| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Departments of
*
Bacteriology,
Internal Medicine, and
Pathology, Yokohama City University School of Medicine, Yokohama, Japan;
§
Department of Microbiology, Tokyo Dental College, Chiba, Japan; and
¶
Center for Biologics Evaluation and Research/Food and Drug Administration, Bethesda, MD 20892
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(13), IL-12 (11, 14, 15), TCA3
(16), and others (5). We have been investigating the effect of a plasmid-encoding GM-CSF (pGM-CSF)3 on humoral and cellular immunity. We previously reported that the simultaneous intranasal administration of a DNA vaccine with pGM-CSF induced both systemic and mucosal Ab production (17). GM-CSF has been reported to initiate the proliferation, differentiation, and activation of macrophages, neutrophils, and various APCs (18, 19, 20, 21, 22, 23). Cytokine-encoding plasmids not only increase Ag-induced immune responses but can also alter the Th1:Th2 cytokine balance (8, 9, 10, 12, 14, 16, 17, 24, 25, 26).
In the present study, we observed that the timing of pGM-CSF administration had a significant impact on the resultant Th response. We were also interested in optimizing mucosal and cell-mediated immunity to HIV-1 and thus examined the effect of coadministering the HIV DNA vaccine in combination with plasmids encoding several different cytokines or costimulatory molecules. Finally, the mechanism of immune enhancement induced by pGM-CSF was examined using an in vivo transfer system involving bone marrow-derived dendritic cells (DCs) incorporating the DNA vaccine. This also provided insight into the potential of passively transferred DNA-pulsed DCs on the induction of an immune response.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Six- to 10-wk-old BALB/c female mice were purchased from Japan SLC (Shizuoka, Japan).
Plasmids and reagents
The following expression plasmids were used: pCMV160IIIB, which
encodes gp160 of HIV-1IIIB, and pcREV-encoding
HIV-1 rev (27); an IL-12 expression plasmid
(pCAGGS IL-12), which encodes both the p40 and p35 subunits of IL-12
(17, 26), donated by Dr. J. Miyazaki (Osaka University);
and IL-4 expression plasmid (pCAGGS IL-4), also donated by Dr. J.
Miyazaki, which encodes IL-4 cDNA (17); an IL-2 expression
plasmid (BCMGNeo-mIL-2) (28), kindly donated by Dr. H.
Karasuyama (Department of Immunology, Tokyo Metropolitan Institute of
Medical Science); a TNF- expression plasmid, donated by Riken Gene
Bank (Ibaraki, Japan); an IFN-
expression plasmid, a gift from Dr.
H. Uesaka, (Tokyo Dental College, Chiba); an GM-CSF expression plasmid
(pGM-CSF), a kind donation from Dr. H. L. Davis (Loeb Medical
Research Institute, Ottawa, Ontario, Canada) (29); and
empty vector, which was a construct derived from pGM-CSF by removing
the cytokine gene. For vaccine immunization, the
HIV-1IIIB-derived gag region plasmid, which was a
combined construct of gag DNA and CMV promoter (J. Fukushima et al.,
unpublished observations) was used. The rat monoclonal anti-mouse
GM-CSF Ab (05-169; Upstate Biotechnology, Lake Placid, NY)
(anti-GM-CSF mAb) was purchased from Wako Life Sciences (Osaka,
Japan), and rat anti-mouse IL-12 mAb were received from Dr. G.
Trinchieri (The Wistar Institute, Philadelphia, PA). The rat monoclonal
anti-mouse IL-4 Ab was purchased from PharMingen (San Diego, CA).
The rabbit Ab for sperm whale myoglobin (Mb; Sigma, St. Louis, MO) was
obtain by immunizing Mb with CFA three times (30), and the
Ab titer of reciprocal log2 was 15.3 using ELISA
assay. This Ab was affinity purified using a Mb-conjugated column.
Immunization
The protocol used for i.m. immunization was previously described (27). Briefly, 100 µl of PBS containing 20 µg of the DNA vaccine plasmids (15 µg of pCMV160IIIB and 5 µg of pcREV, hereafter referred to DNA vaccine or pGP160) or 10 µg of adjuvant plasmid, or both, was inoculated directly into the gastrocnemius muscle of mice. The same procedure of immunization employing the same dose of immunogen was used for repeat immunizations on days 7 and 21. Five to 7 days after the last boost, immune responses were studied. To study the effect of GM-CSF plasmid on the immune activation induced by the DNA vaccine, 10 µg of pGM-CSF was administered i.m. into mice 3 days before or after DNA vaccination. In some experiments, pGM-CSF was injected into the gastrocnemius muscle of another foot. The mAbs were injected i.p. on two consecutive days 3 days after or before pGM-CSF administration. All cytokine expression plasmids except pGM-CSF were injected on the same day as the DNA vaccination.
Histology
The samples were fixed with 10% neutral-buffered formalin solution (Sigma) and embedded in paraffin. Slices (4 µm thick) were prepared and stained with hematoxylin-eosin. For immunohistochemical analysis, slices were deparafinized and rehydrated. These specimens were treated with 0.5% H2O2 solution for 15 min to block the endogenous peroxidase activity. These treated samples were incubated with a primary Ab using Histofine immunodetection system (Nichirei, Tokyo, Japan) according to the manufacturer’s protocol.
Analysis of CD8+ and CD11c+ cells in regional lymph nodes
Three days after pGM-CSF injection, regional lymph nodes were collected, and partial purification of DCs was conducted using a previously described method (31). As a control, nonimmune lymph nodes from mice, which have not been given pGM-CSF, were also collected and studied. Lymph node cells from three to five mice were pooled, suspended, and placed in a petri dish in RPMI 1640 medium supplemented with 2% heat-inactivated mouse serum plus 5 x 10-5 M 2-ME. After 2 h, nonadherent low-density cells were removed by gentle Paster pipetting, and adherent cells were cultured again with the same RPMI 1640 media at 37°C in a CO2 incubator. After 12 h, the nonadherent cells were collected and stained with FITC-labeled anti-CD11c Ab (PharMingen) and PE-labeled anti-CD8 Ab (PharMingen). These stained cells were analyzed with a FACScan (Becton Dickinson, Franklin Lakes, NJ).
Purification of DCs and in vitro immunization
A detailed protocol of DC purification was previously described (32). Briefly, after removing all muscle tissues from the femur and tibia, both ends of the bones were cut and the marrow was flushed out using 2 ml of RPMI 1640 with a syringe and a 25-gauge needle. The tissue was suspended, passed through nylon mesh, and the RBC were lysed with ammonium chloride. Lymphocytes and class II-positive cells in the culture were removed with a mixture of mAbs and rabbit complement for 60 min at 37°C. The mixture of mAbs contains GK1.3 anti-CD4, HO2.2 anti-CD8, B21-2 anti-Ia, and RA3-3A1/6.1 anti-B220/CD45R (American Type Culture Collection, Manassas, VA). Then, the culture was incubated with 200 U/ml rGM-CSF and rIL-4 (20 ng/ml; Genzyme, Framingham, MA), and the medium was replaced with medium containing the same concentrations of cytokines every 2 days to enrich the loosely adherent proliferating DC aggregates. On day 8 of culture, the released mature, nonadherent cells with the typical morphological features of DCs were used for in vitro phenotypic and functional analysis as well as for the immunization of mice. The FACS analysis of these recovered cells revealed over 60% of both CD11c and CD86 Ag-positive cells.
In vitro immunization was performed using these in vitro-cultured DCs. The method of DNA transfection followed that previously reported (6, 33, 34). Briefly, 20 µg of DNA plasmids were mixed with 40 µg of Lipofectin in a polystyrene container. The solution was brought to a volume of 50 µl with PBS, mixed, and allowed to sit in a CO2 incubator for 15 min. The DNA and Lipofectin complex was mixed with 3 ml of EX-cell/TM 400 serum-free medium (IRH Bioscience, Lenexa, KS) and added to a 25-cm2 flask containing 1–3 x 106 DCs. These cells were incubated at 37°C in an atmosphere containing 5% CO2. After 6 h, these cells were washed and transferred into naive mice. The HIV-1-specific delayed-type hypersensitivity (DTH) response was assayed after 10 days. When the CTL and Ab responses were assayed, these cell transfers were repeated after 7 and 21 days, and the immune responses of these mice were tested.
Sample collection
Sera and fecal samples were prepared as described elsewhere (2). Briefly, sera were collected by retro-orbital puncture under anesthesia with diethyl ether and stored at 4°C until use. Fecal pellets (100 mg) were suspended in 1 ml of PBS. After centrifugation at 12,000 rpm, the supernatants were collected and stored at -20°C until use.
DTH response
The DTH response was assessed using a footpad swelling method as previously described (27). Briefly, 25 µl PBS containing 4 µg of an HIV-1IIIB V3 peptide (RGPGRAFVTIGK) (35) was injected into mouse footpads. Control mice were injected with the same dose of sperm whale Mb peptide, ALVEADVA (30). As the other control Ag, HGP-30 peptide (YSVHQRIDVKVTKEALEKIEEEQNKSKKKA) (36) was also employed. After 24 h, the extent of footpad swelling was evaluated as the difference in thickness in units of 10-2 mm between the preinjected and postinjected footpads.
CTL assay
Spleen and regional lymph node cells were collected around the third day after the last immunization (27). Approximately 1 x 106 lymphoid cells from the immunized mice were restimulated in vitro with HIV-1 V3 peptide (RGPGRAFVTI)-pulsed syngeneic spleen cells. After culturing for 5 days, the cytotoxic activity of these spleen cells was measured by a 6-h 51Cr release assay using V3 peptide-pulsed target cells. The target cells were prepared using the same HIV-1 V3 peptide-pulsed P815 cells (H-2d). The percentage of specific 51Cr release was calculated as 100 x (experimental release - spontaneous release)/(maximum release - spontaneous release). Target cells incubated in medium alone and with medium plus 5% Triton X-100 were used to determine spontaneous and maximum chromium release, respectively.
RT-PCR assay
Total RNA was isolated from about 0.1 g of cultured DCs or bone marrow cells using an RNAzol B kit (Biotecx Laboratories, Houston, TX). One microgram of total RNA was reverse transcribed by methods described elsewheres (37, 38). PCR primers for IL-4 and ß-actin mRNA were constructed as the following sequence. For IL-4, the 5' primer was TCG GCA TTT TGA ACG AGG TC and the 3' primers were GAA AAG CCC GAA AGA GTC TC. For ß-actin, the 5' primer was TGGAATCCTGTGGCATCCATGAAAC and the 3' primer was TAAAACGCAGCTCAG T AACAGTCCG.
ELISA
The titers of serum IgG, IgG1, IgG2a, and fecal IgA against HIV-1 were examined on days 14 and 28 after immunization using ELISA as described elsewhere (26, 27). Briefly, 96-well microtiter plates were coated with 5 mg/ml of HIV-1IIIB V3 peptide (NNTRKSIRIQRGPGRAFVTIGKIGN) or a sperm whale Mb peptide, ALVEADVA. The wells were treated with PBS containing 1% BSA and incubated for 1 h at room temperature. Then they were treated with 100 µl of a 1-in-500 dilution of mouse serum and incubated for an additional hour at 37°C. The bound Ig was characterized using affinity-purified HRP-labeled anti-mouse IgG, IgG1, or IgG2a (Organon Teknika, West Chester, PA). For the estimation of secretory IgA Ab against the HIV-1IIIB V3 peptide, rabbit anti-rat secretory component Ab (kindly provided by Dr. B. Underdown, McMaster University Medical Center, Hamilton, Ontario, Canada) was also used. Ab titers were expressed as the reciprocal log2 value of the final detectable dilution, which gave an OD at 490 nm (OD490) of >0.2 OD units above the preimmune control.
For quantification of IFN- and IL-4, freshly isolated splenic
mononuclear cells were cultured in the presence of a V3 peptide. This
peptide, RGPGRAFVTIGK, contains both a helper (39) and a
CTL (40) epitope for HIV-1IIIB.
Culture media were collected 48 h after the initiation of cell
culture, and the cell-free supernatants were stored at -80°C until
use. Cytokine levels in these samples were measured with a commercial
EIA kit (Cytoscreen; Biosource, Beverly, MA) according to the
manufacturer’s instructions.
Cytokine enzyme-linked immunospot (ELISPOT) assay
Cytokine ELISPOT assay was performed as previously described
(41). Lymphoid cells were isolated from popliteal and
inguinal lymph nodes 7 days after the third immunization. Serial 3-fold
dilutions of a single-cell suspension, starting with 5 x
106 cells/well, were incubated at 5%
CO2, 37°C for 12 h with or without 10
µg/ml of V3 peptide. Detection kits for cytokines using alkaline
phosphatase-labeled Abs (PharMingen) were used for detecting IL-4 and
IFN--producing cells. Spots were counted in each well, and the
dilution was used to calculate the total number of cytokine-secreting
cells/samples.
Data analysis
All values were expressed as means ± SE. Statistical analysis of the experimental data and controls was conducted by one-way factorial ANOVA, with the levels of significance defined as p < 0.05 and 0.01.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BALB/c mice were immunized i.m. with 15 µg of pCMV160IIIB plus 5
µg of pcREV. We previously showed that this combination of plasmids
induced the production of IgG anti-gp160 Abs (27). In
an effort to boost this response, we examined the effect of
coadministering pGM-CSF with pGP160 (Table I
).
|
, pGM-CSF had a maximal effect on
Ag-specific IgG levels when administered before pGP160, boosting serum
titers 8-fold. We then analyzed the effect of pGM-CSF on the mucosal
immune response of pGP160IIIB-vaccinated mice. HIV-1-specific mucosal
IgA titers were significantly increased when pGM-CSF was administered 3
days before DNA vaccination (Table I). The IgG2a Ab titer was enhanced,
when pGM-CSF was injected 3 days after pGP120 injection. In the mouse
injected with pGP160 and pGM-CSF, each into a different foot, the Ab
production was not so effectively enhanced, which suggests the
importance of the local accumulation effect of pGM-CSF. Both the
mucosal and systemic rise in Ab titer were inhibited by anti-GM-CSF
mAb. This type of enhancement was also observed using sperm whale Mb as
an immunogen. As shown in Table I, pGM-CSF inoculation also enhances
Mb-specific Ab production when pGM-CSF was inoculated before 3 days of
Mb immunization.
In contrast, pGM-CSF maximally increased the production of Ag-specific
CTL when administered 3 days after pGP160 (Fig. 1, A and B). The
same effect on DTH was observed in assays of footpad swelling (Table II). The same effect was also observed
using Mb Ag. However, this enhancing effect was inhibited by injection
of anti GM-CSF mAb. In the mouse injected with pGP160 and pGM-CSF, each
into a different foot, the swelling response was not so effectively
enhanced. To determine the basis of this differential effect, we
examined cytokine production by lymphocytes from these mice. Spleen and
lymph node cells were cultured in vitro with a peptide encoding the V3
region of gp160, and the production of IL-4 and IFN- was monitored
by ELISA. As seen in Fig. 2, IL-4
production by lymphoid cells from mice pretreated with pGM-CSF was
significantly increased when compared with mice treated with pGP160
alone. In contrast, IL-4 levels in cultures from mice treated with
pGM-CSF 3 days after pGP160 was rather reduced. An inverse effect on
IFN- levels was observed in this experiment: mice treated with
pGM-CSF 3 days before pGP160 had lower levels of IFN-, while those
treated 3 days after had significantly increase levels of IFN- in
culture. We further studied cytokine production using an ELISPOT assay
with cells from immune regional lymph nodes. As shown in Table III, the profile of the activation of
cytokine production using in vitro V3 peptide-activated cells became
clearer. Thus, the timing of pGM-CSF administration impacts on the
Th1:Th2 cytokine balance, and this change of balance became clearer
when we tested lymph node cells at the site of DNA vaccination.
|
|
|
|
The next series of experiments examined the mechanism underlying
the Th2-type response elicited by pretreatment with pGM-CSF. We first
examined the histology of the region injected with pGM-CSF. A cellular
infiltrate was present within 24 h that peaked in magnitude by
2–3 days after injection (Fig. 3a). Immunohistochemical
analysis with anti-S-100 polyclonal Ab (Nichirei) identified many
S-100 plus DCs infiltrating the site (Fig. 3b). S-100
immunoreactivity is characteristic of mature DC cells that are
effective in Ag presentation (42, 43, 44). We also observed
the accumulation of S-100-stained cells among the infiltrated cells in
the muscles, which had received pGP160 after 48 h. However, the
accumulation of S-100-stained or infiltrating cells was not so
remarkable when we studied the specimen immunized with pGP160 alone
(Fig. 3, c and d). These observations suggest
that the infiltrating cells might have taken up or been activated by
the GM-CSF produced by transfected cells and were playing a role in the
immune response.
|
The percentages of CD8+ and
CD11c+ cells 3 days after pGM-CSF injection were
analyzed using a FACS analyzer. In the present study, DCs were
partially purified by a previously described method (31).
As shown in Fig. 4, the
percentage of both CD8+ and
CD11c+ cells was 3.21% in the enhanced cells
from mice that had been injected with pGM-CSF. In the control, the
percentage of these positive cells was 1.07%. The results of two other
experiments showed that these double-positive cells after pGM-CSF
injection were 3.02 and 2.96%, whereas these double-positive cells in
the noninjected groups were 1.13 and 0.97%, respectively. These
results suggest that both the CD8+ and
CD11c+ cells in the regional lymph nodes increase
when pGM-CSF is injected 3 days before of pGP160 immunization.
|
Our histological findings combined with previous reports
(17, 21, 22, 23, 45) suggested that DCs play an important role
in GM-CSF-mediated immune responses. Therefore, we cultured purified
DCs with IL-4 and GM-CSF. These cells were then cocultured for 6 h
with HIV-1 plasmids in the presence of Lipofectin and then were
transferred into naive mice. As shown in Table IV, HIV-1-specific serum IgG, IgG1,
IgG2a, and mucosal IgA Abs were markedly increased in mice when 1
x 103 or more of DNA vaccine-pulsed DCs were
transferred. An increased ratio of G1/G2a was also observed after this
DNA-pulsed DC transfer. However, this DCs-mediated Ab response was
significantly suppressed when either anti-GM-CSF mAb or
anti-IL-4 mAb was i.p. injected. Neither anti-IL-12 mAb nor
anti-Mb Ab suppressed this immune. This result suggests that both
GM-CSF and IL-4 are playing important roles in HIV-1-specific Ab
induction.
|
). In this
study, we observed a significantly suppressed HIV-1-specific DTH
response only in anti-GM-CSF mAb. Compared with GM-CSF, IL-4 seems
to have only a minor role in this DC-mediated DTH response, which might
be due to the signal transudation by a shared receptor of IL-4 and
IL-13 (46).
|
, the pattern of cytokine production of
lymphoid cells from recipients of plasmid-pulsed DCs was similar to
those of lymphoid cells from mice inoculated with pGM-CSF 3 days before
DNA vaccination. These results support the conclusion that DCs
contribute to the process of immune activation of Th2-type responses
induced by pGM-CSF injected 3 days before DNA vaccination.
|
).
|
Effects of coadministering additional cytokine-encoding plasmids with pGM-CSF
We then examined whether coadministering other cytokine expression
plasmids with pGM-CSF effected the immune response to pGP160. Given the
complexity of these studies, all plasmids were injected simultaneously
rather than at various periods before or after pGP160 administration.
As seen in Table VI, inclusion of pIL-4
improved the Ag-specific IgG and IgG1 response of vaccinated mice, as
well as their mucosal IgA production. Plasmid-encoding IFN-
selectively promoted IgG2a Ab production, consistent with its ability
to induce isotype switching from IgM to IgG2a. Plasmid-encoding IL-2
had a suppressive effect on Ab production, particularly of the IgG1
isotype.
|
). However, the combination of
GM-CSF with pIL-4 did not improve the DTH response.
|
). Significantly decreased CTL activity
was observed when the DNA vaccine and pGM-CSF were injected in
combination with anti-GM-CSF mAb or plasmid-encoding IL-4.
|
). In contrast, IFN- synthesis was decreased
when the IL-4 expression plasmid was coadministered with pGM-CSF and
the DNA vaccine.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and VI). Simultaneous administration of pGP160 plus pGM-CSF
stimulated both a Th1 and a Th2 response, with significantly increased
Ag-specific serum IgG, IgG1, IgG2a, and fecal IgA levels when compared
with the DNA vaccine alone. By comparison, when pGM-CSF was
administered 3 days after DNA vaccination, DTH (Table II), CTL (Fig. 1), and IFN- responses were enhanced, consistent with late pGM-CSF
administration preferentially enhancing Th1 immunity (Tables I and II
and Fig. 1). Our results also revealed that this type of immune
modification was also observed in protein immunization using Mb. These
findings demonstrate that the Th1/Th2 balance of an Ag-specific immune
response can be dramatically affected by the timing of cytokine plasmid
administration.
GM-CSF activates neutrophils, macrophages, DCs, and other mononuclear
cells, and also stimulates progenitor/stem cells to mature and migrate
from the bone marrow to the peripheral circulation (18, 19, 23). Consistent with previous findings, we observed that GM-CSF
enhanced the growth of DCs in vitro, an effect that was enhanced by the
addition of IL-4 (32, 49). In our present study (Table IV), we coinjected plasmid-pulsed DCs with anti-GM-CSF mAb or
anti-IL-4 mAb. The Ab titers were remarkably suppressed by both
anti-GM-CSF and IL-4 mAbs. As shown in Table IV, anti-IL-4 mAb
significantly suppressed DC-mediated Ab response, which suggests that
IL-4 is playing an important role for this Ab production. Although we
could not observe a statistically significant difference in the serum
IL-4 level between pGM-CSF-injected and noninjected groups, we are
considering the effect of IL-4 at least in the immunized sites (Fig. 2). The weak effect of the pGM-CSF, when injected in the other foot
(Tables I and II), supports our notion. When we injected pGP160 with
the association of anti-GM-CSF mAb into mice, the immune responses
were not greatly suppressed (Tables I and II). However, a significant
level of inhibition was observed, when we injected these mAb with the
association of DC transfer. Dramatic inhibition of Ab production might
be due to the high sensitivity of anti-GM-CSF mAb or anti-IL-4
mAb against these transferred cells, which are limited in number.
To explore the mechanism by which pGM-CSF augmented Th2 responses when
administered 3 days before DNA vaccination, we isolated DC pulsed in
vitro with pGP160 and then transferred them into naive recipients. The
pattern of immune enhancement (including increased Ab production, DTH,
and activation of IL-4-secreting cells) was similar in recipients of
pulsed DC and in mice treated with pGM-CSF 3 days before DNA
vaccination (Tables III and V and Fig. 5). The observation that large
numbers of S-100-positive DC were found at the site of pGM-CSF
injection 1–3 days after plasmid delivery (Fig. 3b) and the
weak effect of the pGM-CSF when injected in the other foot (Tables I
and II) led us to hypothesize that pGM-CSF induces DC to accumulate at
the site of DNA vaccination and that the cytokines released by DCs
induces a Th2 bias to the resultant immune response. However, this
conclusion remains speculative because we were unable to document the
accumulation of CD11+ or class
II+ cells by immunofluorescence (data not shown).
However, we observed the activation of IL-4 in the regional lymph
nodes. The increased percentages of both CD8+ and
CD11c+ cells in regional lymph nodes were also
observed when pGM-CSF was injected 3 days before pGP160 immunization.
The results also suggest an increase in DCs in the pGP160 immune
regional lymph nodes. This suggests that these increased DCs activated
Th2 in immune responses. Recently, it was demonstrated that distinct DC
subsets may differentially regulate the Th1/Th2 balance of immune
response in mice (50, 51) and humans (52).
Pulendran et al. (50) showed that the injection of GM-CSF
alone into mice expanded DCs that induced large amounts of Th2
cytokines, whereas cytokine Flt3-ligand led to the expansion of DCs
inducing Th1 cytokine production. Treatment with pGM-CSF 3 days
before DNA vaccination in our study may be introducing the same
situation as above to expand Th2-inducing DCs.
We also studied the effect of administering pGM-CSF 3 days after DNA
vaccination. This resulted in the preferential activation of
IFN--secreting cells (Fig. 2) and the production of Ag-specific
IgG2a Ab (Table I). While the mechanism underlying this Th1 bias is
uncertain, several possibilities are under investigation. First, it is
possible that the amount of HIV Ag present 3 days after pGP160
administration promotes the development of Th1 rather than Th2
responses. Consistent with such a possibility, preliminary data from
our laboratory show that minute amounts of Ag preferentially stimulate
HIV-1-specific CTL or DTH responses, whereas larger amounts of Ag
stimulated Ab-dominated Th2 responses (K. Okuda et al., unpublished
observations). It is also possible that pGP160 alone preferentially
induces a strong Th1-type immune response (27) (perhaps
mediated by CpG motifs in the plasmid backbone), and that delaying
administration of pGM-CSF allows this type of response to become
irrevocably fixed.
Based on the observation that GM-CSF plus IL-12 can enhance CTL
activity (11, 17, 24, 29, 32), we coadministered multiple
cytokine-encoding plasmids with pGM-CSF in an effort to identify
optimally immunostimulatory combinations. Significant enhancement of
Th1-type immunity was observed when pGM-CSF was complemented with
pIL-12 (Fig. 5 and Table VII). However, these combinations also
resulted in a modest decrease in fecal IgA and serum IgG levels (Table VI). In most cases, plasmid combinations did not improve DNA vaccine
immunogenicity. However, it remains possible that changes in dose,
route, or timing of plasmid administration may improve the efficacy of
these other adjuvants (alone or in combination).
Although multiple methods for introducing DNA plasmids into DCs were examined (including gene gun, saline, and cationic liposomes), optimal transfection was obtained using Lipofectin. The efficacy of in vitro transfection by this technique was only 2–5%, as monitored by expression of the ß-galactosidase gene. Consistent with previous reports, we found that transfected DCs had potent immunogenic activity (45, 53, 54). In certain situations (such as the induction of tumor-specific immunity), plasmid-pulsed DCs may be required to break self-tolerance and stimulate a maximal immune response. Thus, further study of this fascinating alternative to direct DNA vaccination would be of considerable interest.
Our results demonstrate that pGM-CSF markedly enhances Th2 immunity when delivered 3 days before DNA vaccination, but enhances Th1 immunity if administered 3 days after DNA vaccination. To our knowledge, this is the first study to show that the timing of cytokine plasmid injection can profoundly effect the Th1/Th2 balance. Reports from other laboratories have been contradictory, some showing that GM-CSF can activate both Th1 and Th2 immune responses while others reporting that GM-CSF stimulates only a Th1 or Th2 response (17, 55, 56, 57). The balance of activation of DC1 or DC2 by pGM-CSF injection might be one reason to cause these Th1 and Th2 responses (50, 52) Our findings explain these apparently contradictory effects by showing that the timing of the administration of pGM-CSF influences the outcome of the resultant immune response. We also find that pGM-CSF-activated DCs play an important role in the induction of Th2 immunity. Given the growing use of plasmid-based immune adjuvants to improve the immunogenicity and efficacy of DNA vaccines, these findings support the need for further detailed study of this class of agent.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kenji Okuda, Department of Bacteriology, Yokohama City University School of Medicine, 3-9 Fukuura, Kanazawa-ku, Yokohama 236-0004, Japan. E-mail address:
3 Abbreviations used in this paper: pGM-CSF, plasmid-encoding GM-CSF; DC, dendritic cell; Mb, myoglobin; DTH, delayed-type hypersensitivity; ELISPOT, enzyme-linked immunospot.
Received for publication September 20, 1999. Accepted for publication January 13, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(MIP-1) expression plasmid enhances DNA vaccine-induced immune response against HIV-1. Clin. Exp. Immunol. 115:335.[Medline]
synergize with IL-12 to enhance induction of cytotoxic T lymphocytes. J. Immunol. 158:3947.[Abstract]
. J. Exp. Med. 179:1109.+ and CD8- subclasses of dendritic cells direct the developement of distinct T helper cells in vivo. J Exp Med. 189:587.This article has been cited by other articles:
|
|
 |
|
  L. V. Bentancor, M. Bilen, R. J. F. Brando, M. V. Ramos, L. C. S. Ferreira, P. D. Ghiringhelli, and M. S. Palermo A DNA Vaccine Encoding the Enterohemorragic Escherichia coli Shiga-Like Toxin 2 A2 and B Subunits Confers Protective Immunity to Shiga Toxin Challenge in the Murine Model Clin. Vaccine Immunol., May 1, 2009; 16(5): 712 - 718. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. O. Abdalla, L. Hansson, I. Eriksson, B. Nasman-Glaser, E. D. Rossmann, H. Rabbani, H. Mellstedt, and A. Osterborg Idiotype protein vaccination in combination with adjuvant cytokines in patients with multiple myeloma - evaluation of T-cell responses by different read-out systems Haematologica, January 1, 2007; 92(1): 110 - 114. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. R. Ferrone, M.-A. Perales, S. M. Goldberg, C. J. Somberg, D. Hirschhorn-Cymerman, P. D. Gregor, M. J. Turk, T. Ramirez-Montagut, J. S. Gold, A. N. Houghton, et al. Adjuvanticity of plasmid DNA encoding cytokines fused to immunoglobulin fc domains. Clin. Cancer Res., September 15, 2006; 12(18): 5511 - 5519. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Someya, K.-Q. Xin, K. Matsuo, K. Okuda, N. Yamamoto, and M. Honda A Consecutive Priming-Boosting Vaccination of Mice with Simian Immunodeficiency Virus (SIV) gag/pol DNA and Recombinant Vaccinia Virus Strain DIs Elicits Effective Anti-SIV Immunity J. Virol., September 15, 2004; 78(18): 9842 - 9853. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Jiao, R. Y.-H. Wang, Q. Qiu, H. J. Alter, and J. W.-K. Shih Enhanced hepatitis C virus NS3 specific Th1 immune responses induced by co-delivery of protein antigen and CpG with cationic liposomes J. Gen. Virol., June 1, 2004; 85(6): 1545 - 1553. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A. Siddiqui, T. Phillips, H. Charest, R. B. Podesta, M. L. Quinlin, J. R. Pinkston, J. D. Lloyd, M. Paz, R. M. Villalovos, and J. Pompa Induction of Protective Immunity against Schistosoma mansoni via DNA Priming and Boosting with the Large Subunit of Calpain (Sm-p80): Adjuvant Effects of Granulocyte-Macrophage Colony-Stimulating Factor and Interleukin-4 Infect. Immun., July 1, 2003; 71(7): 3844 - 3851. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. B. Geldhof, J. A. Van Ginderachter, Y. Liu, W. Noel, G. Raes, and P. De Baetselier Antagonistic effect of NK cells on alternatively activated monocytes: a contribution of NK cells to CTL generation Blood, December 1, 2002; 100(12): 4049 - 4058. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. H. Barouch, S. Santra, K. Tenner-Racz, P. Racz, M. J. Kuroda, J. E. Schmitz, S. S. Jackson, M. A. Lifton, D. C. Freed, H. C. Perry, et al. Potent CD4+ T Cell Responses Elicited by a Bicistronic HIV-1 DNA Vaccine Expressing gp120 and GM-CSF J. Immunol., January 15, 2002; 168(2): 562 - 568. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Moore, W.-p. Kong, B. K. Chakrabarti, and G. J. Nabel Effects of Antigen and Genetic Adjuvants on Immune Responses to Human Immunodeficiency Virus DNA Vaccines in Mice J. Virol., January 1, 2002; 76(1): 243 - 250. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. S. Meng, L. H. Butterfield, A. Ribas, V. B. Dissette, J. B. Heller, G. A. Miranda, J. A. Glaspy, W. H. McBride, and J. S. Economou {alpha}-Fetoprotein-specific Tumor Immunity Induced by Plasmid Prime-Adenovirus Boost Genetic Vaccination Cancer Res., December 1, 2001; 61(24): 8782 - 8786. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-W. Chen, C.-H. Pan, H.-W. Huan, M.-Y. Liau, J.-R. Chiang, and M.-H. Tao Suppression of Immune Response and Protective Immunity to a Japanese Encephalitis Virus DNA Vaccine by Coadministration of an IL-12-Expressing Plasmid J. Immunol., June 15, 2001; 166(12): 7419 - 7426. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Haddad, J. Ramprakash, M. Sedegah, Y. Charoenvit, R. Baumgartner, S. Kumar, S. L. Hoffman, and W. R. Weiss Plasmid Vaccine Expressing Granulocyte-Macrophage Colony-Stimulating Factor Attracts Infiltrates Including Immature Dendritic Cells into Injected Muscles J. Immunol., October 1, 2000; 165(7): 3772 - 3781. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
