The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kusakabe, K.-i.
Right arrow Articles by Okuda, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kusakabe, K.-i.
Right arrow Articles by Okuda, K.
The Journal of Immunology, 2000, 164: 3102-3111.
Copyright © 2000 by The American Association of Immunologists

The Timing of GM-CSF Expression Plasmid Administration Influences the Th1/Th2 Response Induced by an HIV-1-Specific DNA Vaccine1

Ken-ichi Kusakabe*, Ke-Qin Xin*, Hidenori Katoh*, Kaharu Sumino{dagger}, Eri Hagiwara{dagger}, Susumu Kawamoto*, Katsuji Okuda§, Yohei Miyagi{ddagger}, Ichiro Aoki{ddagger}, Kusuya Nishioka*, Dennis Klinman and Kenji Okuda2,*

Departments of * Bacteriology, {dagger} Internal Medicine, and {ddagger} Pathology, Yokohama City University School of Medicine, Yokohama, Japan; § Department of Microbiology, Tokyo Dental College, Chiba, Japan; and Center for Biologics Evaluation and Research/Food and Drug Administration, Bethesda, MD 20892


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The mechanism of immune activation induced by a plasmid-encoding GM-CSF (pGM-CSF), administered in combination with a DNA vaccine encoding the envelope of HIV, was studied. Injecting pGM-CSF i.m. into mice 3 days before DNA vaccination primarily induced a Th2 response. Simultaneous administration of the DNA vaccine plus pGM-CSF activated both a Th1 and a Th2 response. When the plasmid was injected 3 days after DNA vaccination, enhancement of Th1 immunity predominated. These results suggest that the timing of cytokine expression determines the phenotype of the resultant Th response. After 3 days of pGM-CSF injection, the increased percentages of CD11c+, CD8+ cells were observed in the regional lymph nodes. In addition, many infiltrated cells, including S-100 protein-positive cells, were found in the pGM-CSF-injected tissue. The importance of these S-100+ cells or both CD8+ and CD11c+ cells, especially that of dendritic cells (DCs), was also studied. DCs derived from bone marrow and cultured in RPMI 1640 medium containing IL-4 and GM-CSF were incubated with DNA vaccine and then transferred into naive mice. Mice receiving DCs showed strong HIV-1-specific Th2 immune responses. Our results suggest that DCs play important roles in the activation or modification of the Th2-type immune response induced by DNA vaccination.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The induction of strong mucosal and systemic CTL activity is important for the development of an effective HIV-1 vaccine (1, 2, 3, 4). HIV-1 DNA vaccines provide the Ag required for the host to develop an immune response without exposure to a live organism or replication-competent vectors (5). However, adjuvants may be needed to enhance the immune response elicited by this DNA vaccine. Therefore, we and other groups have been studying the effects of multiple potential adjuvants, including cationic liposomes (6), Ribi adjuvant (7, 8), vectamidin (9), QS21 (10), B7-2 (11), IL-2 (12), macrophage inflammatory protein-1{alpha} (13), IL-12 (11, 14, 15), TCA3 (16), and others (5).

We have been investigating the effect of a plasmid-encoding GM-CSF (pGM-CSF)3 on humoral and cellular immunity. We previously reported that the simultaneous intranasal administration of a DNA vaccine with pGM-CSF induced both systemic and mucosal Ab production (17). GM-CSF has been reported to initiate the proliferation, differentiation, and activation of macrophages, neutrophils, and various APCs (18, 19, 20, 21, 22, 23). Cytokine-encoding plasmids not only increase Ag-induced immune responses but can also alter the Th1:Th2 cytokine balance (8, 9, 10, 12, 14, 16, 17, 24, 25, 26).

In the present study, we observed that the timing of pGM-CSF administration had a significant impact on the resultant Th response. We were also interested in optimizing mucosal and cell-mediated immunity to HIV-1 and thus examined the effect of coadministering the HIV DNA vaccine in combination with plasmids encoding several different cytokines or costimulatory molecules. Finally, the mechanism of immune enhancement induced by pGM-CSF was examined using an in vivo transfer system involving bone marrow-derived dendritic cells (DCs) incorporating the DNA vaccine. This also provided insight into the potential of passively transferred DNA-pulsed DCs on the induction of an immune response.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

Six- to 10-wk-old BALB/c female mice were purchased from Japan SLC (Shizuoka, Japan).

Plasmids and reagents

The following expression plasmids were used: pCMV160IIIB, which encodes gp160 of HIV-1IIIB, and pcREV-encoding HIV-1 rev (27); an IL-12 expression plasmid (pCAGGS IL-12), which encodes both the p40 and p35 subunits of IL-12 (17, 26), donated by Dr. J. Miyazaki (Osaka University); and IL-4 expression plasmid (pCAGGS IL-4), also donated by Dr. J. Miyazaki, which encodes IL-4 cDNA (17); an IL-2 expression plasmid (BCMGNeo-mIL-2) (28), kindly donated by Dr. H. Karasuyama (Department of Immunology, Tokyo Metropolitan Institute of Medical Science); a TNF-{alpha} expression plasmid, donated by Riken Gene Bank (Ibaraki, Japan); an IFN-{gamma} expression plasmid, a gift from Dr. H. Uesaka, (Tokyo Dental College, Chiba); an GM-CSF expression plasmid (pGM-CSF), a kind donation from Dr. H. L. Davis (Loeb Medical Research Institute, Ottawa, Ontario, Canada) (29); and empty vector, which was a construct derived from pGM-CSF by removing the cytokine gene. For vaccine immunization, the HIV-1IIIB-derived gag region plasmid, which was a combined construct of gag DNA and CMV promoter (J. Fukushima et al., unpublished observations) was used. The rat monoclonal anti-mouse GM-CSF Ab (05-169; Upstate Biotechnology, Lake Placid, NY) (anti-GM-CSF mAb) was purchased from Wako Life Sciences (Osaka, Japan), and rat anti-mouse IL-12 mAb were received from Dr. G. Trinchieri (The Wistar Institute, Philadelphia, PA). The rat monoclonal anti-mouse IL-4 Ab was purchased from PharMingen (San Diego, CA). The rabbit Ab for sperm whale myoglobin (Mb; Sigma, St. Louis, MO) was obtain by immunizing Mb with CFA three times (30), and the Ab titer of reciprocal log2 was 15.3 using ELISA assay. This Ab was affinity purified using a Mb-conjugated column.

Immunization

The protocol used for i.m. immunization was previously described (27). Briefly, 100 µl of PBS containing 20 µg of the DNA vaccine plasmids (15 µg of pCMV160IIIB and 5 µg of pcREV, hereafter referred to DNA vaccine or pGP160) or 10 µg of adjuvant plasmid, or both, was inoculated directly into the gastrocnemius muscle of mice. The same procedure of immunization employing the same dose of immunogen was used for repeat immunizations on days 7 and 21. Five to 7 days after the last boost, immune responses were studied. To study the effect of GM-CSF plasmid on the immune activation induced by the DNA vaccine, 10 µg of pGM-CSF was administered i.m. into mice 3 days before or after DNA vaccination. In some experiments, pGM-CSF was injected into the gastrocnemius muscle of another foot. The mAbs were injected i.p. on two consecutive days 3 days after or before pGM-CSF administration. All cytokine expression plasmids except pGM-CSF were injected on the same day as the DNA vaccination.

Histology

The samples were fixed with 10% neutral-buffered formalin solution (Sigma) and embedded in paraffin. Slices (4 µm thick) were prepared and stained with hematoxylin-eosin. For immunohistochemical analysis, slices were deparafinized and rehydrated. These specimens were treated with 0.5% H2O2 solution for 15 min to block the endogenous peroxidase activity. These treated samples were incubated with a primary Ab using Histofine immunodetection system (Nichirei, Tokyo, Japan) according to the manufacturer’s protocol.

Analysis of CD8+ and CD11c+ cells in regional lymph nodes

Three days after pGM-CSF injection, regional lymph nodes were collected, and partial purification of DCs was conducted using a previously described method (31). As a control, nonimmune lymph nodes from mice, which have not been given pGM-CSF, were also collected and studied. Lymph node cells from three to five mice were pooled, suspended, and placed in a petri dish in RPMI 1640 medium supplemented with 2% heat-inactivated mouse serum plus 5 x 10-5 M 2-ME. After 2 h, nonadherent low-density cells were removed by gentle Paster pipetting, and adherent cells were cultured again with the same RPMI 1640 media at 37°C in a CO2 incubator. After 12 h, the nonadherent cells were collected and stained with FITC-labeled anti-CD11c Ab (PharMingen) and PE-labeled anti-CD8 Ab (PharMingen). These stained cells were analyzed with a FACScan (Becton Dickinson, Franklin Lakes, NJ).

Purification of DCs and in vitro immunization

A detailed protocol of DC purification was previously described (32). Briefly, after removing all muscle tissues from the femur and tibia, both ends of the bones were cut and the marrow was flushed out using 2 ml of RPMI 1640 with a syringe and a 25-gauge needle. The tissue was suspended, passed through nylon mesh, and the RBC were lysed with ammonium chloride. Lymphocytes and class II-positive cells in the culture were removed with a mixture of mAbs and rabbit complement for 60 min at 37°C. The mixture of mAbs contains GK1.3 anti-CD4, HO2.2 anti-CD8, B21-2 anti-Ia, and RA3-3A1/6.1 anti-B220/CD45R (American Type Culture Collection, Manassas, VA). Then, the culture was incubated with 200 U/ml rGM-CSF and rIL-4 (20 ng/ml; Genzyme, Framingham, MA), and the medium was replaced with medium containing the same concentrations of cytokines every 2 days to enrich the loosely adherent proliferating DC aggregates. On day 8 of culture, the released mature, nonadherent cells with the typical morphological features of DCs were used for in vitro phenotypic and functional analysis as well as for the immunization of mice. The FACS analysis of these recovered cells revealed over 60% of both CD11c and CD86 Ag-positive cells.

In vitro immunization was performed using these in vitro-cultured DCs. The method of DNA transfection followed that previously reported (6, 33, 34). Briefly, 20 µg of DNA plasmids were mixed with 40 µg of Lipofectin in a polystyrene container. The solution was brought to a volume of 50 µl with PBS, mixed, and allowed to sit in a CO2 incubator for 15 min. The DNA and Lipofectin complex was mixed with 3 ml of EX-cell/TM 400 serum-free medium (IRH Bioscience, Lenexa, KS) and added to a 25-cm2 flask containing 1–3 x 106 DCs. These cells were incubated at 37°C in an atmosphere containing 5% CO2. After 6 h, these cells were washed and transferred into naive mice. The HIV-1-specific delayed-type hypersensitivity (DTH) response was assayed after 10 days. When the CTL and Ab responses were assayed, these cell transfers were repeated after 7 and 21 days, and the immune responses of these mice were tested.

Sample collection

Sera and fecal samples were prepared as described elsewhere (2). Briefly, sera were collected by retro-orbital puncture under anesthesia with diethyl ether and stored at 4°C until use. Fecal pellets (100 mg) were suspended in 1 ml of PBS. After centrifugation at 12,000 rpm, the supernatants were collected and stored at -20°C until use.

DTH response

The DTH response was assessed using a footpad swelling method as previously described (27). Briefly, 25 µl PBS containing 4 µg of an HIV-1IIIB V3 peptide (RGPGRAFVTIGK) (35) was injected into mouse footpads. Control mice were injected with the same dose of sperm whale Mb peptide, ALVEADVA (30). As the other control Ag, HGP-30 peptide (YSVHQRIDVKVTKEALEKIEEEQNKSKKKA) (36) was also employed. After 24 h, the extent of footpad swelling was evaluated as the difference in thickness in units of 10-2 mm between the preinjected and postinjected footpads.

CTL assay

Spleen and regional lymph node cells were collected around the third day after the last immunization (27). Approximately 1 x 106 lymphoid cells from the immunized mice were restimulated in vitro with HIV-1 V3 peptide (RGPGRAFVTI)-pulsed syngeneic spleen cells. After culturing for 5 days, the cytotoxic activity of these spleen cells was measured by a 6-h 51Cr release assay using V3 peptide-pulsed target cells. The target cells were prepared using the same HIV-1 V3 peptide-pulsed P815 cells (H-2d). The percentage of specific 51Cr release was calculated as 100 x (experimental release - spontaneous release)/(maximum release - spontaneous release). Target cells incubated in medium alone and with medium plus 5% Triton X-100 were used to determine spontaneous and maximum chromium release, respectively.

RT-PCR assay

Total RNA was isolated from about 0.1 g of cultured DCs or bone marrow cells using an RNAzol B kit (Biotecx Laboratories, Houston, TX). One microgram of total RNA was reverse transcribed by methods described elsewheres (37, 38). PCR primers for IL-4 and ß-actin mRNA were constructed as the following sequence. For IL-4, the 5' primer was TCG GCA TTT TGA ACG AGG TC and the 3' primers were GAA AAG CCC GAA AGA GTC TC. For ß-actin, the 5' primer was TGGAATCCTGTGGCATCCATGAAAC and the 3' primer was TAAAACGCAGCTCAG T AACAGTCCG.

ELISA

The titers of serum IgG, IgG1, IgG2a, and fecal IgA against HIV-1 were examined on days 14 and 28 after immunization using ELISA as described elsewhere (26, 27). Briefly, 96-well microtiter plates were coated with 5 mg/ml of HIV-1IIIB V3 peptide (NNTRKSIRIQRGPGRAFVTIGKIGN) or a sperm whale Mb peptide, ALVEADVA. The wells were treated with PBS containing 1% BSA and incubated for 1 h at room temperature. Then they were treated with 100 µl of a 1-in-500 dilution of mouse serum and incubated for an additional hour at 37°C. The bound Ig was characterized using affinity-purified HRP-labeled anti-mouse IgG, IgG1, or IgG2a (Organon Teknika, West Chester, PA). For the estimation of secretory IgA Ab against the HIV-1IIIB V3 peptide, rabbit anti-rat secretory component Ab (kindly provided by Dr. B. Underdown, McMaster University Medical Center, Hamilton, Ontario, Canada) was also used. Ab titers were expressed as the reciprocal log2 value of the final detectable dilution, which gave an OD at 490 nm (OD490) of >0.2 OD units above the preimmune control.

For quantification of IFN-{gamma} and IL-4, freshly isolated splenic mononuclear cells were cultured in the presence of a V3 peptide. This peptide, RGPGRAFVTIGK, contains both a helper (39) and a CTL (40) epitope for HIV-1IIIB. Culture media were collected 48 h after the initiation of cell culture, and the cell-free supernatants were stored at -80°C until use. Cytokine levels in these samples were measured with a commercial EIA kit (Cytoscreen; Biosource, Beverly, MA) according to the manufacturer’s instructions.

Cytokine enzyme-linked immunospot (ELISPOT) assay

Cytokine ELISPOT assay was performed as previously described (41). Lymphoid cells were isolated from popliteal and inguinal lymph nodes 7 days after the third immunization. Serial 3-fold dilutions of a single-cell suspension, starting with 5 x 106 cells/well, were incubated at 5% CO2, 37°C for 12 h with or without 10 µg/ml of V3 peptide. Detection kits for cytokines using alkaline phosphatase-labeled Abs (PharMingen) were used for detecting IL-4 and IFN-{gamma}-producing cells. Spots were counted in each well, and the dilution was used to calculate the total number of cytokine-secreting cells/samples.

Data analysis

All values were expressed as means ± SE. Statistical analysis of the experimental data and controls was conducted by one-way factorial ANOVA, with the levels of significance defined as p < 0.05 and 0.01.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Temporal effects of pGM-CSF administration on the immune response to pGP160IIIB

BALB/c mice were immunized i.m. with 15 µg of pCMV160IIIB plus 5 µg of pcREV. We previously showed that this combination of plasmids induced the production of IgG anti-gp160 Abs (27). In an effort to boost this response, we examined the effect of coadministering pGM-CSF with pGP160 (Table IGo).


View this table:
[in this window]
[in a new window]
 
Table I. Temporal effects of pGM-CSF administration on Ag-specific Ab production1

 
pGM-CSF was injected either 3 days before, at the same time, or 3 days after pGP160. As seen in Table IGo, pGM-CSF had a maximal effect on Ag-specific IgG levels when administered before pGP160, boosting serum titers 8-fold. We then analyzed the effect of pGM-CSF on the mucosal immune response of pGP160IIIB-vaccinated mice. HIV-1-specific mucosal IgA titers were significantly increased when pGM-CSF was administered 3 days before DNA vaccination (Table IGo). The IgG2a Ab titer was enhanced, when pGM-CSF was injected 3 days after pGP120 injection. In the mouse injected with pGP160 and pGM-CSF, each into a different foot, the Ab production was not so effectively enhanced, which suggests the importance of the local accumulation effect of pGM-CSF. Both the mucosal and systemic rise in Ab titer were inhibited by anti-GM-CSF mAb. This type of enhancement was also observed using sperm whale Mb as an immunogen. As shown in Table IGo, pGM-CSF inoculation also enhances Mb-specific Ab production when pGM-CSF was inoculated before 3 days of Mb immunization.

In contrast, pGM-CSF maximally increased the production of Ag-specific CTL when administered 3 days after pGP160 (Fig. 1Go, A and B). The same effect on DTH was observed in assays of footpad swelling (Table IIGo). The same effect was also observed using Mb Ag. However, this enhancing effect was inhibited by injection of anti GM-CSF mAb. In the mouse injected with pGP160 and pGM-CSF, each into a different foot, the swelling response was not so effectively enhanced. To determine the basis of this differential effect, we examined cytokine production by lymphocytes from these mice. Spleen and lymph node cells were cultured in vitro with a peptide encoding the V3 region of gp160, and the production of IL-4 and IFN-{gamma} was monitored by ELISA. As seen in Fig. 2Go, IL-4 production by lymphoid cells from mice pretreated with pGM-CSF was significantly increased when compared with mice treated with pGP160 alone. In contrast, IL-4 levels in cultures from mice treated with pGM-CSF 3 days after pGP160 was rather reduced. An inverse effect on IFN-{gamma} levels was observed in this experiment: mice treated with pGM-CSF 3 days before pGP160 had lower levels of IFN-{gamma}, while those treated 3 days after had significantly increase levels of IFN-{gamma} in culture. We further studied cytokine production using an ELISPOT assay with cells from immune regional lymph nodes. As shown in Table IIIGo, the profile of the activation of cytokine production using in vitro V3 peptide-activated cells became clearer. Thus, the timing of pGM-CSF administration impacts on the Th1:Th2 cytokine balance, and this change of balance became clearer when we tested lymph node cells at the site of DNA vaccination.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 1. Effect of GM-CSF expression plasmids on HIV-1-mediated CTL activity. The timing of pGM-CSF inoculation differed between groups. These injections were performed twice, and the activity was assayed using cells from regional lymph nodes and spleen. A, Data represent the means of the experiments. B, Mean values ± SE of CTL activities from individual immune mouse. *, Mean values significantly different from the pGP160IIIB (p < 0.05) group at the same E:T ratio (80:1).

 

View this table:
[in this window]
[in a new window]
 
Table II. Temporal effects of pGM-CSF administration Ag-specific DTH response1

 


View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 2. Influence of other cytokine expression plasmids on IL-4 production induced by DNA vaccine and pGM-CSF. Some plasmids were inoculated i.m. into mice, and immune lymphoid cells, spleen, as well as lymph node cells were collected. Coculturing was performed for 3 days with 10 mg/ml gp160 protein. The culture supernatants were assayed using IL-4 ELISA kits. *, Statistically significant difference between pGP160 and IL-4; a, statistically significant difference between pGP160 and IFN-{gamma}. Mean levels ± SE of cytokines were assayed. Data represent mean cytokine levels ± SE of five to seven mice. These data are representative of three other individual experiments.

 

View this table:
[in this window]
[in a new window]
 
Table III. Temporal effects of pGM-CSF administration on cytokine production using ELISPOT assay1

 
Histological analysis of pGM-CSF-injected mice

The next series of experiments examined the mechanism underlying the Th2-type response elicited by pretreatment with pGM-CSF. We first examined the histology of the region injected with pGM-CSF. A cellular infiltrate was present within 24 h that peaked in magnitude by 2–3 days after injection (Fig. 3Goa). Immunohistochemical analysis with anti-S-100 polyclonal Ab (Nichirei) identified many S-100 plus DCs infiltrating the site (Fig. 3Gob). S-100 immunoreactivity is characteristic of mature DC cells that are effective in Ag presentation (42, 43, 44). We also observed the accumulation of S-100-stained cells among the infiltrated cells in the muscles, which had received pGP160 after 48 h. However, the accumulation of S-100-stained or infiltrating cells was not so remarkable when we studied the specimen immunized with pGP160 alone (Fig. 3Go, c and d). These observations suggest that the infiltrating cells might have taken up or been activated by the GM-CSF produced by transfected cells and were playing a role in the immune response.



View larger version (140K):
[in this window]
[in a new window]
 
FIGURE 3. Accumulation of S-100 protein-positive cells among the infiltrated cells in the muscle. After 3 days of injection of pGM-CSF, the muscle was fixed and observed. a, Hematoxilin-eosin staining; b, S-100 protein immunohistochemistry. After 3 days of pGP160 injection, the muscle was fixed and observed. c, Hematoxilin-eosin staining; d, S-100 protein immunohistochemistry. Arrows indicate positively stained Schwann cells. All figures are x100 by original magnification.

 
FACS analysis

The percentages of CD8+ and CD11c+ cells 3 days after pGM-CSF injection were analyzed using a FACS analyzer. In the present study, DCs were partially purified by a previously described method (31). As shown in Fig. 4Go, the percentage of both CD8+ and CD11c+ cells was 3.21% in the enhanced cells from mice that had been injected with pGM-CSF. In the control, the percentage of these positive cells was 1.07%. The results of two other experiments showed that these double-positive cells after pGM-CSF injection were 3.02 and 2.96%, whereas these double-positive cells in the noninjected groups were 1.13 and 0.97%, respectively. These results suggest that both the CD8+ and CD11c+ cells in the regional lymph nodes increase when pGM-CSF is injected 3 days before of pGP160 immunization.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 4. Expression of CD8 and CD11c Ags on partially enriched DCs in regional lymph nodes.

 
In vitro DNA vaccine immunization with IL-4 and GM-CSF-cultured DCs

Our histological findings combined with previous reports (17, 21, 22, 23, 45) suggested that DCs play an important role in GM-CSF-mediated immune responses. Therefore, we cultured purified DCs with IL-4 and GM-CSF. These cells were then cocultured for 6 h with HIV-1 plasmids in the presence of Lipofectin and then were transferred into naive mice. As shown in Table IVGo, HIV-1-specific serum IgG, IgG1, IgG2a, and mucosal IgA Abs were markedly increased in mice when 1 x 103 or more of DNA vaccine-pulsed DCs were transferred. An increased ratio of G1/G2a was also observed after this DNA-pulsed DC transfer. However, this DCs-mediated Ab response was significantly suppressed when either anti-GM-CSF mAb or anti-IL-4 mAb was i.p. injected. Neither anti-IL-12 mAb nor anti-Mb Ab suppressed this immune. This result suggests that both GM-CSF and IL-4 are playing important roles in HIV-1-specific Ab induction.


View this table:
[in this window]
[in a new window]
 
Table IV. Ab production by in vitro immunization using DCs1

 
Transferring DNA-pulsed DCs also enhanced DTH response with the correspondent protein (Table VGo). In this study, we observed a significantly suppressed HIV-1-specific DTH response only in anti-GM-CSF mAb. Compared with GM-CSF, IL-4 seems to have only a minor role in this DC-mediated DTH response, which might be due to the signal transudation by a shared receptor of IL-4 and IL-13 (46).


View this table:
[in this window]
[in a new window]
 
Table V. Footpad swelling response induced by the transfer of DNA plasmid-pulsed DCs1

 
The type of cytokines activated by these DNA plasmid-pulsed DCs was then examined. The spleen cells from mice that had received plasmid-pulsed DCs were cocultured with gp160 Ag, and the cytokine levels were assayed using the supernatants. As shown in Fig. 5Go, the pattern of cytokine production of lymphoid cells from recipients of plasmid-pulsed DCs was similar to those of lymphoid cells from mice inoculated with pGM-CSF 3 days before DNA vaccination. These results support the conclusion that DCs contribute to the process of immune activation of Th2-type responses induced by pGM-CSF injected 3 days before DNA vaccination.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 5. IL-4 and IFN-{gamma} production lymphocytes of mice to which DNA-pulsed DCs were transferred. The source of the samples and the method of assay are the same as for Fig. 2Go. These data represent the mean ± SE of five to seven mice. The data of two other experiments are almost the same.

 
We then examined whether these cultured DCs induced IL-4 production, because that cytokine can induce the maturation of Th0 into Th2 cells (47, 48). RNA was extracted from DCs cultured for 6 h in medium supplemented with IL-4 and/or IL-12. IL-4 mRNA was detected in IL-4-treated DC-enriched samples, but not in samples cultured with IL-12 (Fig. 6Go).



View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 6. Detection of IL-4 and ß-actin transcripts using RT-PCR assay. A, IL-4 transcript. Lane 1, DCs cultured with IL-4; lane 2, DCs cultured without IL-4; lane 3, DCs cultured with IL-12; lane 4, bone marrow cells. B, ß-actin transcript. Lane 1, DCs cultured with IL-4; lane 2, DCs cultured without IL-4; lane 3, DCs cultured with IL-12; lane 4, bone marrow cells.

 
Finally, we studied the level of IL-4 in the serum of the mice transferred with DCs. Although there was some tendency for increasing IL-4 levels in the serum of the DC-transferred group, no statistically significant difference was found between groups. This might be due to the poor sensitivity of this assay.

Effects of coadministering additional cytokine-encoding plasmids with pGM-CSF

We then examined whether coadministering other cytokine expression plasmids with pGM-CSF effected the immune response to pGP160. Given the complexity of these studies, all plasmids were injected simultaneously rather than at various periods before or after pGP160 administration. As seen in Table VIGo, inclusion of pIL-4 improved the Ag-specific IgG and IgG1 response of vaccinated mice, as well as their mucosal IgA production. Plasmid-encoding IFN-{gamma} selectively promoted IgG2a Ab production, consistent with its ability to induce isotype switching from IgM to IgG2a. Plasmid-encoding IL-2 had a suppressive effect on Ab production, particularly of the IgG1 isotype.


View this table:
[in this window]
[in a new window]
 
Table VI. Adjuvant activity of Ab production by GM-CSF and other cytokine expression plasmids1

 
The coadministration of plasmids encoding IL-12 also significantly increased the DTH response of mice vaccinated with pGM-CSF plus pGP160 (Table VIIGo). However, the combination of GM-CSF with pIL-4 did not improve the DTH response.


View this table:
[in this window]
[in a new window]
 
Table VII. Adjuvant activity of GM-CSF expression plasmid and other cytokine expression plasmids on footpad swelling responses1

 
We then examined whether these plasmid combinations impacted the generation of CTL. A significant increase in CTL activity was observed by adding plasmids encoding IL-12 with pGP160 (Fig. 7Go). Significantly decreased CTL activity was observed when the DNA vaccine and pGM-CSF were injected in combination with anti-GM-CSF mAb or plasmid-encoding IL-4.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 7. Comparison of adjuvant activity was using pGM-CSF and other cytokine expression plasmids. The experimental conditions were the same as described in Fig. 1Go. A, Data are the means of the experiments. B, Mean values ± SE of CTL activities from individual immune mouse (E:T = 80:1). *, Significantly significant difference from the pGP160IIIB-inoculated group with other plasmid-inoculated groups (p < 0.05). a, Statistically significant difference between DNA vaccine plus pGM-CSF-inoculated and other experimental groups (E:T = 80:1).

 
Finally, we examined the effect of plasmid combinations on cytokine production. IL-4 production was increased when pGP160 was administered in combination with pGM-CSF or pGM-CSF plus the IL-4 expression plasmid (Fig. 8Go). In contrast, IFN-{gamma} synthesis was decreased when the IL-4 expression plasmid was coadministered with pGM-CSF and the DNA vaccine.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 8. Influence of other cytokine expression plasmids on IFN-{gamma} production induced by DNA vaccine and pGM-CSF. The same culture supernatants as for Fig. 2Go were assayed using ELISA kits. The data analysis and presentation are the same as for Fig. 2Go. The results of two other experiment showed almost the same.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study demonstrates that the timing of pGM-CSF administration with respect to DNA vaccination can profoundly influence the nature of the resultant Ag-specific response. Injecting pGM-CSF 3 days before DNA vaccination markedly enhanced Th2 immunity, as manifest by the activation of IL-4-secreting cells and improved Ab production (Tables IIIGo and VIGo). Simultaneous administration of pGP160 plus pGM-CSF stimulated both a Th1 and a Th2 response, with significantly increased Ag-specific serum IgG, IgG1, IgG2a, and fecal IgA levels when compared with the DNA vaccine alone. By comparison, when pGM-CSF was administered 3 days after DNA vaccination, DTH (Table IIGo), CTL (Fig. 1Go), and IFN-{gamma} responses were enhanced, consistent with late pGM-CSF administration preferentially enhancing Th1 immunity (Tables IGo and IIGo and Fig. 1Go). Our results also revealed that this type of immune modification was also observed in protein immunization using Mb. These findings demonstrate that the Th1/Th2 balance of an Ag-specific immune response can be dramatically affected by the timing of cytokine plasmid administration.

GM-CSF activates neutrophils, macrophages, DCs, and other mononuclear cells, and also stimulates progenitor/stem cells to mature and migrate from the bone marrow to the peripheral circulation (18, 19, 23). Consistent with previous findings, we observed that GM-CSF enhanced the growth of DCs in vitro, an effect that was enhanced by the addition of IL-4 (32, 49). In our present study (Table IVGo), we coinjected plasmid-pulsed DCs with anti-GM-CSF mAb or anti-IL-4 mAb. The Ab titers were remarkably suppressed by both anti-GM-CSF and IL-4 mAbs. As shown in Table IVGo, anti-IL-4 mAb significantly suppressed DC-mediated Ab response, which suggests that IL-4 is playing an important role for this Ab production. Although we could not observe a statistically significant difference in the serum IL-4 level between pGM-CSF-injected and noninjected groups, we are considering the effect of IL-4 at least in the immunized sites (Fig. 2Go). The weak effect of the pGM-CSF, when injected in the other foot (Tables IGo and IIGo), supports our notion. When we injected pGP160 with the association of anti-GM-CSF mAb into mice, the immune responses were not greatly suppressed (Tables IGo and IIGo). However, a significant level of inhibition was observed, when we injected these mAb with the association of DC transfer. Dramatic inhibition of Ab production might be due to the high sensitivity of anti-GM-CSF mAb or anti-IL-4 mAb against these transferred cells, which are limited in number.

To explore the mechanism by which pGM-CSF augmented Th2 responses when administered 3 days before DNA vaccination, we isolated DC pulsed in vitro with pGP160 and then transferred them into naive recipients. The pattern of immune enhancement (including increased Ab production, DTH, and activation of IL-4-secreting cells) was similar in recipients of pulsed DC and in mice treated with pGM-CSF 3 days before DNA vaccination (Tables IIIGo and VGo and Fig. 5Go). The observation that large numbers of S-100-positive DC were found at the site of pGM-CSF injection 1–3 days after plasmid delivery (Fig. 3Gob) and the weak effect of the pGM-CSF when injected in the other foot (Tables IGo and IIGo) led us to hypothesize that pGM-CSF induces DC to accumulate at the site of DNA vaccination and that the cytokines released by DCs induces a Th2 bias to the resultant immune response. However, this conclusion remains speculative because we were unable to document the accumulation of CD11+ or class II+ cells by immunofluorescence (data not shown). However, we observed the activation of IL-4 in the regional lymph nodes. The increased percentages of both CD8+ and CD11c+ cells in regional lymph nodes were also observed when pGM-CSF was injected 3 days before pGP160 immunization. The results also suggest an increase in DCs in the pGP160 immune regional lymph nodes. This suggests that these increased DCs activated Th2 in immune responses. Recently, it was demonstrated that distinct DC subsets may differentially regulate the Th1/Th2 balance of immune response in mice (50, 51) and humans (52). Pulendran et al. (50) showed that the injection of GM-CSF alone into mice expanded DCs that induced large amounts of Th2 cytokines, whereas cytokine Flt3-ligand led to the expansion of DCs inducing Th1 cytokine production. Treatment with pGM-CSF 3 days before DNA vaccination in our study may be introducing the same situation as above to expand Th2-inducing DCs.

We also studied the effect of administering pGM-CSF 3 days after DNA vaccination. This resulted in the preferential activation of IFN-{gamma}-secreting cells (Fig. 2Go) and the production of Ag-specific IgG2a Ab (Table IGo). While the mechanism underlying this Th1 bias is uncertain, several possibilities are under investigation. First, it is possible that the amount of HIV Ag present 3 days after pGP160 administration promotes the development of Th1 rather than Th2 responses. Consistent with such a possibility, preliminary data from our laboratory show that minute amounts of Ag preferentially stimulate HIV-1-specific CTL or DTH responses, whereas larger amounts of Ag stimulated Ab-dominated Th2 responses (K. Okuda et al., unpublished observations). It is also possible that pGP160 alone preferentially induces a strong Th1-type immune response (27) (perhaps mediated by CpG motifs in the plasmid backbone), and that delaying administration of pGM-CSF allows this type of response to become irrevocably fixed.

Based on the observation that GM-CSF plus IL-12 can enhance CTL activity (11, 17, 24, 29, 32), we coadministered multiple cytokine-encoding plasmids with pGM-CSF in an effort to identify optimally immunostimulatory combinations. Significant enhancement of Th1-type immunity was observed when pGM-CSF was complemented with pIL-12 (Fig. 5Go and Table VIIGo). However, these combinations also resulted in a modest decrease in fecal IgA and serum IgG levels (Table VIGo). In most cases, plasmid combinations did not improve DNA vaccine immunogenicity. However, it remains possible that changes in dose, route, or timing of plasmid administration may improve the efficacy of these other adjuvants (alone or in combination).

Although multiple methods for introducing DNA plasmids into DCs were examined (including gene gun, saline, and cationic liposomes), optimal transfection was obtained using Lipofectin. The efficacy of in vitro transfection by this technique was only 2–5%, as monitored by expression of the ß-galactosidase gene. Consistent with previous reports, we found that transfected DCs had potent immunogenic activity (45, 53, 54). In certain situations (such as the induction of tumor-specific immunity), plasmid-pulsed DCs may be required to break self-tolerance and stimulate a maximal immune response. Thus, further study of this fascinating alternative to direct DNA vaccination would be of considerable interest.

Our results demonstrate that pGM-CSF markedly enhances Th2 immunity when delivered 3 days before DNA vaccination, but enhances Th1 immunity if administered 3 days after DNA vaccination. To our knowledge, this is the first study to show that the timing of cytokine plasmid injection can profoundly effect the Th1/Th2 balance. Reports from other laboratories have been contradictory, some showing that GM-CSF can activate both Th1 and Th2 immune responses while others reporting that GM-CSF stimulates only a Th1 or Th2 response (17, 55, 56, 57). The balance of activation of DC1 or DC2 by pGM-CSF injection might be one reason to cause these Th1 and Th2 responses (50, 52) Our findings explain these apparently contradictory effects by showing that the timing of the administration of pGM-CSF influences the outcome of the resultant immune response. We also find that pGM-CSF-activated DCs play an important role in the induction of Th2 immunity. Given the growing use of plasmid-based immune adjuvants to improve the immunogenicity and efficacy of DNA vaccines, these findings support the need for further detailed study of this class of agent.


    Acknowledgments
 
We are grateful to T. Sasaki, A. Honsho, and T. Takeishi for their secretarial assistance.


    Footnotes
 
1 This work was supported by a Grant-in Aid from the Ministry of Education, Science, Sports, and Culture of Japan (No. 08670311) and the Japan Health Sciences Foundation (No. K-1027). Back

2 Address correspondence and reprint requests to Dr. Kenji Okuda, Department of Bacteriology, Yokohama City University School of Medicine, 3-9 Fukuura, Kanazawa-ku, Yokohama 236-0004, Japan. E-mail address: Back

3 Abbreviations used in this paper: pGM-CSF, plasmid-encoding GM-CSF; DC, dendritic cell; Mb, myoglobin; DTH, delayed-type hypersensitivity; ELISPOT, enzyme-linked immunospot. Back

Received for publication September 20, 1999. Accepted for publication January 13, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lehner, T., L. Tao, C. Panagiotidi, L. S. Klavinskis, R. Brookes, L. Hussain, N. Meyers, S. E. Adams, A. J. Gearing, L. A. Bergmeier. 1994. Mucosal model of genital immunization in male rhesus macaques with a recombinant simian immunodeficiency virus p27 antigen. J. Virol. 68:1624.[Abstract/Free Full Text]
  2. Bukawa, H., K. Sekigawa, K. Hamajima, J. Fukushima, Y. Yamada, H. Kiyono, K. Okuda. 1995. Neutralization of HIV-1 by secretory IgA induced by oral immunization with a new macromolecular multicomponent peptide vaccine candidate. Nat. Med. 1:681.[Medline]
  3. Rowland-Jones, S., J. Sutton, K. Ariyoshi, T. Dong, F. Gotch, S. McAdam, D. Whitby, S. Sabally, A. Gallimore, T. Corrah, et al 1995. HIV-specific cytotoxic T-cells in HIV-exposed but uninjected Gambian women. Nat. Med. 1:59.[Medline]
  4. Shearer, G. M., M. Clerici. 1996. Protective immunity against HIV infection: has nature done the experiment for us?. Immunol. Today 17:21.[Medline]
  5. Fynan, E. F., R. G. Webster, D. H. Fuller, J. R. Haynes, J. C. Santoro, H. L. Robinson. 1995. DNA vaccines: a novel approach to immunization. Int. J. Immunopharmacol. 17:79.[Medline]
  6. Ishii, N., J. Fukushima, T. Kaneko, E. Okada, K. Tani, S.-I. Tanaka, K. Hamajima, K.-Q. Xin, S. Kawamoto, W. C. Koff, et al 1997. Cationic liposomes are a strong adjuvant for a DNA vaccine of human immunodificiency virus type 1. AIDS Res. Hum. Retrov. 13:1421.[Medline]
  7. Sasaki, S., K. Hamajima, J. Fukushima, A. Ihata, N. Ishii, H. Hohri, K. Okuda. 1998. A comparsion of intranasal and intramuscular DNA vaccination against human immunodeficiency virus type 1 with monophosphoryl lipid A adjuvant. Infect. Immun. 66:823.[Abstract/Free Full Text]
  8. Sasaki, S., J. Fukushima, H. Arai, K. Kusakabe, K. Hamajima, N. Ishii, K. Okuda, B. Wahren, J.-M. Ruysschaert, M. Vandenbranden, et al 1997. Human immunodeficiency virus type 1 specific immune responses induced by DNA vaccination are greatly enhanced by mannan-coated diC14-amidine. Eur. J. Immunol. 27:3121.[Medline]
  9. Sasaki, S., T. Tsuji, K. Hamajima, J. Fukushima, N. Ishii, T. Kaneko, K.-Q. Xin, H. Mohri, I. Aoki, T. Okubo, K. Nishioka, K. Okuda. 1997. Monophosphoryl lipid A enhances both humoral and cell-mediated immune responses to DNA vaccination against human immunodeficiency virus type 1. Infect. Immun. 65:3520.[Abstract]
  10. Sasaki, S., K. Sumino, K. Hamajima, J. Fukushima, N. Ishii, S. Kawamoto, H. Mohri, C. R. Kensil, K. Okuda. 1998. Induction of systemic and mucosal immune responses to human immunodeficiency virus type 1 by a DNA vaccine formulated with QS-21 saponin adjuvant via intramuscular and intranasal routes. J. Virol. 72:4931.[Abstract/Free Full Text]
  11. Kim, J. J., M. L. Bagarazzi, N. Trivedi, Y. Hu, K. Kazahaya, D. M. Wilson, R. Ciccarelli, M. A. Chattergoon, K. Dang, S. Mahalingam, et al 1997. Engineering of in vivo immune responses to DNA immunization via codelivery of costimulatory molecule genes. Nat. Biotechnol. 15:641.[Medline]
  12. Xin, K.-Q., K. Hamajima, S. Sasaki, A. Honsho, T. Tsuji, N. Ishii, X.-R. Cao, Y. Lu, J. Fukushima, P. Shapshak, S. Kawamoto, K. Okuda. 1998. Intranasal administration of human immunodeficiency virus type-1 (HIV-1) DNA vaccine with interleukin-2 expression plasmid enhances cell-mediated immunity against HIV-1. Immunol. 94:438.[Medline]
  13. Lu, Y., K.-Q. Xin, K. Hamajima, T. Tsuji, I. Aoki, J. Yang, S. Sasaki, J. Fukushima, T. Yoshimura, S. Toda, E. Okada, K. Okuda. 1999. Macrophage inflammatory protein-1{alpha} (MIP-1{alpha}) expression plasmid enhances DNA vaccine-induced immune response against HIV-1. Clin. Exp. Immunol. 115:335.[Medline]
  14. Tsuji, T., K. Hamajima, N. Ishi, I. Aoki, J. Fukushima, K.-Q. Xin, S. Kawamoto, S. Sasaki, K.-I. Matsunaga, Y. Ishigatsubo, et al 1997. Immunodulatory effects of plasmid expressing B7-2 on human immunodeficiency virus-1 specific cell-mediated immunity induced by plasmid-encoded the viral antigen. Eur. J. Immunol. 27:782.[Medline]
  15. Ahlers, J. D., N. Dunlop, D. W. Alling, P. L. Nara, J. A. Berzofsky. 1997. Cytokine-in-adjuvant steering of the immune response phenotype to HIV-1 vaccine constructs: granulocyte-macrophage colony-stimulating factor and TNF-{alpha} synergize with IL-12 to enhance induction of cytotoxic T lymphocytes. J. Immunol. 158:3947.[Abstract]
  16. Tsuji, T., J. Fukushima, K. Hamajiam, N. Ishii, I. Aoki, H. Bukawa, Y. Ishigatsubo, K. Tani, T. Okubo, M. E. Dort, K. Okuda. 1997. HIV-1-specific cell-mediated immunity is enhanced by co-inoculation of TCA3 expression plasmid DNA vaccine. Immunol. 90:1.[Medline]
  17. Okada, E., S. Sasaki, N. Ishii, I. Aoki, T. Yasuda, K. Nishioka, J. Fukushima, B. Wahren, K. Okuda. 1997. Intranasal immunization of a DNA vaccine with interleukin 12 and granulocyte macrophage colony stimulating factor (GM-CSF) expressing plasmids in liposomes induce strong mucosal and cell-mediated immune responses against HIV-1 antigen. J. Immunol. 159:3638.[Abstract]
  18. Kitamura, T., K. Hayashida, K. Sakamaki, T. Yokota, K. Arai, A. Miyajima. 1991. Reconstitution of functional receptors for human granulocyte/macrophage colony-stimulating factor (GM-CSF): evidence that the protein encoded by the AIC2B cDNA is a subunit of the murine GM-CSF receptor. Proc. Natl. Acad. Sci. USA 88:5082.[Abstract/Free Full Text]
  19. Kitamura, T., N. Sato, K. Arai, A. Miyajima. 1991. Expression cloning of the human IL-3 receptor cDNA reveals a shared ß subunit for the human IL-3 and GM-CSF receptors. Cell 66:1165.[Medline]
  20. Wakimoto, H., J. Abe, R. Tsunoda, M. Aoyagi, K. Hirakawa, H. Hamada. 1996. Intensified antitumor immunity by a cancer vaccine that produces granulocyte-macrophage colony-stimulating factor plus interleukin 4. Cancer Res. 56:1828.[Abstract/Free Full Text]
  21. Jager, E., M. Ringhoffer, H. P. Dienes, M. Arand, J. Karbach, D. Jager, C. Ilsemann, M. Hagedorn, F. Oesch, A. Knuth. 1996. Granulocyte-macrophage-colony-stimulating factor enhances immune responses to melanoma-associated peptides in vivo. Int. J. Cancer 67:54.[Medline]
  22. Jones, T., A. Stern, R. Lin. 1994. Potential role of granulocyte-macrophage colony-stimulating factor as vaccine adjuvant. Eur. J. Clin. Microbiol. Infect. Dis. 13:(Suppl. 2):S47.
  23. Disis, M. L., H. Bernhard, F. M. Shiota, S. L. Hand, J. R. Gralow, E. S. Huseby, S. Gillis, M. A. Cheever. 1996. Granulocyte-macrophage colony-stimulating factor: an effective adjuvant for protein and peptide-based vaccines. Blood 88:202.[Abstract/Free Full Text]
  24. Kim, J. J., V. Ayyavoo, M. L. Bagarazzi, M. A. Chattergoon, K. Dang, B. Wang, J. D. Boyer, D. B. Weiner. 1997. In vivo engineering of a cellular immune response by coadministration of IL-12 expression vector with a DNA immunogen. J. Immunol. 158:816.[Abstract]
  25. Scott, P.. 1993. IL-12: initiation cytokine for cell-mediated immunity. Science 260:496.[Free Full Text]
  26. Tsuji, T., K. Hamajima, J. Fukushima, K.-Q. Xin, N. Ishii, I. Aoki, Y. Ishigatsubo, K. Tani, S. Kawamoto, Y. Nitta, et al 1997. Enhancement of cell-mediated immunity against HIV-1 induced by coinoculation of plasmid-encoded HIV-1 antigen with plasmid expressing interleukin-12. J. Immunol. 158:4008.[Abstract]
  27. Okuda, K., H. Bukawa, K. Hamajima, S. Kawamoto, K. Sekigawa, Y. Yamada, S. Tanaka, N. Ishii, I. Aoki, M. Nakamura, et al 1995. Induction of potent humoral and cell-mediated immune responses following direct injection of DNA encoding the HIV-1 env and rev gene products. AIDS Res. Hum. Retrov. 11:933.[Medline]
  28. Karasuyama, H., N. Tohyama, T. Tada. 1989. Autocrine growth and tumorigenicity of interleukin 2-dependent helper T cells transfected with IL-2 gene. J. Exp. Med. 169:13.[Abstract/Free Full Text]
  29. Davis, H. L., M. L. Michel, R. G. Whalen. 1993. DNA-based immunization induces continuous secretion of hepatitis B surface antigen and high levels of circulating antibody. Hum. Mol. Genet. 2:1847.[Abstract/Free Full Text]
  30. Okuda, K., S. S. Twining, C. S. David, M. Z. Atassi. 1979. Genetic control of immune response to sperm whale myoglobin in mice. II. T lymphocyte proliferative response to the synthetic antigenic sites. J. Immunol. 123:182.[Abstract/Free Full Text]
  31. Steinman, R. M., G. Kaplan, M. D. Witmer, Z. A. Cohn. 1979. Identification of a novel cell type in peripheral lymphoid organs of mice. V. Purification of spleen dendritic cells, new surface markers, and maintenance in vitro. J. Exp. Med. 149:1.[Abstract/Free Full Text]
  32. Sallusto, F., A. Lanzavecchia. 1994. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor {alpha}. J. Exp. Med. 179:1109.[Abstract/Free Full Text]
  33. Gao, X., L. Huang. 1991. A novel cationic liposome reagent for efficient transfection of mammalian cells. Biochem. Biophys. Res. Commun. 179:280.[Medline]
  34. Groebe, D. R., A. E. Chung, C. Ho. 1990. Cationic lipid-mediated co-transfection of insect cells. Nucleic Acids Res. 18:4033.[Free Full Text]
  35. Takahashi, H., T. Takeshita, B. Morein, S. Putney, R. N. Germain, J. A. Berzofsky. 1990. Induction of CD8+ cytotoxic T cells by immunization with purified HIV-1 envelope protein in ISCOMs. Nature 344:873.[Medline]
  36. Achour, A., O. Picard, D. Zagury, P. S. Sarin, R. C. Gallo, P. H. Naylor, A. L. Goldstein. 1990. HGP-30, a synthetic analogue of human immunodeficiency virus (HIV) p17, is a target for cytotoxic lymphocytes in HIV-infected individuals. Proc. Natl. Acad. Sci. USA 87:7045.[Abstract/Free Full Text]
  37. Matthes, T., V. Kindler, R. H. Zubler. 1994. Semiquantitative, nonradioactive RT-PCR detection of immunoglobulin mRNA in human B cells and plasma cells. DNA Cell Biol. 13:429.[Medline]
  38. Favre, N., G. Bordmann, W. Rudin. 1997. Comparison of cytokine measurements using ELISA, ELISPOT and semi-quantitative RT-PCR. J. Immunol. Methods 204:57.[Medline]
  39. Layton, G. T., S. J. Harris, A. J. Gearing, P. M. Hill, J. S. Cole, J. C. Griffiths, N. R. Burns, A. J. Kingsman, S. E. Adams. 1993. Induction of HIV-specific cytotoxic T lymphocytes in vivo with hybrid HIV-1 V3:Ty-virus-like particles. J. Immunol. 151:1097.[Abstract]
  40. Takahashi, H., R. N. Germain, B. Moss, J. A. Berzofsky. 1990. An immunodominant class I-restricted cytotoxic T lymphocyte determinant of human immunodeficiency virus type 1 induces CD4 II-restricted help for itself. J. Exp. Med. 171:571.[Abstract/Free Full Text]
  41. Shirai, A., K. Holmes, D. Klinman. 1993. Detection and quantitaion of cells secreting IL-6 under physiologic conditions in BALB/c mice. J. Immunol. 150:793.[Abstract]
  42. Okuyama, T., Y. Maehara, Y. Kakeji, S. Tsuijitani, D. Korenaga, K. Sugimachi. 1998. Interrelation between tumor-associated cell surface glycoprotein and host immune response in gastric carcinoma patients. Cancer 82:1468.[Medline]
  43. Steinman, R. M., Z. A. Cohn. 1974. Identification of a novel cell type in peripheral lymphoid organs of mice. II. Functional properties in vitro. J. Exp. Med. 139:380.[Abstract]
  44. Gabrilovich, D. I., H. L. Chen, K. R. Girgis, H. T. Cunningham, G. M. Meny, S. Nadaf, D. Kavanaugh, D. P. Carbone. 1996. Production of vascular endothelial growth factor by human tumors inhibits the functional maturation of dendritic cells. [Published erratum appears in 1996 Nat. Med. 2:1267.]. Nat. Med. 2:1096.[Medline]
  45. Steinman, R. M.. 1991. The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9:271.[Medline]
  46. Murata, T., J. Taguchi, R. K. Puri, H. Mohri. 1999. Sharing of receptor subunits and signal transduction pathway between the IL-4 and IL-3 receptor system. Int J Hematol 69:13.[Medline]
  47. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
  48. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12:635.[Medline]
  49. Inaba, K., M. Inabe, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu, R. M. Steinman. 1992. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 176:1693.[Abstract/Free Full Text]
  50. Pulendran, B., J. L. Smith, G. Caspary, K. Brasel, D. Pettit, E. Maraskovsky, C. R. Maliszewski. 1999. Distinct dendritic cell subsets differentially regulate the class of immune response in vivo. Proc. Natl. Acad. Sci. USA 96:1036.[Abstract/Free Full Text]
  51. Maldonado-Lopez, R., T. De Smedt, P. Michel, J. Godfoid, B. Pajak, C. Heirman, K. Thielemans, O. Leo, J. Urbain, M. Moser. 1999. CD8{alpha}+ and CD8{alpha}- subclasses of dendritic cells direct the developement of distinct T helper cells in vivo. J Exp Med. 189:587.[Abstract/Free Full Text]
  52. Rissoan, M. C., V. Soumelis, N. Kadowaki, G. Grouard, F. Briere, R. Waal Malefyt, Y. J. Liu. 1999. Reciprocal control of T helper cell and dendritic cell differentiation. Science 283:1183.[Abstract/Free Full Text]
  53. Girolomoni, G., P. Ricciardi Castagnoli. 1997. Dendritic cells hold promise for immunotherapy. Immunol. Today 18:102.[Medline]
  54. Celluzzi, C. M., J. I. Mayordomo, W. J. Storkus, M. T. Lotze, Jr L. D. Falo. 1996. Peptide-pulsed dendritic cells induce antigen-specific CTL-mediated protective tumor immunity. J. Exp. Med. 183:283.[Abstract/Free Full Text]
  55. Stampfli, M. R., R. E. Wiley, G. S. Neigh, B. U. Gajewska, X. F. Lei, D. P. Snider, Z. Xing, M. Jordana. 1998. GM-CSF transgene expression in the airway allows aerosolized ovalbumin to induce allergic sensitization in mice. J. Clin. Invest. 102:1704.[Medline]
  56. Liu, H. M., S. E. Newbrough, S. K. Bhatia, C. E. Dahle, A. M. Krieg, G. J. Weiner. 1998. Immunostimulatory CpG oligodeoxynucleotides enhance the immune response to vaccine strategies involving granulocyte-macrophage colony-stimulating factor. Blood 92:3730.[Abstract/Free Full Text]
  57. Sin, J. I., J. J. Kim, K. E. Ugen, R. B. Ciccarelli, T. J. Higgins, D. B. Weiner. 1998. Enhancement of protective humoral (Th2) and cell-mediated (Th1) immune responses against herpes simplex virus-2 through co-delivery of granulocyte-macrophage colony-stimulating factor expression cassettes. Eur. J. Immunol. 28:3530.[Medline]



This article has been cited by other articles:


Home page
CVIHome page
L. V. Bentancor, M. Bilen, R. J. F. Brando, M. V. Ramos, L. C. S. Ferreira, P. D. Ghiringhelli, and M. S. Palermo
A DNA Vaccine Encoding the Enterohemorragic Escherichia coli Shiga-Like Toxin 2 A2 and B Subunits Confers Protective Immunity to Shiga Toxin Challenge in the Murine Model
Clin. Vaccine Immunol., May 1, 2009; 16(5): 712 - 718.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
A. O. Abdalla, L. Hansson, I. Eriksson, B. Nasman-Glaser, E. D. Rossmann, H. Rabbani, H. Mellstedt, and A. Osterborg
Idiotype protein vaccination in combination with adjuvant cytokines in patients with multiple myeloma - evaluation of T-cell responses by different read-out systems
Haematologica, January 1, 2007; 92(1): 110 - 114.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. R. Ferrone, M.-A. Perales, S. M. Goldberg, C. J. Somberg, D. Hirschhorn-Cymerman, P. D. Gregor, M. J. Turk, T. Ramirez-Montagut, J. S. Gold, A. N. Houghton, et al.
Adjuvanticity of plasmid DNA encoding cytokines fused to immunoglobulin fc domains.
Clin. Cancer Res., September 15, 2006; 12(18): 5511 - 5519.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Someya, K.-Q. Xin, K. Matsuo, K. Okuda, N. Yamamoto, and M. Honda
A Consecutive Priming-Boosting Vaccination of Mice with Simian Immunodeficiency Virus (SIV) gag/pol DNA and Recombinant Vaccinia Virus Strain DIs Elicits Effective Anti-SIV Immunity
J. Virol., September 15, 2004; 78(18): 9842 - 9853.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
X. Jiao, R. Y.-H. Wang, Q. Qiu, H. J. Alter, and J. W.-K. Shih
Enhanced hepatitis C virus NS3 specific Th1 immune responses induced by co-delivery of protein antigen and CpG with cationic liposomes
J. Gen. Virol., June 1, 2004; 85(6): 1545 - 1553.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. A. Siddiqui, T. Phillips, H. Charest, R. B. Podesta, M. L. Quinlin, J. R. Pinkston, J. D. Lloyd, M. Paz, R. M. Villalovos, and J. Pompa
Induction of Protective Immunity against Schistosoma mansoni via DNA Priming and Boosting with the Large Subunit of Calpain (Sm-p80): Adjuvant Effects of Granulocyte-Macrophage Colony-Stimulating Factor and Interleukin-4
Infect. Immun., July 1, 2003; 71(7): 3844 - 3851.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. B. Geldhof, J. A. Van Ginderachter, Y. Liu, W. Noel, G. Raes, and P. De Baetselier
Antagonistic effect of NK cells on alternatively activated monocytes: a contribution of NK cells to CTL generation
Blood, December 1, 2002; 100(12): 4049 - 4058.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. H. Barouch, S. Santra, K. Tenner-Racz, P. Racz, M. J. Kuroda, J. E. Schmitz, S. S. Jackson, M. A. Lifton, D. C. Freed, H. C. Perry, et al.
Potent CD4+ T Cell Responses Elicited by a Bicistronic HIV-1 DNA Vaccine Expressing gp120 and GM-CSF
J. Immunol., January 15, 2002; 168(2): 562 - 568.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. C. Moore, W.-p. Kong, B. K. Chakrabarti, and G. J. Nabel
Effects of Antigen and Genetic Adjuvants on Immune Responses to Human Immunodeficiency Virus DNA Vaccines in Mice
J. Virol., January 1, 2002; 76(1): 243 - 250.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W. S. Meng, L. H. Butterfield, A. Ribas, V. B. Dissette, J. B. Heller, G. A. Miranda, J. A. Glaspy, W. H. McBride, and J. S. Economou
{alpha}-Fetoprotein-specific Tumor Immunity Induced by Plasmid Prime-Adenovirus Boost Genetic Vaccination
Cancer Res., December 1, 2001; 61(24): 8782 - 8786.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-W. Chen, C.-H. Pan, H.-W. Huan, M.-Y. Liau, J.-R. Chiang, and M.-H. Tao
Suppression of Immune Response and Protective Immunity to a Japanese Encephalitis Virus DNA Vaccine by Coadministration of an IL-12-Expressing Plasmid
J. Immunol., June 15, 2001; 166(12): 7419 - 7426.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Haddad, J. Ramprakash, M. Sedegah, Y. Charoenvit, R. Baumgartner, S. Kumar, S. L. Hoffman, and W. R. Weiss
Plasmid Vaccine Expressing Granulocyte-Macrophage Colony-Stimulating Factor Attracts Infiltrates Including Immature Dendritic Cells into Injected Muscles
J. Immunol., October 1, 2000; 165(7): 3772 - 3781.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kusakabe, K.-i.
Right arrow Articles by Okuda, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kusakabe, K.-i.
Right arrow Articles by Okuda, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS