cells. A, Cell-surface expression of {alpha}ßTCR in the hepatic and splenic NKR-P1Adull-positive subset and NKR-P1Ahigh-positive subset using FACScan. FACS dot plot (below) shown gated above. A total of 50,000 events were acquired from each tube. The results are representative of eight experiments performed, with similar results obtained. B, Cell-surface expression of Vß8.2, Vß10, and Vß16 in HL using FACScan (FACS dot plot (left) shown gated with the results (right)). Upper panels in NKRhigh-positive subset, lower panels in NKRdull-positive subset.

 

View this table:
[in this window]
[in a new window]
 
Table II. Three-color analysis with anti-{alpha}ßTCR mAb, anti-NKR-P1A mAb, and anti-CD4 mAb or anti-CD8 mAb, and anti-CD44 mAb using FACScan1

 
Next we studied whether there was restricted heterogeneity of TCRVß usage in the hepatic T cells and NKT cells using FITC-conjugated mAbs for rat Vß8.2, Vß8.5, Vß10, and Vß16 and PE-conjugated anti-{alpha}ßTCR mAb or PE-conjugated anti-NKR mAb. Each of Vß8.2, Vß10, and Vß16 were expressed in hepatic T cells and NKT cells at ~5 and 10%, respectively (Fig. 5GoB). Vß usage of splenic T cells and NKT cells was similar to hepatic T cells and NKT cells (data not shown).

Thus, TCR Vß8, the major partner of an invariant TCR{alpha} in mice, was not expressed dominantly in either NKT cells or T cells in the normal rat liver and spleen.

CD1d-restricted cytolytic activity of tissue-specific lymphocytes

To elucidate the function of rat CD1, we first examined the cytotoxic activity of the lymphocytes to CD1d transfectants in the thymus, lymph nodes, spleen, and hepatic sinusoids by CTL assay in vitro. As shown in Fig. 6GoA, hepatic lymphocytes killed CD1d transfectants, but did not kill the parent cell line. Splenic lymphocytes had relatively low cytotoxicity. Thymocytes and lymph node cells did not show any cytotoxity. Cold (i.e., cells that had not been labeled with 51Cr) CD1d transfectants and CD1+ thymocytes were able to compete for lysis of hot (labeled with 51Cr) CD1d transfectants (Fig. 6GoB). These results indicated that hepatic lymphocytes directly recognized CD1d expressed on killing targets.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 6. Cytotoxicity of rat lymphocytes against CD1-expressing cells. A, CTL assay showing specific lysis of T9-transfected lines expressing rat CD1d molecule. T9 is a gliosarcoma cell line of F344 rat origin and has been shown not to be sensitive to syngeneic NK cells (32 ). Lymphocytes in the thymus, spleen, and hepatic sinusoids from syngeneic F344 rats were purified using a modified nylon fiber column method and used as effectors. The data shown are representative of three independent experiments with four rats per group. B, Cold target inhibition assay. HL purified using the modified nylon fiber column method were used as effector cells. The E:T ratio was 25:1. The nonlabeled target cell to 51Cr-labeled target CD1 transfectant (hot target cell) ratio was 4:1, 2:1, and 1:1. CD1 transfectants and the parent cells were used as nonlabeled cold target cells. The mean value of triplicate cultures was used for statistical evaluation.

 
Thus, among adult rat lymphocytes (the mixture of T cells, NK cells, and NKT cells) in the thymus, spleen, liver sinusoids, and lymph nodes, only the cells from the liver sinusoids cytolyzed CD1d transfectants significantly in a CD1d-restricted manner.

CD1 induces proliferation of rat hepatic lymphocytes and TCR-{alpha}ß+ NKRdull cells

Incubation of HL with CD1d transfectants for 72 h in the absence of exogenously added cytokines resulted in proliferation as assessed by incorporation of [3H]thymidine (Fig. 7GoA). The reaction was blocked by addition of anti-CD1 Ab at the initiation of the incubation. In contrast, cultures of HL-containing medium alone showed progressive cell death over the duration of the culture. In cultures with the parent cell line, most surviving cells were NK cells by 24 h, and apoptosis was nearly complete by 72 h. In striking contrast to freshly isolated HL, the majority of surviving cells in cultures with CD1d transfectants expressed Vß8.2 at 72 h (Fig. 7GoB).



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 7. Rat lymphocyte proliferation in the presence of CD1-expressing cells. A, Proliferative responses of HL (1 x 104), purified using the modified nylon fiber column method, cultured in vitro for 72 h in the presence of irradiated CD1d transfectants (1 x 104 or 5 x 104) in flat-bottom 24-well plates in the absence of the stimulants. After the specified time, cells were pulsed for 8 h with 1 µCi [3H]thymidine and harvested. Anti-CD1 Abs (2.5 µg/ml), added at the initiation of the incubation in cultures, inhibited the proliferative activity. Data are expressed as means ± SD of triplicate. B, Phenotypes of CD1d-reactive cells by 72 h in culture with the irradiated CD1d-transfected cell line. Most cells in the NKR-TCR- subset were dead as confirmed by propidium iodide staining (data not shown). C, TCR {alpha}-chain expression of CD1d-reactive cells by 72 h in culture with the irradiated CD1d-transfected cell line. The constant region (C{alpha}) gene segment was amplified with N369 and N370. V{alpha}14 TCR transcripts were detected with N388 and N325. An invariant V{alpha}14-J{alpha}281 TCR was amplified with N388 and N314, then confirmed by direct sequencing. D, RT-PCR analyses of TRAV14 transcripts using type specific primers. HL (lanes 1–3) and splenic lymphocytes (lanes 4–6) (1 x 106 each) were cultured with the irradiated CD1d-transfected cell line (1 x 106) for 72 h. Control ß-actin transcripts were amplified (lanes 1 and 4). Type 1 TRAV14 transcripts were amplified with M48 and M72 (lanes 2 and 5). Type 2 TRAV14 transcripts were amplified with M48 and M73 (lanes 3 and 6). PCR products were confirmed by direct sequencing.

 
Invariant rat V{alpha}14-J{alpha}281 expression was detected by RT-PCR in HL in cultures with CD1d transfectants at 96 h (Fig. 7GoC). However, TCR C{alpha}, V{alpha}14-C{alpha}, and V{alpha}14-J{alpha}281 were not detected in HL in cultures with the parent cells at 48, 72, or 96 h. TCR{gamma} expression was not detected in any of the cases.

CD1d/endogenous Ag stimulation impartially induces type 1 and type 2 invariant TCR{alpha}+ NKT cells

To elucidate the possible roles of different types of TRAV14s in different organs, the type of TRAV14 expressed in the proliferating hepatic and splenic NKT cells by the stimulation of CD1d without exogenous Ag was studied using the quantitative PCR method and direct sequencing. The ratios of type 1 to type 2 TRAV14 expressed on proliferating NKT cells in this system were similar to those in freshly isolated V{alpha}14+ NKT cells both in the spleen and liver sinusoids (Fig. 7GoD).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We, for the first time, identified novel rat TRAV family genes encoding invariant TCR {alpha}-chains highly similar to mouse TRAV14-J281 and human TRAV24-J18. Remarkable homogeneity of their CDR3 regions implies that a part of the ligand molecules (carbohydrate or protruding portion) bound to the CD1d facing them is mainly constant in rats as in mice and humans. Multiplicity of rat TRAV14s may correspond to a previous notion by Southern blot analysis, in which a duplication event encompassing a large portion of the TRAV locus occurred in the rat (36). This is in extreme contrast to mouse TRAV14, as most laboratory mouse strains harbor a single-copy gene; mouse TRAV14S1 in 17 strains or mouse TRAV14S2 in 4 strains. Only two strains, DBA/1 and DBA/2, had both genes (29). This multiplicity was not a simple numerical expansion, rather the rat TRAV14 genes are more diverse and polymorphic than previously inferred from the studies of mice and humans, in which the invariability of the V domain has been emphasized (8, 9, 10, 29). The rat TRAV14s were divided into two types based on the diversity in the CDR2 region. Both types of invariant TRAV14-positive NKT cells, showing tissue-specific distribution, existed in rats and were simultaneously proliferated by and cytolysed to CD1d-expressing transfectants. Such CD1d-reactive NKT cells were enriched in the adult rat liver sinusoids. Whereas most features were common to mouse NKT cells, several characteristics were unique in the rat. For example, skewed TCR Vß usage was not very obvious for freshly isolated rat NKT cells (Fig. 5GoB; and A. Matsuura and M. Kinebachi, unpublished observation of Vß expression analysis by RT-PCR). However, the majority of CD1d-responding cells after coculture were Vß8.2-positive invariant TRAV14-J281-positive NKT cells (Fig. 7Go, B and C). Such a bias of Vß repertoire of rat TRAV14+ cells may be due to stimulation through CD1d molecules under the different background of species. Furthermore, most rat NKT cells were CD8 positive. To further investigate rat TRAV14+ cells, specific Abs against recombinant TRAV14 protein is in preparation.

Proliferation and survival of hepatic NKT cells upon CD1d stimulation suggested that CD1d may play a role in hemopoiesis in the adult rat liver via the expansion or maintenance of NKT cells, in addition to the necessity of CD1d for the differentiation of mouse NKT cells in their early development and in the adult thymus (37, 38, 39, 40). As these autoreactive rat NKT cells have cytotoxic potential, as in mice (41), they may also contribute to tissue homeostasis, such as ordinary turnover of hepatocytes that strongly express CD1d molecules (22). Rat CD1d in the liver may also act as Ag-presenting molecules in emergent needs for protection against microorganisms from the intestine and blood. Besides hepatocytes, the kind of cells that express CD1d in the normal and inflamed rat liver needs to be determined.

Based on the crystal structures reported (42, 43), an insight into the molecular interaction between TCR, CD1d, and ligands was gained from the observation that "two types" of rat invariant TRAV14-positive NKT cells showed tissue-specific distribution. Because the variability was found in the CDR2 region, one can speculate that interaction surfaces created by the CD1 {alpha}2 helix and a part of the ligands might be different from organ to organ. Park et al. reported that autorecognition of mouse CD1 molecules by T cell hybridomas expressing the invariant TCR {alpha}-chains was highly dependent on the cell types in which mouse CD1 was expressed (44). Because most mouse strains have only one type of invariant TCR{alpha}, the fine specificity difference may be explained by the variety of self ligands and by diversity of the paired TCR ß-chain. In such a situation, perhaps also in humans, the opposite side of the surfaces formed by CD1{alpha}1 helix and ligands is important for perception. Upon coculture with CD1d-transfected cells, the proportion of type 1 and type 2 invariant NKT cells from the liver and that of spleen were unaltered, indicating that the destination of types has already been determined in the origin of tissues or that self ligands/CD1d of transfectants have had insufficient force to drive them into distinctly differentiated pathways. Whether tissue-specific Ags loaded onto a hydrophobic ligand-binding groove of CD1d or tissue-specific modification of CD1d itself is responsible for the restriction of the types of TRAV14 needs to be clarified.

Recently, cellular GPI has been identified to be a major ligand of mouse CD1d1 by mass spectrometry and metabolic radiolabeling analysis (45). By assumption, >90% of CD1d1 was occupied by GPI. However, it has been shown that glycolipids, such as phosphatidylinositol, a synthetic PIM2 (a phosphatidylinositol with two additional {alpha}-D mannose groups), and lipoarabinomannan purified from M. tuberculosis could not stimulate unprimed spleen cells from TAP-/- mice which had TL- and CD1-dependent cells but did not have TAP-dependent, MHC class I-dependent cells. In contrast, {alpha}-galactosylceramide could do so (46). Because the {alpha}-anomeric form of glycolipids are not natural constituents of mammals, other hydrophobic ligands with certain degrees of heterogeneity might be associated with some fractions of CD1d molecules and might shape autoreactive cell pools in each organ. In vivo natural ligands of CD1d that are capable of stimulating lymphocytes should be clarified.

Athymic nude rats had a relatively high proportion of TRAV14 transcripts with a variable CDR3 region and a different kind of invariant TRAV-J transcript was found (H.-Z. Chen and A. Matsuura, unpublished observation). Our study revealed that NKT populations in rats were more variable than in mice, suggesting they have novel roles in nature.


    Footnotes
 
1 This work was supported in part by a fund from The Hokkaido Geriatrics Research Institute. Back

2 The nucleotide sequence data reported in this paper will appear in the DDBJ/EMBL/GenBank nucleotide databases under accession numbers AB036694AB036697. Back

3 Address correspondence and reprint requests to Dr. Akihiro Matsuura, Department of Pathology, School of Medicine, Sapporo Medical University, South-1, West-17, Chao-ku, Sapporo 060-8556, Japan. E-mail address: Back

4 Present address: Dr. Miyuki Klinebuchi, Department of Pathology, School of Medicine, Gifu University, Tsukasa-machi Gifu, 570-8705, Japan Back

5 Abbreviations used in this paper: NKT, NKR-P1-positive T cells; HL, hepatic lymphocytes; RACE, rapid amplification of cDNA ends; CDR, complementarity determining region. Back

6 A part of this work was presented at the 12th International Workshop on Alloantigenic Systems in the Rat, held in Halifax, Canada. A. Matsuura, H. Chen, M. Kinebuchi, Y. Hashimoto, and K. Kikuchi, 1998 (49). Back

7 Nomenclature of rat TRAV14 and TRAJ281 is in accord with IMGT numbering and based on similarity to mouse TRAV14S1 and TRAJ281 (J15), respectively. Because rat TRAJ genes have not been well-characterized, we used TRAJ281 to respect the original identification by Imai et al. (8 ). Back

Received for publication September 21, 1999. Accepted for publication December 30, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bendelac, A., O. Lantz, M. E. Quimby, J. W. Tewdell, J. Bennink, R. R. Brutkiewicz. 1995. CD1 recognition by mouse NK1+ T lymphocytes. Science 268:863.[Abstract/Free Full Text]
  2. Exley, M., J. Garcia, S. P. Balk, S. Porcelli. 1997. Requirements for CD1d recognition by human invariant V{alpha}24+ CD4-CD8- T cells. J. Exp. Med. 186:109.[Abstract/Free Full Text]
  3. Davodeau, F., M. A. Peyrat, A. Necker, R. Dominici, F. Blanchard, C. Leget, J. Gaschet, P. Costa, Y. Jacques, A. Godard, et al 1997. Close phenotypic and functional similarities between human and murine {alpha}ß T cells expressing invariant TCR {alpha}-chains. J. Immunol. 158:5603.[Abstract]
  4. Knudsen, E., T. Seierstad, J. T. Vaage, C. Naper, H. B. Benestad, B. Rolstad, A. A. Maghazachi. 1997. Cloning, functional activities and in vivo tissue distribution of rat NKR-P1+ TCR{alpha}ß+ cells. Int. Immunol. 9:1043.[Abstract/Free Full Text]
  5. Brossay, L., M. Chioda, N. Burdin, Y. Koezuka, C. Giulia, P. Dellabona, M. Kronenberg. 1998. CD1d-mediated recognition of an {alpha}-galactosylceramide by natural killer T cells is highly conserved through mammalian evolution. J. Exp. Med. 188:1521.[Abstract/Free Full Text]
  6. Spada, F. M., Y. Koezuka, S. A. Porcelli. 1998. CD1d-restricted recognition of synthetic glycolipid antigens by human natural killer T cells. J. Exp. Med. 188:1529.[Abstract/Free Full Text]
  7. Kawano, T., J. Cui, Y. Koezuka, I. Toura, Y. Kaneko, K. Motoki, H. Ueno, R. Nakagawa, H. Sato, E. Kondo, H. Koseki, M. Taniguchi. 1997. CD1d-restricted and TCR-mediated activation of V{alpha}14 NKT cells by glycosylceramides. Science 278:1626.[Abstract/Free Full Text]
  8. Imai, K., M. Kanno, H. Kimoto, K. Shigemoto, S. Yamamoto, M. Taniguchi. 1986. Sequence and expression of transcripts the T-cell antigen receptor {alpha}-chain gene in a functional, antigen-specific suppressor-T-cell hybridoma. Proc. Natl. Acad. Sci. USA 83:8708.[Abstract/Free Full Text]
  9. Dellabona, P., E. Padovan, G. Casorati, M. Brockhaus, A. Lanzavecchia. 1994. An invariant V{alpha}24-J{alpha}Q/Vß11 T cell receptor is expressed in all individuals by clonally expanded CD4-CD8- T cells. J. Exp. Med. 180:1171.[Abstract/Free Full Text]
  10. Lantz, O., A. Bendelac. 1994. An invariant T cell receptor {alpha} chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4-8- T cells in mice and humans. J. Exp. Med. 180:1097.[Abstract/Free Full Text]
  11. Arase, H., N. Arase, T. Saito. 1996. Interferon-{gamma} production by natural killer cells and NK1.1+ T cells upon NKR-P1 cross-linking. J. Exp. Med. 183:2391.[Abstract/Free Full Text]
  12. Bendelac, A., M. N. Rivera, S. H. Park, J. H. Roark. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu. Rev. Immunol. 15:535.[Medline]
  13. Katabami, S., A. Matsuura, H. Z. Chen, K. Imai, K. Kikuchi. 1998. Structural organization of rat CD1 typifies evolutionarily conserved CD1D class genes. Immunogenetics 48:22.[Medline]
  14. Calabi, F., J. M. Jarvis, L. Martin, C. Milstein. 1989. Two classes of CD1 genes. Eur. J. Immunol. 19:285.[Medline]
  15. Bradbury, A., K. T. Belt, T. M. Neri, C. Milstein, F. Calabi. 1988. Mouse CD1 is distinct from and co-exists with TL in the same thymus. EMBO J. 7:3081.[Medline]
  16. Ichimiya, S., K. Kikuchi, A. Matsuura. 1994. Structural analysis of the rat homologue of CD1: evidence for evolutionary conservation of the CD1D class and widespread transcription by rat cells. J. Immunol. 153:1112.[Abstract]
  17. Calabi, F., K. T. Belt, C. Y. Yu, A. Bradbury, W. J. Mandy, C. Milstein. 1989. The rabbit CD1 and the evolutionary conservation of the CD1 gene family. Immunogenetics 30:370.[Medline]
  18. Rhind, S. M., J. Hopkins, B. M. Dutia. 1999. Amino-terminal sequencing of sheep CD1 antigens and identification of a sheep CD1D gene. Immunogenetics 49:225.[Medline]
  19. Blumberg, R. S., C. Terhorst, P. A. Bleicher, F. V. McDermott, C. H. Allan, S. B. Landau, J. S. Trier, S. P. Balk. 1991. Expression of a nonpolymorphic MHC class I-like molecule, CD1D, by human intestinal epithelial cells. J. Immunol. 147:2518.[Abstract/Free Full Text]
  20. Canchis, P. W., A. K. Bhan, S. B. Landau, L. Yang, S. P. Balk, R. S. Blumberg. 1993. Tissue distribution of the non-polymorphic major histocompatibility complex class I-like molecule, CD1d. Immunology 80:561.[Medline]
  21. Bleicher, P. A., S. P. Balk, S. J. Hagen, R. S. Blumberg, T. J. Flotte, C. Terhorst. 1990. Expression of murine CD1 on gastrointestinal epithelium. Science 250:679.[Abstract/Free Full Text]
  22. Kasai, K., A. Matsuura, K. Kikuchi, Y. Hashimoto, S. Ichimiya. 1997. Localization of rat CD1 transcripts and protein in rat tissues: an analysis of rat CD1 expression by in situ hybridization and immunohistochemistry. Clin. Exp. Immunol. 109:317.[Medline]
  23. Somnay-Wadgaonkar, K., A. Nusrat, H. S. Kim, W. P. Canchis, S. P. Balk, S. P. Colgan, and R. S. Blumberg. 1999. Immunolocalization of CD1d in human intestinal epithelial cells and identification of a ß2-microglobulin-associated form. 11:383.
  24. Brossay, L., D. Jullien, S. Cardell, A. C. Sydora, N. Burdin, R. L. Modlin, M. Kronenberg. 1997. Mouse CD1 is mainly expressed on hemopoietic-derived cells. J. Immunol 159:1216.[Abstract]
  25. Porcelli, S. A.. 1995. The CD1 family: a third lineage of antigen-presenting molecules. Adv. Immunol. 59:1.[Medline]
  26. Matsuura, A., Y. Ishii, H. Yuasa, H. Narita, S. Kon, T. Takami, K. Kikuchi. 1984. Rat T lymphocyte antigens comparable with mouse Lyt-1 and Lyt-2,3 antigenic systems: characterization by monoclonal antibodies. J. Immunol. 132:316.[Abstract]
  27. Bouwens, L., L. Remels, M. Baekeland, H. Van Bossuyt, E. Wisse. 1987. Large granular lymphocytes or "Pit cells" from rat liver: isolation, ultrastructural characterization and natural killer activity. Eur. J. Immunol. 17:37.[Medline]
  28. Kinebuchi, M., T. Ide, D. Lupin, T. Tamatani, M. Miyasaka, A. Matsuura, Y. Nagai, K. Kikuchi, T. Uede. 1991. A novel cell surface antigen involved in thymocyte and thymic epithelial cell adhesion. J. Immunol. 146:3721.[Abstract]
  29. Koseki, H., H. Asano, T. Inaba, N. Miyashita, K. Moriwaki, K. F. Lindahl, Y. Mizutani, K. Imai, M. Taniguchi. 1991. Dominant expression of a distinctive V14+ T-cell antigen receptor {alpha} chain in mice. Proc. Natl. Acad. Sci. USA 88:7518.[Abstract/Free Full Text]
  30. Morris, M., A. N. Barclay, A. F. Williams. 1988. Analysis of T cell receptor ß chains in rat thymus, and rat C{alpha} and Cß sequences. Immunogenetics 27:174.[Medline]
  31. Itoh, Y., A. Matsuura, S. Kon, M. Kinebuchi, R. Honda, S. Takayama, S. Ichimiya, K. Kikuchi. 1993. Structural analysis of CD3 {zeta}/{eta} locus of the rat: expression of {zeta} but not {eta} transcripts by rat T cells. J. Immunol. 151:4705.[Abstract]
  32. Yamaki, T., T. Uede, K. Kikuchi. 1990. Cellular mechanism of tumor rejection in rats. Nat. Immun. Cell Growth Regul. 9:1.[Medline]
  33. Chothia, C., D. R. Boswell, A. M. Lesk. 1988. The outline structure of the T-cell {alpha}ß receptor. EMBO J. 7:3745.[Medline]
  34. Koseki, H., K. Imai, F. Nakayama, T. Sado, K. Moriwaki, M. Taniguchi. 1990. Homogeneous junctional sequences of the V14+ T-cell antigen receptor {alpha} chain expanded in unprimed mice. Proc. Natl. Acad. Sci. USA 87:5248.[Abstract/Free Full Text]
  35. Ohteki, T., R. Okuyama, S. Seki, T. Abo, K. Sugiura, A. Kusumi, T. Ohmori, H. Watanabe, K. Kumagai. 1992. Age-dependent increase of extrathymic T cells in the liver and their appearance in the periphery of older mice. J. Immunol. 149:1562.[Abstract]
  36. Williams, C. B., S. Khurana, G. A. Gutman. 1990. Duplication of Tcra-V gene segments in the rat. Immunogenetics 32:134.[Medline]
  37. Mendiratta, S. K., W. D. Martin, S. Hong, A. Boesteanu, S. Joyce, L. Van-Kaer. 1997. CD1d1 mutant mice are deficient in natural T cells that promptly produce IL-4. Immunity 6:469.[Medline]
  38. Chen, Y. H., N. M. Chiu, M. Mandal, N. Wang, C. R. Wang. 1997. Impaired NK1+ T cell development and early IL-4 production in CD1-deficient mice. Immunity 6:459.[Medline]
  39. Bendelac, A., N. Killeen, D. R. Littman, R. H. Schwartz. 1994. A subset of CD4+ thymocytes selected by MHC class I molecules. Science 263:1774.[Abstract/Free Full Text]
  40. Bendelac, A.. 1995. Positive selection of mouse NK1+ T cells by CD1-expressing cortical thymocytes. J. Exp. Med. 182:2091.[Abstract/Free Full Text]
  41. Arase, H., N. Arase, Y. Kobayashi, Y. Nishimura, S. Yonehara, K. Onoe. 1994. Cytotoxicity of fresh NK1.1+ T cell receptor {alpha}+ thymocytes against CD4+8+ thymocyte population associated with intact Fas antigen expression on the target. J. Exp. Med. 180:423.[Abstract/Free Full Text]
  42. Zeng, Z.-H., A. R. Castano, B. W. Segelke, E. A. Stura, P. A. Peterson, I. A. Wilson. 1997. Crystal structure of mouse CD1: an MHC-like fold with a large hydrophobic binding groove. Science 277:339.[Abstract/Free Full Text]
  43. Wilson, I. A., K. C. Garcia. 1997. T-cell receptor structure and TCR complexes. Curr. Opin. Struct. Biol. 7:839.[Medline]
  44. Park, S. H., J. H. Roark, A. Bendelac. 1998. Tissue-specific recognition of mouse CD1 molecules. J. Immunol. 160:3128.[Abstract/Free Full Text]
  45. Joyse, S., A. S. Woods, J. W. Yewdell, J. R. Bennik, D. De Silva, A. Boesteanu, S. P. Balk, R. J. Cotter, R. R. Brutkiewicz. 1998. Natural ligand of mouse CD1d1: cellular glycosylphosphatidylinositol. Science 279:1541.[Abstract/Free Full Text]
  46. Burdin, N., L. Brossay, Y. Koezuka, S. T. Smiley, M. J. Grusby, M. Gui, M. Taniguchi, K. Hayakawa, M. Kronenberg. 1998. Selective ability of mouse CD1 to present glycolipids: {alpha}-galactosylceramide specifically stimulates V{alpha}14+ NK T lymphocytes. J. Immunol. 161:3271.[Abstract/Free Full Text]
  47. Moody, D. B., G. S. Besra, I. A. Wilson, S. A. Porcelli. 1999. The molecular basis of CD1-mediated presentation of lipid antigens. Immunol. Rev 172:285.[Medline]
  48. Koop, B. F., R. K. Wilson, K. Wang, B. Vernooij, D. Zaller, C. L. Kuo, D. Seto, M. Toda, L. Hood. 1992. Organization, structure, and function of 95 kb of DNA spanning the murine T-cell receptor C{alpha}/C{delta} region. Genomics 13:1209.[Medline]
  49. Matsuura, A., H. Chen, M. Kinebuchi, Y. Hashimoto, K. Kikuchi. 1999. Identification of a rat invariant T-cell receptor {alpha}-chain similar to mouse V{alpha}14-J{alpha}281 and human V{alpha}24-J{alpha}Q. Transplantation Proc. 31:1577.[Medline]



This article has been cited by other articles:


Home page
In VivoHome page
P. CHOPRA, P. DIIORIO, S. C. PINO, S. B. WILSON, N. E. PHILLIPS, J. P. MORDES, A. A. ROSSINI, D. L. GREINER, L. D. SHULTZ, and R. BORTELL
Failure of {alpha}-Galactosylceramide to Prevent Diabetes in Virus-inducible Models of Type 1 Diabetes in the Rat
In Vivo, March 1, 2009; 23(2): 195 - 201.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
Y.-C. Huang, S.-W. Hung, T.-R. Jan, K.-W. Liao, C.-H. Cheng, Y.-S. Wang, and R.-M. Chu
CD5-low expression lymphocytes in canine peripheral blood show characteristics of natural killer cells
J. Leukoc. Biol., December 1, 2008; 84(6): 1501 - 1510.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Pyz, O. Naidenko, S. Miyake, T. Yamamura, I. Berberich, S. Cardell, M. Kronenberg, and T. Herrmann
The Complementarity Determining Region 2 of BV8S2 (Vbeta8.2) Contributes to Antigen Recognition by Rat Invariant NKT Cell TCR.
J. Immunol., June 15, 2006; 176(12): 7447 - 7455.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. L. O'Sullivan, C. A. Skandera, and P. C. Montgomery
Lymphocyte Lineages at Mucosal Effector Sites: Rat Salivary Glands
J. Immunol., May 1, 2001; 166(9): 5522 - 5529.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuura, A.
Right arrow Articles by Sato, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuura, A.
Right arrow Articles by Sato, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS