|
|
||||||||
14 Chains1 ,2
Sapporo Medical University, School of Medicine, Department of Pathology, Sapporo, Japan
| Abstract |
|---|
|
|
|---|
-chains and NKT cells were
investigated to clarify whether CD1d-mediated recognition by NKT cells
is conserved further in evolution. Rats had multiple-copies of
TRAV14 genes, which can be categorized into two types
according to the diversity accumulated in the CDR2 region. Rats
retained invariant TCR
forms with the homogeneous junctional region
similar to mouse invariant TRAV14-J281. The proportion
of invariant TCR among V
14+ clones was 12.9% in the
thymus and increased in the periphery, 31% in the spleen and 95% in
hepatic sinusoidal cells. The invariant TRAV14-J281 was
expressed by liver sinusoidal and splenic NKT cells with CD8,
CD44high, and TCR Vß8. Type 1 invariant TCR
was
expressed more frequently in hepatic lymphocytes, while type 2
invariant TCR
was expressed predominantly in the spleen. Both types
of cells cytolyzed to and were stimulated to proliferate by
CD1d-expressing cells in a CD1d-restricted manner. These results
suggested that rat NKT cells bearing distinct V
14 chains are
distributed in a tissue-specific pattern. NKT cell populations in rats
were more variable than those in mice, indicating that they play novel
roles in nature. The implication of the molecular interaction between
the structurally diverse invariant TCR
and CD1d/ligand complex in
different organs is discussed. | Introduction |
|---|
|
|
|---|
-galactosylceramide
to NKT cells (5, 6, 7). A striking feature of these cells is
that they use an invariant TCR
-chain (V
14-J
281 in mice,
V
24-J
Q in humans) paired preferentially with particular
Vß-chains (Vß8, 7, or 2 in mice and Vß11 in humans)
(8, 9, 10). NKT cells appear to play an important role in
regulating immune responses through their rapid production of large
amounts of IL-4 upon stimulation with anti-CD3 Ab in vivo or
IFN-
upon stimulation with anti-NKR-P1 Ab in vitro (11, 12). The non-MHC-encoded CD1 family has recently emerged as a novel Ag-presenting system that is distinct from either MHC class I or class II molecules. Two classes of CD1 genes have been identified (13, 14). Whereas the classic CD1 genes were absent in rats and mice, CD1D gene has been conserved through mammalian evolution including mice, rats, rabbits, sheep, and humans (14, 15, 16, 17, 18, 19). CD1d molecules, recently referred to as Group 2 CD1 molecules including human CD1d, mouse CD1d, and rat CD1d, are expressed by a wide variety of organs, appearing strongly in the intestinal epithelium, hepatocytes, epidermal cells, and to a lesser extent in thymocytes and hematolymphoid cells (20, 21, 22, 23). On the contrary, Brossay et al. reported that murine CD1d was mainly expressed on hemopoietic cells but not by the epithelium of the digestive tracts (24). Therefore, from a phylogenetic standpoint, several investigators have hypothesized that CD1d molecules have a similar functional significance in various mammalian immune systems (1, 13, 18, 25).
To elucidate the immunological significance of NKT cells and their
interaction with CD1d, especially in a variety of unique disease models
established in rats, it is very important to obtain information about
the rat invariant TCR
-chain. This is the first report of the
nucleotide and predicted amino acid sequences of the invariant TCR
-chains in species other than mice and humans.6
Furthermore, two novel findingsa certain degree of diversity in the
rat TRAV14 genes and their tissue-specific expressionwere
revealed with regard to the invariant TCR
. We also showed a culture
system to establish the CD1d-reactive cells from heterogenous
lymphocytes, including T cells, NKT cells, and NK cells. The
significance of the interaction between the two types of invariant
TCR
-chains and CD1d and the organ specificity of invariant TCR
-chains are discussed.
| Materials and Methods |
|---|
|
|
|---|
Ten- to 14-wk-old and aged (over 12-mo-old) F344/Crj (Fischer, RT1 haplotype; lv1) and F344/Crj nude rats were used. Aged Sprague Dawley (closed colony from Charles River Breeding Laboratories, Wilmington, MA) and Wistar/Smc (RT1l) rats were also used. Cellular DNAs were prepared from 11 different rat strains; F344/Crj (lv1), LEW/Hkm (l), Wistar/Smc (l), NIGIII (q), LEJ/Hkm (j), ALB/Hok (b), BN/Hok (n), ACI/Hkm (av1), TO/Hkm (u), WKAH/Hkm (k), and W/N/Hkm (k), and BALB/c mouse. Single-cell suspensions of hematolymphoid organs were prepared as described previously (26). Hepatic sinusoidal lymphocytes (HL) were isolated by a high pressure perfusion method as described (27). After Ficoll-Conray (density, 1.096) gradient centrifugation, cells in the interface were collected, washed in PBS, and then purified by the modified nylon fiber column method described (28). Histological examination revealed that the meshwork of silver-staining fibers that highlighted endothelial cell linings parallel with liver cell plates was partially destroyed and almost all sinusoidal lymphocytes were perfused, whereas most periportal mononuclear cells remained in the liver.
Primers and probes
Three of the primers were based on originally
reported mouse V
14 and J
281 sequences (29). Forward
primers N323 (CAGAACAACCATGAAAAAGCGCCTGA) and N313
(CTAAGCACAGCACGCTGCACAT) were from exon 1 and exon 2, respectively. The
reverse primer N314 (CAGGTATGACAATCAGCTGAGTCC) was from the 3' region
of mouse TRAJ281. Rat TRAV14 primers were
prepared according to the sequences obtained by this
study.7 Forward
primers M69 (GGCTGAGGAATCAGGCAGCA) and M70 (GCTTTGGGGCTAGGCTTCTG)
were from the 5' region of exon 1, and N388 (GTGGAGCAGAGTCCCCAG) and
M15 (GTCCTTCAATGCAATTACAC) was from exon 2. Rat TRAV14
type-specific primers M72 (GACAAACAAGGAAGAGAAA) for type 1 and M73
(TGCATACAAAAAGGAGACG) for type 2 were derived from exon 2. A
reverse primer, M71 (CACCACACAGATGTAGGTGG), was from the 3' end of exon
2, where the sequences were conserved among TRAV14s. TRAJ281
reverse primers were M47 (ACTCAGCTGACTGTCACACCTG), M48
(GTTCCAATTCCAAAATACAGC), and M49 (AGCTTCCCTAGAGCTGAACCTC).
Rat TCR
-chain constant region gene (TRAC) primers were
also made according to reported rat TRAC sequences
(30); these were a forward primer, N369
(ACCCAGAACCTGCTGGGTACCAG), and reverse primers N325
(TTGCTCTTGGAATCCAGAGC), N324 (AAAGTCGGTGAACATGCAGAGGGT), and N370
(TCAACTGGACCACAGCCTTAGCGT). For screening the TRA and TRAV14 cDNA and
genomic clones, two probes, pV14J (N313/N314) and pV14 (M69/M71), were
prepared by amplification of HL cDNA from Sprague Dawley rats. A
V
14-J
281 cDNA clone (FH-II-2) was also used as a probe.
Amplification of rat invariant TRAV14 cDNA
Total RNA or mRNA of hematolymphoid cells were converted to cDNA
and subjected to RT-PCR with Tth DNA polymerase (Toyobo, Tokyo, Japan).
HL cDNA was used for amplification with the sense primer N323 derived
from the 5' region of mouse TRAV14S1 (8) and
anti-sense primer N325 from the rat C
(TRAC)
(30). The amplified fragment with an expected length of
590 bp was purified from agarose gel and subcloned into pMOSBlue vector
(Amersham Japan, Tokyo, Japan). cDNA clones positive for a V
14
internal oligonucleotide probe from exon 2 of the mouse
TRAV14S1 (N313) were isolated and sequenced. To determine
the 5' untranslated regions of TRAV14, rapid amplification
of cDNA ends (RACE) method and cycle sequencing were performed.
Expressed TRAV14 subfamily genes, TRAV14S1,
TRAV14S2, and TRAV14S3, were originally defined by
sequencing TRAV14-positive cDNA clones from thymus (30
clones), HL (13 clones), and spleen (33 clones) and by close
examination of their sequences. Because errors of nested PCR were
sometimes observed, each subfamily was defined as the same group if
only one or two nucleotide alterations existed in the amplified
segments within 369 bp; moreover consideration was given to differences
at the variable positions among rat TRAV14s. These clones
were derived from three different lymphocyte preparations from
different individual F344 rats. Three subfamilies were confirmed in the
latter experiments.
TRAV14 gene analysis
Genomic DNA of F344 rats was first amplified with high-fidelity KOD DNA polymerase (Toyobo) by using M69 from the 5' untranslated region and M71 from the 3' end of TRAV14. Then nested PCR with M70 and M71 was conducted. Amplified fragments with expected length were subcloned and individual clones were isolated and sequenced. To estimate gene numbers and study polymorphism, Southern blot analysis was done as previously described (13).
Analysis of TRAV14 expression
Expression of TRAV14 was analyzed by RACE and RT-PCR.
RACE was performed on thymus and HL. TRAC-positive clones
were picked up with toothpicks, transferred to new agarose plates (400
colonies/plate), regrown, and blotted onto a Gene Screen Plus blotting
membrane (NEN, Daiichikagaku, Tokyo). The blots were hybridized with an
FH-II-2 V
14 cDNA probe. The V
14-positive clones were sequenced
with a TRAC reverse primer (N324 or N328) or primers
suitable for the vector. For RT-PCR, cDNAs derived from HL, spleen,
thymus, and bone marrow cells were amplified first with N388 forward
primer from exon 2 and N325 reverse primer from TRAC, and
then with internal primers, M15 from exon 2 and N324 from
TRAC. To detect TRAV14 subfamilies and types, sequencing
and/or PCR analyses of cDNA clones were conducted with type-specific
primers; M72 for type 1 and M73 for type 2.
Semiquantitative analysis of TRAV14 expression was done as previously described (31). Briefly, 5 µg of each total RNA was converted to cDNA by the reverse transcription (RT) step. These cDNAs were resuspended in 50 µl of Tris-EDTA buffer and 1 µl of these, corresponding to 100 ng of total RNA (referred to as 1x) was used for amplification. Because the efficiency of RT seemed to be different in each experiment and in each batch of total RNA, these procedures were done at the same time, in the same experimental conditions. Furthermore, serially diluted samples were amplified with ß-actin primers to evaluate the quality and quantity of cDNA. Based on the intensity of ß-actin bands, the amount of cDNA used for amplification could be adjusted. cDNA used for amplification corresponded to the total RNA as follows: lane 1, 100 ng (1x); lane 2, 50 ng (1/2, one second dilution); lane 3, 25 ng (1/4); lane 4, 12.5 ng (1/8); lane 5, 6.25 ng (1/16); lane 6, 3.125 ng (1/32); lane 7, 1.5625 ng (1/64); lane 8, 0.78125 ng (1/128); lane 9, 0.390625 ng (1/256); and lane 10, 0.1953125 ng (1/512). Because ß-actin content is very high in the RNA preparation, serial dilution was started from a more diluted point: lane 1, 5 ng (1/20); lane 2, 2.5 ng (1/40); lane 3, 1.25 ng; lane 4, 0.625 ng; lane 5, 0.3125 ng; lane 6, 0.15625 ng; lane 7, 0.078125 ng; lane 8, 0.0390625 ng; lane 9, 0.0195312 ng; and lane 10, 0.097656 ng.
51Cr-release assay
51Cr-release assay was done according to the procedure previously described (32). For the cold-target inhibition test, 50 µl of 51Cr-unlabeled cells (cold target cells) was added with 50 µl of 51Cr-labeled CD1d transfectants at ratios of 4:1, 2:1, and 1:1. Then, 100 µl of effector hepatic lymphocytes was added at an E:T ratio of 25:1. The percent specific lysis was calculated as follows: [(mean experimental cpm - mean spontaneous cpm)/(mean maximum cpm - mean spontaneous cpm)] x 100.
Abs and flow cytometry
Monoclonal Abs against rat lymphoid cells for CD3 (1F4), CD5
(R1-3B3), CD4 (W3/25), and CD8 (R1-10B5) were made in our laboratory or
obtained from Seikagaku Kogyo (Tokyo, Japan). The mAbs for NKRP-1A
(10/78), TCR-Vß8.2 (R78), TCR-Vß8.5 (B73), TCR-Vß10 (G101),
FITC-conjugated 10/78, PE-conjugated R73, biotin-conjugated
anti-rat CD44 (OX49), and streptavidin Cy-Chrome were purchased
from PharMingen (San Diego, CA). The mAbs for TCR-Cß (R73) and
TCR-
(V65) were kindly supplied by Dr. T. Hünig (University of
Würzburg, Würzburg, Germany). The polyclonal Ab against rat
CD1d was described previously (16). Cells were harvested
after different periods of time and stained by the indirect
immunofluorescence technique as described. Stained cells were analyzed
and sorted by FACScan (Becton Dickinson, San Jose, CA) and FACScalibur
(Becton Dickinson).
Proliferation assay
Freshly isolated HL or splenic lymphocytes (1 x 104), purified using the modified nylon fiber column method, were combined with the 1 x 104 or 5 x 104 irradiated CD1d transfectants or irradiated parent cells for 24, 48, 72, and 96 h in flat-bottom 24-well plates in the absence of the stimulants. After the specified time, cells were pulsed for 8 h with 1 µCi [3H]thymidine and harvested. Abs to CD1d (2.5 µg/ml) were added to HL at the initiation of the incubation with the CD1d transfectants.
| Results |
|---|
|
|
|---|
Four rat TRAV14 genes, referred to as
TRAV14S1, TRAV14S2, TRAV14S3, and
TRAV14S4, highly similar to each other and to mouse
TRAV14 and human TRAV24, were identified. Deduced
amino acid sequences are aligned in Fig. 1
A. Complete 5' untranslated
regions of rat TRAV14 were determined for
TRAV14S3 by RACE and nucleotide sequencing (data in DDBJ
accession no. AB036696). A fourth TRAV14S4 subfamily was found by
genomic PCR analysis of F344 strain, but no mRNA was detected by RT-PCR
analysis. The predicted TRAV14S4 protein had an amino acid
phenylalanine (TTT) at codon 40 instead of cysteine (TGT) in other
TRAV14s (Fig. 1
A). Lack of the cysteine residue may nullify
the intrachain disulfhydryl bond affecting the V domain of TRAV14S4,
which in turn destroys TCR cell-surface expression or may affect the
interaction of TRAV14S4 TCR
-chain with other molecules important
for the trafficking of the TRAV14 to cell-surface membrane. Therefore,
TRAV14S4 mRNA might be excluded from the positively selected T cell
populations.
|
|
Eleven amino acid positions, 4, 36, 40, 64, 72, 73, 75, 77, 80,
89, and 90, numbering first methionine as No. 1, were diversified among
rat TRAV14 proteins (Fig. 1
A). Six positions, 4H
(histidine), 72T (threonine), 73N (asparagine), 75E (glutamic acid),
77K (lysine), and 80R (arginine), were common to TRAV14S1, TRAV14S2,
and TRAV14S4. Amino acids composed of complementarity determining
region (CDR) 1, from 47 to 53 (TVTPFNN) according to Chotia et al.
(33), were conserved among four families. However, the
sequences of the CDR2 region, from 70 to 77, were obviously different
and could be grouped into two types. Type 1 included
TRAV14S1, TRAV14S2, and TRAV14S4
(VLTNKEEK), and type 2 included TRAV14S3 (VLAYKKET).
Four of eight amino acids were diversified. In contrast, only a 3-aa
stretch within the CDR2 region was different between the two mouse
subfamilies: DQK (position 7375) in mouse TRAV14S1 was
substituted to HEN in mouse TRAV14S2 (Ref. 34
and Fig. 1
A).
Evolutionary trees constructed by both UPGMA and neighbor-joining
methods further support the categorization into two types, because type
1 TRAV14s genes had a common root and type 2
TRAV14 (TRAV14S3) was more related to mouse
TRAV14s and human TRAV24 (Fig. 1
D).
Identification of invariant TCR
in the rat
The J regions of TRAV14-positive cDNA clones from HL were
sequenced. Almost all of the TRAV14s (proportion described
in next sections) were rearranged with a new rat J
-chain, referred
to here as rat TRAJ281, which is highly similar to mouse TCR
J
281 (TRAJ15) (Fig. 1
B). The percent
similarity of rat TRAJ281 to its mouse and human
counterparts was 76.2 and 80.9%, respectively. The V14-J281 joint
consisted of a single small amino acid, alanine (encoded by GCc or GCg)
or glycine (GGc, GGt, GGg) (Fig. 1
C). Whereas the exact
origin of these nucleotides could not be determined as no information
about rat germline J region is available, the CDR3 region of rat
TRAV14-J281 is homogeneous, as is the case with mouse and human
invariant TCR
-chains.
Expression of TRAV14 and invariant TRAV14-J281 in different organs
By RACE performed on thymus and HL, 10 of 384 TCR C
-positive
clones from thymus (2.6%) and 19 of 662 clones from HL (2.87%)
contained TRAV14 sequences. Of these, none of the thymus (0%) and five
of the HL (0.76%) had homogeneous junctional sequences (invariant
TRAV14-J281). Thus, TRAV14 expression is very low
in rat T cells. To more accurately determine the level of
TRAV14 expression, semiquantitative RT-PCR analysis was
performed. It was highest in HL (amount scored 1), followed by spleen
(1/32) and then thymus (1/64), as estimated from the visible bands
appearing in the series of diluted samples (Fig. 3
A).
|
among expressed TRAV14
genes was investigated for HL, spleen, thymus, and bone marrow by
RT-PCR amplification using TRAV14 and TRAC primers. The results are
summarized in Fig. 3
14+ clones had invariant TCR
. The
proportion of invariant TCR
among V
14+
clones was increased in the periphery, 31.1% in spleen, and extremely
high, up to 94.6%, in HL.
We then asked whether the two types of rat TRAV14 were
expressed in a tissue-specific manner. Almost the same proportion of
type 1 and type 2 transcripts were found in the thymus, liver, and bone
marrow (Fig. 4
A). In
particular, type 2 TRAV14S3 gene was expressed predominantly in spleen.
Sixty-seven of 82 (81.7%) TRAV14 clones from the spleen were in the
type 2 category. The proportion of type 1 and type 2 invariant TCR
in each organ is summarized in Fig. 4
B. In the liver, type 1
invariant TRAV14-J281 (type 1 invariant TCR
) clones were
more frequently observed than type 2 (type 2 invariant TCR
) clones;
69 type 1 and 44 type 2 clones. Almost the same number of type 1 and
type 2 invariant TCR
clones were observed in bone marrow (26 type 1
and 24 type 2). Of particular interest, type 2 invariant TCR
was
most frequently observed in spleen (81.5%, 22 of 27 invariant TCR
,
Fig. 4
B). From these results, we concluded that the rat
TRAV14s and their invariant derivatives showed a certain
degree of tissue-specific expression.
|
Because little is known about lymphocyte subpopulations in the
normal rat liver, we analyzed the surface phenotypes of lymphocytes
isolated from the liver sinusoids, and spleen, staining them with a set
of mAbs. In the studies described below we used lymphocytes, purified
using a modified nylon fiber column method, which contained T cells, NK
cells, and NKT cells, but not B cells or macrophages. Nearly half of
the total of hepatic and splenic lymphocytes were
ßT cells, 37%
were NKT cells, and 10% were NK cells (Table I
). Furthermore, the fluorescence
intensity of NKR-P1A had two-peak patterns for rat T cells and NKT
cells in the liver and the spleen (Fig. 5
A), like that of TCR for
mouse NKT cells in the liver and the thymus (35). NKT
cells existed both in the NKRhigh and
NKRdull subsets. Interestingly, hepatic NKT cells
existed mainly in NKRdull subsets. The ratio of
NKRhigh-NKT cells to
NKRdull-NKT cells in the hepatic sinusoids and
the spleen was 1:10 and 1:3, respectively. Approximately 80% of
hepatic T cells expressed CD4, 17% of them expressed CD8, and 1.5%
expressed neither CD4 nor CD8. Half of splenic T cells expressed CD4,
and the majority of the other splenic T cells expressed CD8 (Table II
). Unexpectedly, most rat hepatic and
splenic NKT cells expressed CD8. Thus, most hepatic and splenic NKT
cells expressed CD8 and CD44high.
|
|
|
ßTCR mAb or PE-conjugated anti-NKR mAb. Each of
Vß8.2, Vß10, and Vß16 were expressed in hepatic T cells and NKT
cells at
5 and 10%, respectively (Fig. 5
Thus, TCR Vß8, the major partner of an invariant TCR
in mice, was
not expressed dominantly in either NKT cells or T cells in the normal
rat liver and spleen.
CD1d-restricted cytolytic activity of tissue-specific lymphocytes
To elucidate the function of rat CD1, we first examined the
cytotoxic activity of the lymphocytes to CD1d transfectants in the
thymus, lymph nodes, spleen, and hepatic sinusoids by CTL assay in
vitro. As shown in Fig. 6
A,
hepatic lymphocytes killed CD1d transfectants, but did not kill the
parent cell line. Splenic lymphocytes had relatively low cytotoxicity.
Thymocytes and lymph node cells did not show any cytotoxity. Cold
(i.e., cells that had not been labeled with 51Cr)
CD1d transfectants and CD1+ thymocytes were able
to compete for lysis of hot (labeled with 51Cr)
CD1d transfectants (Fig. 6
B). These results indicated that
hepatic lymphocytes directly recognized CD1d expressed on killing
targets.
|
CD1 induces proliferation of rat hepatic lymphocytes and
TCR-
ß+ NKRdull cells
Incubation of HL with CD1d transfectants for 72 h in the
absence of exogenously added cytokines resulted in proliferation as
assessed by incorporation of [3H]thymidine
(Fig. 7
A). The reaction was
blocked by addition of anti-CD1 Ab at the initiation of the
incubation. In contrast, cultures of HL-containing medium alone showed
progressive cell death over the duration of the culture. In cultures
with the parent cell line, most surviving cells were NK cells by
24 h, and apoptosis was nearly complete by 72 h. In striking
contrast to freshly isolated HL, the majority of surviving cells in
cultures with CD1d transfectants expressed Vß8.2 at 72 h (Fig. 7
B).
|
14-J
281 expression was detected by RT-PCR in HL in
cultures with CD1d transfectants at 96 h (Fig. 7
, V
14-C
, and V
14-J
281 were not detected in
HL in cultures with the parent cells at 48, 72, or 96 h. TCR
expression was not detected in any of the cases.
CD1d/endogenous Ag stimulation impartially induces type 1 and type
2 invariant TCR
+ NKT cells
To elucidate the possible roles of different types of
TRAV14s in different organs, the type of TRAV14
expressed in the proliferating hepatic and splenic NKT cells by the
stimulation of CD1d without exogenous Ag was studied using the
quantitative PCR method and direct sequencing. The ratios of type 1 to
type 2 TRAV14 expressed on proliferating NKT cells in this
system were similar to those in freshly isolated
V
14+ NKT cells both in the spleen and liver
sinusoids (Fig. 7
D).
| Discussion |
|---|
|
|
|---|
-chains highly similar to mouse
TRAV14-J281 and human TRAV24-J18. Remarkable
homogeneity of their CDR3 regions implies that a part of the ligand
molecules (carbohydrate or protruding portion) bound to the CD1d facing
them is mainly constant in rats as in mice and humans. Multiplicity of
rat TRAV14s may correspond to a previous notion by Southern
blot analysis, in which a duplication event encompassing a large
portion of the TRAV locus occurred in the rat
(36). This is in extreme contrast to mouse
TRAV14, as most laboratory mouse strains harbor a
single-copy gene; mouse TRAV14S1 in 17 strains or mouse
TRAV14S2 in 4 strains. Only two strains, DBA/1 and DBA/2,
had both genes (29). This multiplicity was not a simple
numerical expansion, rather the rat TRAV14 genes are more
diverse and polymorphic than previously inferred from the studies of
mice and humans, in which the invariability of the V domain has been
emphasized (8, 9, 10, 29). The rat TRAV14s were
divided into two types based on the diversity in the CDR2 region. Both
types of invariant TRAV14-positive NKT cells, showing
tissue-specific distribution, existed in rats and were simultaneously
proliferated by and cytolysed to CD1d-expressing transfectants. Such
CD1d-reactive NKT cells were enriched in the adult rat liver sinusoids.
Whereas most features were common to mouse NKT cells, several
characteristics were unique in the rat. For example, skewed TCR Vß
usage was not very obvious for freshly isolated rat NKT cells (Fig. 5Proliferation and survival of hepatic NKT cells upon CD1d stimulation suggested that CD1d may play a role in hemopoiesis in the adult rat liver via the expansion or maintenance of NKT cells, in addition to the necessity of CD1d for the differentiation of mouse NKT cells in their early development and in the adult thymus (37, 38, 39, 40). As these autoreactive rat NKT cells have cytotoxic potential, as in mice (41), they may also contribute to tissue homeostasis, such as ordinary turnover of hepatocytes that strongly express CD1d molecules (22). Rat CD1d in the liver may also act as Ag-presenting molecules in emergent needs for protection against microorganisms from the intestine and blood. Besides hepatocytes, the kind of cells that express CD1d in the normal and inflamed rat liver needs to be determined.
Based on the crystal structures reported (42, 43), an
insight into the molecular interaction between TCR, CD1d, and ligands
was gained from the observation that "two types" of rat invariant
TRAV14-positive NKT cells showed tissue-specific distribution. Because
the variability was found in the CDR2 region, one can speculate that
interaction surfaces created by the CD1
2 helix and a part of the
ligands might be different from organ to organ. Park et al. reported
that autorecognition of mouse CD1 molecules by T cell hybridomas
expressing the invariant TCR
-chains was highly dependent on the
cell types in which mouse CD1 was expressed (44). Because
most mouse strains have only one type of invariant TCR
, the fine
specificity difference may be explained by the variety of self ligands
and by diversity of the paired TCR ß-chain. In such a situation,
perhaps also in humans, the opposite side of the surfaces formed by
CD1
1 helix and ligands is important for perception. Upon coculture
with CD1d-transfected cells, the proportion of type 1 and type 2
invariant NKT cells from the liver and that of spleen were unaltered,
indicating that the destination of types has already been determined in
the origin of tissues or that self ligands/CD1d of transfectants have
had insufficient force to drive them into distinctly differentiated
pathways. Whether tissue-specific Ags loaded onto a hydrophobic
ligand-binding groove of CD1d or tissue-specific modification of CD1d
itself is responsible for the restriction of the types of TRAV14 needs
to be clarified.
Recently, cellular GPI has been identified to be a major ligand of
mouse CD1d1 by mass spectrometry and metabolic radiolabeling analysis
(45). By assumption, >90% of CD1d1 was occupied by GPI.
However, it has been shown that glycolipids, such as
phosphatidylinositol, a synthetic PIM2 (a
phosphatidylinositol with two additional
-D mannose groups), and
lipoarabinomannan purified from M. tuberculosis could not
stimulate unprimed spleen cells from TAP-/-
mice which had TL- and CD1-dependent cells but did not have
TAP-dependent, MHC class I-dependent cells. In contrast,
-galactosylceramide could do so (46). Because the
-anomeric form of glycolipids are not natural constituents of
mammals, other hydrophobic ligands with certain degrees of
heterogeneity might be associated with some fractions of CD1d molecules
and might shape autoreactive cell pools in each organ. In vivo natural
ligands of CD1d that are capable of stimulating lymphocytes should be
clarified.
Athymic nude rats had a relatively high proportion of TRAV14 transcripts with a variable CDR3 region and a different kind of invariant TRAV-J transcript was found (H.-Z. Chen and A. Matsuura, unpublished observation). Our study revealed that NKT populations in rats were more variable than in mice, suggesting they have novel roles in nature.
| Footnotes |
|---|
2 The nucleotide sequence data reported in this paper will appear in the DDBJ/EMBL/GenBank nucleotide databases under accession numbers AB036694AB036697. ![]()
3 Address correspondence and reprint requests to Dr. Akihiro Matsuura, Department of Pathology, School of Medicine, Sapporo Medical University, South-1, West-17, Chao-ku, Sapporo 060-8556, Japan. E-mail address: ![]()
4 Present address: Dr. Miyuki Klinebuchi, Department of Pathology, School of Medicine, Gifu University, Tsukasa-machi Gifu, 570-8705, Japan ![]()
5 Abbreviations used in this paper: NKT, NKR-P1-positive T cells; HL, hepatic lymphocytes; RACE, rapid amplification of cDNA ends; CDR, complementarity determining region. ![]()
6 A part of this work was presented at the 12th International Workshop on Alloantigenic Systems in the Rat, held in Halifax, Canada. A. Matsuura, H. Chen, M. Kinebuchi, Y. Hashimoto, and K. Kikuchi, 1998 (49). ![]()
7 Nomenclature of rat TRAV14 and TRAJ281 is in accord with IMGT numbering and based on similarity to mouse TRAV14S1 and TRAJ281 (J15), respectively. Because rat TRAJ genes have not been well-characterized, we used TRAJ281 to respect the original identification by Imai et al. (8 ). ![]()
Received for publication September 21, 1999. Accepted for publication December 30, 1999.
| References |
|---|
|
|
|---|
24+ CD4-CD8- T cells. J. Exp. Med. 186:109.
ß T cells expressing invariant TCR
-chains. J. Immunol. 158:5603.[Abstract]
ß+ cells. Int. Immunol. 9:1043.
-galactosylceramide by natural killer T cells is highly conserved through mammalian evolution. J. Exp. Med. 188:1521.
14 NKT cells by glycosylceramides. Science 278:1626.
-chain gene in a functional, antigen-specific suppressor-T-cell hybridoma. Proc. Natl. Acad. Sci. USA 83:8708.
24-J
Q/Vß11 T cell receptor is expressed in all individuals by clonally expanded CD4-CD8- T cells. J. Exp. Med. 180:1171.
chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4-8- T cells in mice and humans. J. Exp. Med. 180:1097.
production by natural killer cells and NK1.1+ T cells upon NKR-P1 cross-linking. J. Exp. Med. 183:2391.
chain in mice. Proc. Natl. Acad. Sci. USA 88:7518.
and Cß sequences. Immunogenetics 27:174.[Medline]
/
locus of the rat: expression of
but not
transcripts by rat T cells. J. Immunol. 151:4705.[Abstract]
ß receptor. EMBO J. 7:3745.[Medline]
chain expanded in unprimed mice. Proc. Natl. Acad. Sci. USA 87:5248.
/ß+ thymocytes against CD4+8+ thymocyte population associated with intact Fas antigen expression on the target. J. Exp. Med. 180:423.
-galactosylceramide specifically stimulates V
14+ NK T lymphocytes. J. Immunol. 161:3271.
/C
region. Genomics 13:1209.[Medline]
-chain similar to mouse V
14-J
281 and human V
24-J
Q. Transplantation Proc. 31:1577.[Medline]
This article has been cited by other articles:
![]() |
Z. Stojic-Vukanic, A. Rauski, D. Kosec, K. Radojevic, I. Pilipovic, and G. Leposavic Dysregulation of T-Cell Development in Adrenal Glucocorticoid-Deprived Rats Experimental Biology and Medicine, September 1, 2009; 234(9): 1067 - 1074. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. CHOPRA, P. DIIORIO, S. C. PINO, S. B. WILSON, N. E. PHILLIPS, J. P. MORDES, A. A. ROSSINI, D. L. GREINER, L. D. SHULTZ, and R. BORTELL Failure of {alpha}-Galactosylceramide to Prevent Diabetes in Virus-inducible Models of Type 1 Diabetes in the Rat In Vivo, March 1, 2009; 23(2): 195 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Huang, S.-W. Hung, T.-R. Jan, K.-W. Liao, C.-H. Cheng, Y.-S. Wang, and R.-M. Chu CD5-low expression lymphocytes in canine peripheral blood show characteristics of natural killer cells J. Leukoc. Biol., December 1, 2008; 84(6): 1501 - 1510. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Pyz, O. Naidenko, S. Miyake, T. Yamamura, I. Berberich, S. Cardell, M. Kronenberg, and T. Herrmann The Complementarity Determining Region 2 of BV8S2 (Vbeta8.2) Contributes to Antigen Recognition by Rat Invariant NKT Cell TCR. J. Immunol., June 15, 2006; 176(12): 7447 - 7455. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. O'Sullivan, C. A. Skandera, and P. C. Montgomery Lymphocyte Lineages at Mucosal Effector Sites: Rat Salivary Glands J. Immunol., May 1, 2001; 166(9): 5522 - 5529. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |