|
|
||||||||
Medical Research Council Protein Phosphorylation Unit, Department of Biochemistry, University of Dundee, Dundee, United Kingdom
| Abstract |
|---|
|
|
|---|
B, have been implicated in the
transcription of the COX-2 gene. However, PD 98059 and/or SB 203580 did
not prevent the LPS-induced increase in the level of the transcription
factor C/EBPß, and none of the four inhibitors used in this study
prevented the activation of NF-
B. Our results demonstrate that two
different mitogen-activated protein kinase cascades are rate limiting
for the LPS-induced activation of CREB/ATF1 and the transcription of
the COX-2 and IL-1ß genes. They also suggest that MSK1 and MSK2 may
play a role in these processes and hence are potential targets for the
development of novel antiinflammatory drugs. | Introduction |
|---|
|
|
|---|
and SAPK2b/p38ß2
(collectively termed SAPK2/p38). Thus, in 293 cells, the activation of
MSK1 induced by growth factors or phorbol esters is suppressed by PD
98059, a drug that specifically inhibits the activation of MAPK
kinase-1 (also called MAPK or ERK kinase) and hence the activation of
MAPKs/ERKs, whereas the activation of MSK1 induced by UV radiation,
oxidative stress, and other cell-damaging stimuli is prevented by SB
203580, a specific inhibitor of SAPK2/p38 (1). Some agonists are activators of both the classical MAPK cascade and the SAPK2/p38 pathway, such as TNF in HeLa cells, nerve growth factor in PC12 cells, and fibroblast growth factor in SK-N-MC cells. After exposure to these stimuli, the activation of MSK1 is partially inhibited by PD 98059, partially inhibited by SB 203580, and suppressed completely only when cells are exposed to both drugs (1).
MSK1 is localized in the nuclei of stimulated or unstimulated cells, suggesting that its physiological substrate(s) may be present in this organelle (1). Two potential in vivo substrates are the cyclic AMP response element (CRE)-binding protein (CREB) and the closely related activating transcription factor-1 (ATF1). These transcription factors become active only when they are phosphorylated at Ser133 and Ser63, respectively. MSK1 phosphorylates CREB at Ser133 in vitro and with an extremely low Km, and several further lines of evidence are consistent with the hypothesis that CREB and ATF1 are two of its physiological substrates. 1) CREB and ATF1 become phosphorylated at the relevant sites in response to growth factors, phorbol esters, or cell-damaging stimuli. Phosphorylation induced by growth factors and phorbol esters is prevented by PD 98059, whereas phosphorylation induced by UV radiation and other stresses is prevented by SB 203580. 2) PD 98059 and SB 203580 are both required to suppress the phosphorylation of CREB and ATF1 by agonists that activate both MAPKs/ERKs and SAPK2/p38. 3) Ro 318220, a potent inhibitor of MSK1 activity and a few other protein kinases, prevents the phosphorylation of CREB and ATF1 by growth factors, phorbol esters, or cell-damaging stimuli, but not the phosphorylation of CREB induced by the cyclic AMP-elevating agent forskolin which is mediated by cyclic AMP-dependent protein kinase (PKA) (1). The only other protein kinases known to be activated by SAPK2/p38 and to phosphorylate CREB at Ser133 are MAPK-activated protein kinase-2 (MAPKAP-K2) and the closely related MAPKAP-K3 (2). However, neither of these protein kinases are inhibited by concentrations of Ro 318220 that ablate MSK1 activity (1, 3).
Inflammatory mediators, such as PGs and leukotrienes, and proinflammatory cytokines, such as IL-1 and TNF, are produced in macrophages during bacterial infection by LPS-activated signal transduction pathways. These substances play key roles in mounting the immune responses needed to fight infection, but they are a double-edged sword because their uncontrolled production can be a cause of chronic inflammatory diseases. For these reasons, drugs that are capable of suppressing the production of inflammatory mediators and proinflammatory cytokines are useful in treating these conditions. Here, we have investigated the signal transduction pathways by which LPS induces IL-1ß and cyclooxygenase-2 (COX-2), the enzyme that catalyzes the rate-limiting step in prostaglandin and leukotriene synthesis (4). Because the COX-2 (5) and IL-1ß (6) promoters both contain a CRE, we wondered whether MSK1 might be present in macrophages and play a role in mediating the induction of COX-2 and IL-1ß. If this were the case, then MSK1 could be a potential target for an antiinflammatory drug. In this paper, we show that MSK1, and a closely related isoform (MSK2), are both activated when macrophages are stimulated with LPS. We also show that drugs that suppress the activation or activity of MSK1 and MSK2 prevent the LPS-induced phosphorylation of CREB and ATF1, the transcription of the COX-2 and IL-1ß genes, and the induction of the COX-2 protein.
| Materials and Methods |
|---|
|
|
|---|
Reagents and antibiotics for cell culture were purchased from
Life Technologies (Paisley, U.K.); PD 98059 from New England Biolabs
(Beverly, MA); Ro 318220, H89, and SB 203580 from Calbiochem
(Nottingham, U.K.); forskolin and 3-isobutyl-1-methylxanthine (IBMX)
from Sigma (Poole, U.K.); complete proteinase inhibitor mixture from
Boehringer (Lewes, U.K.); affinity-purified polyclonal goat
anti-COX-2 Ab and a monoclonal mouse anti-C/EBPß Ab from
Santa Cruz Biotechnology (Santa Cruz, CA); affinity-purified polyclonal
rabbit anti-phospho-CREB from Upstate Biotechnology (Lake Placid,
NY); [
-32P]ATP and enhanced
chemiluminescence (ECL) reagent from Amersham Pharmacia Biotech (Little
Chalfont, U.K.), RNeasy Mini Kit from Qiagen (Crawley, West Sussex,
U.K.); and the access RT-PCR System from Promega (Southampton, U.K.).
Murine RAW264 macrophages were obtained from the European Cell Culture
Collection (Salisbury, Wiltshire, U.K.); LPS was a gift from Dr. John
Lee (SmithKline Beecham, PA); and U 0126 was generously provided by Dr.
Sue Cartlidge (AstraZeneca Pharmaceuticals, Macclesfield, Cheshire,
U.K.).
Cell culture and stimulation
RAW264 macrophages were maintained in a 95% air, 5% CO2 atmosphere in DMEM plus 10% (v/v) heat-inactivated FCS, 100 U/ml penicillin, 100 µg/ml streptomycin. The day before stimulation, the macrophages were plated at a density of 2 x 106 cells/6-cm plate; 2 h before stimulation, the medium was removed and replaced with 2 ml DMEM. The cells were then stimulated with 1100 ng/ml LPS or 20 µM forskolin plus 10 µM IBMX, for the times indicated in the figure legends. Where indicated, SB 203580 (10 µM) and/or PD 98059 (50 µM), and/or U0126 (10 µM) or Ro 318220 (5 µM) or H89 (1050 µM) were added 1 h before stimulation.
Cell lysis
After stimulation, the medium was aspirated, and the cells were solubilized in 0.2 ml ice cold lysis buffer (50 mM Tris-acetate (pH 7.0), 1 mM EDTA, 1 mM EGTA, 1% (w/v) Triton X-100, 1 mM sodium o-vanadate, 10 mM sodium glycerophosphate, 50 mM NaF, 5 mM sodium pyrophosphate, 0.27 M sucrose, 2 µM microcystin-LR, 1 mM benzamidine, 0.1% (v/v) 2-ME and complete proteinase inhibitor mixture, 1 tablet per 50 ml). The samples were then snap frozen in liquid nitrogen and stored in aliquots at -80°C until analysis. Protein concentrations were determined according to (7).
Preparation of nuclear extracts
After stimulation, the cells were resuspended and washed three times in buffer A (10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 1 mM DTT, 0.1 mM sodium orthovanadate, 10 mM sodium glycerophosphate, 2 µM microcystin-LR, 1 mM benzamidine, 0.1% (v/v) 2-ME, and complete proteinase inhibitor mixture), lysed in buffer A plus 0.1% (v/v) Nonidet P-40 for 5 min on ice and then spun at 13,500 x g for 10 min at 4°C. The nuclear pellet was resuspended in buffer B (20 mM HEPES (pH 7.9), 1.5 mM MgCl2, 420 mM NaCl, 1 mM DTT, 0.1 mM sodium o-vanadate, 10 mM sodium glycerophosphate, 2 µM microcystin-LR, 1 mM benzamidine, 0.1% (v/v) 2-ME, and complete proteinase inhibitor mixture), rotated end over end for 15 min at 4°C, and then sonicated in a 10°C water bath (four 15-s pulses during 4 min). The samples were centrifuged at 13,500 x g for 15 min at 4°C, and the supernatants were removed, snap frozen in liquid nitrogen, and stored in aliquots at -80°C until analysis. Protein concentrations were determined according to the method described in Ref. 7 .
Ab production
All Abs were raised in sheep at the Scottish Antibody Production Unit (Carluke, U.K.), and the antisera were purified by affinity chromatography on Ag peptide Sepharose columns. An anti-MSK1 Ab was raised against the peptide FKRNAAVIDPLQFHMGVER corresponding to residues 384402 of MSK1 (1), and a further Ab was raised against the full length human MSK1 protein. An anti-MSK2 Ab was raised against the peptide RAPVASKGAPRRANGPLPPS corresponding to residues 753772 of MSK2.
Immunoprecipitation and assay of protein kinases
MSK1 and MSK2 were immunoprecipitated individually from 0.5 and 1.0 mg cell lysate protein, respectively, using the anti-peptide Abs described above. The immunoprecipitates were washed and assayed at 30°C as described (1). One unit of MSK1 or MSK2 activity was defined as the amount that catalyzes the incorporation of 1 nmol phosphate into the peptide GRPRTSSFAEG in 1 min. MAP kinase-activated protein kinase-1 (MAPKAP-K1, also known as p90RSK) was immunoprecipitated from cell lysates (50 µg protein) with an Ab raised against the peptide RNQSPVLEPVGRSTLAQRRGIKK corresponding to residues 605627 of murine MAPKAP-K1b (RSK2 isoform). This Ab immunoprecipitates MAPKAP-K1a (RSK1) as well as MAPKAP-K1b (8). The immunoprecipitates were washed and assayed at 30°C as described (8). One unit of MAPKAP-K1 activity was defined as the amount that catalyzes the incorporation of 1 nmol phosphate into [G245,G246]S6- 218249(218249)] (a peptide closely related to the C terminus of ribosomal protein S6) in 1 min. MAPKAP-K2 was immunoprecipitated in an manner identical to that for MAPKAP-K1 using an Ab raised against the peptide MTSALATMRVDYEQIK corresponding to residues 356371 of the human protein. This Ab immunoprecipitates MAPKAP-K3, as well as MAPKAP-K2 (9). MAPKAP-K2 was assayed as described (10), and one unit was the amount of enzyme that catalyzes the incorporation of 1 nmol phosphate into the peptide KKLNRTLSVA in 1 min.
Immunoblotting
Proteins were denatured in SDS, electrophoresed on a 10% SDS/polyacrylamide gel, transferred to nitrocellulose membrane, immunoblotted with the Abs described below, which were detected with the ECL reagent. For immunoblotting of MSK1, MSK1 was first immunoprecipitated with the anti-peptide Ab and then immunoblotted using the Ab raised against the full length protein. For immunoblotting of C/EBPß, nuclear cell extracts were prepared as described above and immunoblotted with a C/EBPß-specific Ab. For immunoblotting of COX-2 and CREB, cell lysate (30 µg protein) was electrophoresed and immunoblotted with anti-COX-2 Ab (1.0 µg/ml) and phospho-specific Ab recognizing CREB phosphorylated at Ser133 and ATF1 phosphorylated at Ser63.
Reverse transcriptase-PCRs
Total RNA was prepared from LPS-stimulated or control RAW264 cells using the RNeasy Mini Kit according to the manufacturers protocol. Total RNA was measured and 100 ng were reverse transcribed using Promega avian myeloblastosis virus reverse transcriptase (5 U/ml) with the oligonucleotides GTTGGATACAGGCCAGACTTTGTTG and GAGGGTAGGCTGGCCTATAGGCT (coding for the housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (HPRT)), AAGCTCTCCACCTCAATGGACAG and CTCAAACTCCACTTTGCTCTTGA (coding for the IL-1ß gene), and CAGCAAATCCTTGCTGTTCC and TGGGCAAAGAATGCAAACATC (coding for the COX-2 gene). Conditions for PCR amplification of the resulting first-strand DNA template were 94°C denaturing for 30 s, 60°C annealing for 1 min, 68°C extension for 1 min, 30 cycles using thermostable Tfl DNA polymerase (5 U/ml), and 1 mM MgSO4. The PCR products showed a single band of 515 bp for COX-2, a single band of 260 bp for IL-1ß, and a single band of 352 bp for HPRT.
| Results |
|---|
|
|
|---|
To measure MSK1 and MSK2 activities in macrophage extracts, we
first raised Abs capable of immunoprecipitating these protein kinases
specifically. The specificity of the MSK1 Abs was established by the
finding that immunoprecipitation was abolished by preincubating the Ab
with the MSK1 peptide immunogen, but not the MSK2 peptide immunogen
(Fig. 1
A). Moreover, after
immunoprecipitation with MSK1-peptide Ab, an immunoreactive band
comigrating with authentic MSK1 was detected by immunoblotting with an
Ab raised against the full length protein. This band was not detected
in the immunoprecipitates if the MSK1 peptide Ab was first preincubated
with the peptide immunogen or if the Ab was replaced by control IgG
(Fig. 1
B). Similarly, the immunoprecipitation of MSK2 was
abolished by preincubation of the MSK2 Ab with the MSK2 peptide Ag, but
not the MSK1 peptide Ag (Fig. 1
A). Using these Abs, the
activities of MSK1 and MSK2 were found to be negligible in unstimulated
macrophages but greatly elevated after stimulation with LPS. Activation
peaked 30 min after stimulation with 100 ng/ml LPS and 60 min after
stimulation with 10 ng/ml LPS and declined thereafter (Fig. 1
, C and D). Little activation was observed after
stimulation with 1 ng/ml LPS.
|
|
The LPS-induced phosphorylation of CREB and ATF1 is mediated by two different MAP kinase cascades
Two putative physiological substrates for MSK1/MSK2 are the
introduction transcription factors CREB and ATF1. As shown in Fig. 3
A, LPS induced the
phosphorylation of CREB at Ser133 and the
phosphorylation of ATF1 at Ser63. Like the
activation of MSK1 and MSK2, the phosphorylation of CREB and ATF1
peaked after 1 h and declined thereafter. Similarly, the
LPS-induced phosphorylation of CREB and ATF1 was partially inhibited by
SB 203580, partially inhibited by PD 98059, and completely inhibited in
the presence of both drugs (Fig. 3
B). Similar results were
obtained in additional experiments in which U0126 replaced PD 98059
(data not shown).
|
The COX-2 promoter contains a CRE (5). We therefore
decided to examine whether the signaling pathways that mediate the
LPS-stimulated induction of this enzyme are the same as those required
to activate CREB. The COX-2 protein was present at low levels in
unstimulated macrophages but was strongly induced 2 h after
exposure to LPS. Induction was maximal after 4 h and maintained
for at least 8 h (Fig. 4
A). The induction of COX-2
was partially inhibited by SB 203580, partially inhibited by PD 98059,
and almost completely suppressed in the presence of both drugs (Fig. 4
B). Similar results were obtained in additional experiments
in which U0126 replaced PD 98059 (data not shown).
|
|
In contrast to the level of COX-2 and IL-1ß mRNA, the mRNA encoding
the housekeeping gene HPRT was unaffected by LPS, PD 98059, and SB
203580 (Fig. 5
).
Effect of Ro 318220 on LPS-stimulated proteins
Ro 318220 was originally developed as a protein kinase C inhibitor
but is now known to inhibit several other protein kinases with similar
potency in vitro, namely MSK1, MAPKAP-K1, p70 S6 kinase, and glycogen
synthase kinase-3. In contrast, 20 other protein kinases including
those known to be activated by SAPK2/p38 (i.e., MAPKAP-K2 and p38
regulated and activated protein kinase (PRAK) (13)) are
unaffected at drug concentrations that ablate MSK1 activity ( Refs.
1 and 3 ; S. Davies, H. Reddy, and P. Cohen,
unpublished experiments). To test the specificity of Ro 318220 more
rigorously, we first examined whether it affected the activation of the
MAPK/ERK and SAPK2a/p38 pathways by LPS. Cells were incubated with Ro
318220 (5 µM) before stimulation with LPS, and the cells then were
lysed. MSK1, MSK2, MAPKAP-K1, or MAPKAP-K2 were immunoprecipitated from
the cell lysates (1) and assayed in the absence of Ro
318220 (Fig. 2
). These experiments showed that the LPS-induced
activation of all four protein kinases was unaffected by Ro 318220 (5
µM). Thus, Ro 318220 does not inhibit any protein kinase in the
signaling pathways leading to the activation of MSK1, MSK2, MAPKAP-K1,
and MAPKAP-K2 in these cells.
Because the activation of MSK1 is prevented by SB 203580 plus PD 98059
and the activity of MSK1 is abolished by Ro 318220, any proteins with
in vivo phosphorylation that is prevented by SB 203580 plus PD 98059,
or by Ro 318220, are candidates to be physiological substrates for
MSK1. In the present study, we found that Ro 318220 (5 µM) completely
prevented the LPS-induced phosphorylation of CREB at
Ser133 and ATF1 at Ser63
(Fig. 3
). The same concentration of Ro 318220 also suppressed the
LPS-stimulated induction of COX-2 protein (Fig. 4B
), COX-2
mRNA, and IL-1ß mRNA. In contrast, the mRNA encoding HPRT was
unaffected by Ro 318220 (Fig. 5B
).
Effect of H89 on LPS-stimulated proteins
H89 was originally developed as a specific inhibitor of PKA but we
have recently shown that it is an equally potent inhibitor of several
other protein kinases in vitro, namely, MSK1, p70 S6 kinase and
Rho-dependent protein kinase
. In contrast, 20 other protein kinases
including those activated by SAPK2/p38 (i.e., MAPKAP-K2 and PRAK
(13)), as well as protein kinase C were unaffected at drug
concentrations that ablate MSK1 activity (S. Davies, H. Reddy, and P.
Cohen, unpublished experiments).
To test the specificity of H89 further, we first examined whether it
affected the ability of LPS to activate the MAPK/ERK and SAPK2a/p38
pathways. Cells were incubated with 1050 µM H89 before stimulation
with LPS, and the cells were then lysed. MSK1 was immunoprecipitated
from the cell lysates (1) and assayed in the absence of
H89. These experiments showed that the LPS-induced activation of MSK1
(Fig. 6
A) was unaffected by
H89 after 1 h. This demonstrated that at the concentrations
tested, H89 does not decrease the activity of any protein kinase in
these pathways to a level where it would become rate limiting for the
activation of MSK1. Therefore, proteins for which phosphorylation in
vivo is prevented by SB 203580 plus PD 98059, or by H89, are candidates
to be physiological substrates for MSK1. In the present study, we found
that H89 suppressed the LPS-induced phosphorylation of CREB at
Ser133 and ATF1 at Ser63
(Fig. 6
B). The LPS-stimulated induction of the COX-2 protein
(Fig. 6
C) and the induction of the IL-1ß mRNA (Fig. 6
D) were inhibited at slightly higher concentrations. In
contrast, the mRNA encoding HPRT was unaffected by the same
concentration of H89 (Fig. 6
D), demonstrating that the drug
does not inactivate any essential component of the general
transcription apparatus.
|
The in vivo phosphorylation of CREB at
Ser133 and ATF1 at Ser63 is
not only catalyzed by MSK1 but also by PKA and can therefore be induced
by agonists that elevate the intracellular concentration of cyclic AMP,
such as forskolin (an activator of adenylate cyclase) and IBMX (an
inhibitor of cyclic AMP phosphodiesterase). Stimulation with forskolin
plus IBMX increased the phosphorylation of CREB and ATF1 in RAW264
macrophages to a level similar to that attained in the response to LPS.
However, the effect was much faster and far more transient (Fig. 7
, A and B). The
forskolin plus IBMX-stimulated phosphorylation of CREB/ATF1 was
unaffected by pretreatment with 5 µM Ro 318220 (Fig. 7
B),
in contrast to the basal and LPS-stimulated phosphorylation of CREB and
ATF1. This is consistent with the finding that MSK1 is inhibited by Ro
318220 in vitro at a 50-fold lower concentration than PKA (Refs.
1 and 3 ; S. Davies, H. Reddy, and P. Cohen,
unpublished experiments).
|
Effect of inhibitors of MAP kinase cascades on the LPS-induced induction of C/EBPß
The transcription factor C/EBPß is known to play a role in the
activation of the COX-2 gene (14), and LPS is reported to
increase the level of this protein and its mRNA in RAW264.7 and J774
macrophages (15). In the present study, we found that the
LPS-induced increase in the level of C/EBPß was unaffected by prior
incubation of the RAW264 cells with PD 98059, SB 203580, PD 98059 plus
SB 203580, or Ro 318220 (Fig. 8
).
|
| Discussion |
|---|
|
|
|---|
Previous work suggested that the transcription factors CREB and ATF1
may be physiological substrates of MSK1 (1) and MSK2
(16) (see Introduction), and the present study
is consistent with this hypothesis. Thus, CREB and ATF1 were
transiently phosphorylated with kinetics similar to the
activation/inactivation of MSK1 and MSK2. Moreover, phosphorylation was
prevented when the macrophages were pretreated with inhibitors of both
the classical MAP kinase cascade and SAPK2/p38, but inhibition of CREB
and ATF-1 phosphorylation was only partial when just one of these
signaling pathways was blocked. Furthermore, the phosphorylation of
CREB was also prevented by Ro 318220 (Fig. 3
B) or H89 (Fig. 6
B) at concentrations that inhibit MSK1 (see
Introduction). MAPKAP-K2, MAPKAP-K3, and PKA also
phosphorylate CREB and ATF1 at Ser133 and
Ser63, respectively (2). However,
these protein kinases cannot be rate limiting for the LPS-induced
activation of CREB and ATF1, because their activities are unaffected in
vivo at the concentrations of Ro 318220 used in these experiments, and
neither are MAPKAP-K2 and MAPKAP-K3 inhibited by H89 ( Ref.
1 ; S. Davies, H. Reddy, and P. Cohen, unpublished
experiments).
Interestingly, the inhibitory effects of SB 203580, PD 98059, Ro
318220, and H89 on the LPS-induced increase in COX-2 mRNA and protein
and IL-1ß mRNA correlated with their ability to suppress the
LPS-induced phosphorylation of CREB/ATF1. Because the genes encoding
COX-2 (5) and IL-1ß (6) both contain a CRE
and the potential importance of the CRE in the transcriptional
regulation of these genes is well documented, these observations raise
the possibility that MSK1 may play an important role in mediating the
increase in COX-2 and IL-1ß mRNA. This might be achieved by the
phosphorylation of CREB/ATF1 and/or other substrates for MSK1 that have
yet to be identified (Fig. 9
). These
substrates might include other transcription factors or proteins that
control the stability of COX-2 mRNA and IL-1ß mRNA. The level of the
mRNA encoding any protein is clearly a steady state that reflects the
relative rates of transcription of the gene and the rate of degradation
of its mRNA. Indeed, LPS has been shown to increase COX-2 mRNA
stability in human monocytes, as well as to stimulate transcription of
the gene. Both effects were inhibited by SB 203580 (17).
An SB 203580-sensitive pathway was also reported to regulate the
stability of COX-2 mRNA in IL-1-stimulated HeLa cells
(18). It will be interesting to examine how all four
inhibitors used in the present study affect LPS-stimulated gene
transcription and LPS-induced mRNA stability.
|
The cyclic AMP-elevating agents forskolin and IBMX triggered a much
faster PKA-dependent phosphorylation of CREB and ATF1 (Fig. 7
A) than that produced by LPS (Fig. 3
A).
Phosphorylation was maximal after 5 min but had declined to basal
levels by 60 min, a time at which LPS-stimulated CREB phosphorylation
was still maximal. This is consistent with the smaller and much more
transient increase in IL-1ß mRNA observed with forskolin plus IBMX
(Fig. 7
B). However, whether PKA increases the level of
IL-1ß mRNA by activating CREB/ATF1 or by phosphorylation of
additional/other protein(s) is unclear. In contrast to IL-1ß mRNA,
forskolin plus IBMX did not induce the COX-2 protein (Fig. 7
D). This indicates that the activation of CREB alone is
insufficient to induce transcription of the COX-2 gene. This is not
surprising because the COX-2 gene contains binding sites for a number
of important transcription factors, including C/EBPß and NF-
B.
Numerous papers have suggested that NF-
B plays a role in the
stimulation of COX-2 gene expression. For example, NF-
B is capable
of activating a COX-2 promoter construct in IL-1ß-stimulated human
pulmonary type II A549 cells (19), and mutation of the
NF-
B response element partially inhibited TNF-
-stimulated
luciferase activity in transfected mouse osteoblastic MC3T3-E1 cells
(20). Moreover, colonic epithelial HT-29 cells infected
with an adenoviral vector containing a dominant negative mutant of
I-
B prevented the TNF-
-induced increase in COX-2 mRNA
(21). However, there is also evidence against a role for
NF-
B in COX-2 induction. For example, the antioxidant ammonium
pyrrolidinedithiocarbamate or the proteinase inhibitor
tosyllysylchloromethyl ketone completely blocked NF-
B activation in
LPS-stimulated J774 macrophages but had little effect on the induction
of COX-2 protein, as judged by immunoblotting, or on the production of
PGE2 (22). Moreover, another
proteinase inhibitor, calpain inhibitor I, blocked the activation of
NF-
B without inhibiting TNF-
-stimulated induction of COX-2 in rat
aortic smooth muscle (23). However, even if NF-
B plays
a role in LPS-stimulated COX-2 gene expression in RAW264 cells, the
four inhibitors used in the present study are most unlikely to exert
their effects by suppressing the activation of NF-
B. Thus, SB 203580
does not inhibit TNF-
-induced NF-
B activation in L929 fibroblasts
(24), and this is also true in RAW264 macrophages (M.
Caivano, N. Chapman, and N. Perkins, unpublished experiments).
Similarly, PD 98059 does not inhibit LPS-stimulated NF-
B activation
in RAW264.7 macrophages (25) or in IL-1ß-stimulated
human mesangial cells (26). We have also found that
neither Ro 318220 (5 µM) nor H89 (25 µM) affect TNF-
-stimulated
activation of NF-
B in human embryonic kidney 293 cells or in
LPS-stimulated RAW264 macrophages (M. Caivano, N. Chapman, and N.
Perkins, unpublished experiments).
The transcription factor C/EBPß is known to play a role in the
activation of the COX-2 gene (14), and LPS was reported to
increase the level of C/EBPß in RAW264.7 and J774 macrophages by
stimulating transcription of the gene (15). We confirmed
that LPS induces a striking rise in the level of C/EBPß, and we also
found that this increase was not prevented by SB 203580 and/or PD 98059
or by Ro 318220 (Fig. 8
). Therefore, the SAPK2/p38 and MAPK/ERK
pathways do not increase the level of COX-2 mRNA by increasing the
amount of C/EBPß protein. In NIH 3T3 cells (27) and
3T3-L1 preadipocytes (28), C/EBPß is reported to be
activated by phosphorylation of a threonine residue catalyzed by
MAPK/ERK and SAPK2/p38, respectively. However, LPS does not appear to
trigger the phosphorylation of C/EBPß in RAW264.7 macrophages
(15), suggesting that the activation of C/EBPß by
phosphorylation does not underlie the LPS-induced increase in COX-2
mRNA either. In any case, the direct phosphorylation of C/EBPß by
MAPK/ERK and/or SAPK2/p38 cannot account for the effects of Ro 318220
or H89 on COX-2 gene transcription, because these MAPK family members
(Ref. 3 ; S. Davies, H. Reddy, and P. Cohen, unpublished
experiments), and the signaling pathways that lead to their activation
(Fig. 2
), are resistant to this drug.
| Acknowledgments |
|---|
B activation. | Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Matilde Caivano, MSI/WTB Complex, Dow Street, University of Dundee, Dundee DD1 5EH, U.K. E-mail address: ![]()
3 Abbreviations used in this paper: MSK, mitogen- and stress-activated protein kinase; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; MAPKAP-K, MAPK-activated protein kinase; SAPK, stress-activated protein kinase; PRAK, p38-regulated activated kinase; IBMX, 3-isobutyl-1-methylxanthine; PKA, cyclic AMP-dependent protein kinase; CRE, cyclic AMP response element; CREB, CRE-binding protein; ATF1, activating transcription factor 1; COX-2, cyclooxygenase-2; ECL, enhanced chemiluminescence; HPRT, hypoxanthine guanine phosphoribosyltransferase. ![]()
Received for publication July 21, 1999. Accepted for publication January 11, 2000.
| References |
|---|
|
|
|---|
mitogen-activated protein kinase (p38
MAPK). J. Biol. Chem. 273:29661.
B in transcriptional control of COX-2 gene expression by IL-1ß. Biochem. Biophys. Res. Commun. 237:28.[Medline]
B and nuclear factor interleukin-6 in tumor necrosis factor
-dependent induction of cyclooxygenase-2 in MC3T3E1 cells. J. Biol. Chem. 270:31315.
B blockade selectively inhibits tumour necrosis factor-
-induced COX-2 but not constitutive COX-1 gene expression in HT-29 cells. Immunology 95:537.[Medline]
B in the regulation of cyclooxygenase-2 protein expression in LPS- stimulated J774 macrophages. FEBS Lett. 418:175.[Medline]
B activation. Life Sci. 64:1231.[Medline]
This article has been cited by other articles:
![]() |
W.-Y. Wang, J. Li, D. Yang, W. Xu, R.-p. Zha, and Y.-p. Wang OxLDL stimulates lipoprotein-associated phospholipase A2 expression in THP-1 monocytes via PI3K and p38 MAPK pathways Cardiovasc Res, December 1, 2009; (2009) cvp367v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Choi, Y.-S. Chung, H. J. Kim, U. Y. Moon, Y. H. Choi, I. Van Seuningen, S. J. Baek, H.-G. Yoon, and J.-H. Yoon Signal Pathway of 17{beta}-Estradiol-Induced MUC5B Expression in Human Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., February 1, 2009; 40(2): 168 - 178. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Gavala, Z. A. Pfeiffer, and P. J. Bertics The nucleotide receptor P2RX7 mediates ATP-induced CREB activation in human and murine monocytic cells J. Leukoc. Biol., October 1, 2008; 84(4): 1159 - 1171. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Han, B. Chen, and T. J. Smith Jak2 Dampens the Induction by IL-1beta of Prostaglandin Endoperoxide H Synthase 2 Expression in Human Orbital Fibroblasts: Evidence for Divergent Influence on the Prostaglandin E2 Biosynthetic Pathway J. Immunol., November 15, 2007; 179(10): 7147 - 7156. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Steer, J. M. Moran, B. S. Christmann, L. B. Maggi Jr, and J. A. Corbett Role of MAPK in the Regulation of Double-Stranded RNA- and Encephalomyocarditis Virus-Induced Cyclooxygenase-2 Expression by Macrophages. J. Immunol., September 1, 2006; 177(5): 3413 - 3420. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Brook, C. R. Tchen, T. Santalucia, J. McIlrath, J. S. C. Arthur, J. Saklatvala, and A. R. Clark Posttranslational Regulation of Tristetraprolin Subcellular Localization and Protein Stability by p38 Mitogen-Activated Protein Kinase and Extracellular Signal-Regulated Kinase Pathways. Mol. Cell. Biol., March 1, 2006; 26(6): 2408 - 2418. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Han, N. K. Lee, K. H. Kim, I. W. Jang, M. Yim, J. H. Kim, W. J. Lee, and S. Y. Lee Transcriptional induction of cyclooxygenase-2 in osteoclast precursors is involved in RANKL-induced osteoclastogenesis Blood, August 15, 2005; 106(4): 1240 - 1245. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Wang, J. T. Tseng, and W.-C. Chang Induction of Human NF-IL6{beta} by Epidermal Growth Factor Is Mediated through the p38 Signaling Pathway and cAMP Response Element-binding Protein Activation in A431 Cells Mol. Biol. Cell, July 1, 2005; 16(7): 3365 - 3376. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kim, S. H. Rhee, E. Kokkotou, X. Na, T. Savidge, M. P. Moyer, C. Pothoulakis, and J. T. LaMont Clostridium difficile Toxin A Regulates Inducible Cyclooxygenase-2 and Prostaglandin E2 Synthesis in Colonocytes via Reactive Oxygen Species and Activation of p38 MAPK J. Biol. Chem., June 3, 2005; 280(22): 21237 - 21245. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Aki, R. Mashima, K. Saeki, Y. Minoda, M. Yamauchi, and A. Yoshimura Modulation of TLR signalling by the C-terminal Src kinase (Csk) in macrophages Genes Cells, April 1, 2005; 10(4): 357 - 368. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Pathak, A. Bhattacharyya, S. Pathak, C. Basak, D. Mandal, M. Kundu, and J. Basu Toll-like Receptor 2 and Mitogen- and Stress-activated Kinase 1 Are Effectors of Mycobacterium avium-induced Cyclooxygenase-2 Expression in Macrophages J. Biol. Chem., December 31, 2004; 279(53): 55127 - 55136. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. G. Shepherd, Q. Zhao, S. E. Welty, T. N. Hansen, C. V. Smith, and Y. Liu The Function of Mitogen-activated Protein Kinase Phosphatase-1 in Peptidoglycan-stimulated Macrophages J. Biol. Chem., December 24, 2004; 279(52): 54023 - 54031. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Beinke, M. J. Robinson, M. Hugunin, and S. C. Ley Lipopolysaccharide Activation of the TPL-2/MEK/Extracellular Signal-Regulated Kinase Mitogen-Activated Protein Kinase Cascade Is Regulated by I{kappa}B Kinase-Induced Proteolysis of NF-{kappa}B1 p105 Mol. Cell. Biol., November 1, 2004; 24(21): 9658 - 9667. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wu, G. A. Zimmerman, S. M. Prescott, and D. M. Stafforini The p38 MAPK Pathway Mediates Transcriptional Activation of the Plasma Platelet-activating Factor Acetylhydrolase Gene in Macrophages Stimulated with Lipopolysaccharide J. Biol. Chem., August 20, 2004; 279(34): 36158 - 36165. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. KUWANO, S. NAKAO, H. YAMAMOTO, M. TSUNEYOSHI, T. YAMAMOTO, M. KUWANO, and M. ONO Cyclooxygenase 2 is a key enzyme for inflammatory cytokine-induced angiogenesis FASEB J, February 1, 2004; 18(2): 300 - 310. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Caivano, C. Rodriguez, P. Cohen, and S. Alemany 15-Deoxy-{Delta}12,14-prostaglandin J2 Regulates Endogenous Cot MAPK Kinase Kinase 1 Activity Induced by Lipopolysaccharide J. Biol. Chem., December 26, 2003; 278(52): 52124 - 52130. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Davie MSK1 and MSK2 Mediate Mitogen- and Stress-Induced Phosphorylation of Histone H3: A Controversy Resolved Sci. Signal., August 12, 2003; 2003(195): pe33 - pe33. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Song, W.-J. Lee, K. C. Chung, J. S. Koo, E. J. Yang, J. Y. Choi, and J.-H. Yoon Interleukin-1{beta} and Tumor Necrosis Factor-{alpha} Induce MUC5AC Overexpression through a Mechanism Involving ERK/p38 Mitogen-activated Protein Kinases-MSK1-CREB Activation in Human Airway Epithelial Cells J. Biol. Chem., June 20, 2003; 278(26): 23243 - 23250. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wu, M. Marko, K. Claycombe, K. E. Paulson, and S. N. Meydani Ceramide-induced and Age-associated Increase in Macrophage COX-2 Expression Is Mediated through Up-regulation of NF-kappa B Activity J. Biol. Chem., March 21, 2003; 278(13): 10983 - 10992. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bousserouel, A. Brouillet, G. Bereziat, M. Raymondjean, and M. Andreani Different effects of n-6 and n-3 polyunsaturated fatty acids on the activation of rat smooth muscle cells by interleukin-1{beta} J. Lipid Res., March 1, 2003; 44(3): 601 - 611. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. H. Cho, C. H. Lee, and S. G. Kim Potentiation of Lipopolysaccharide-Inducible Cyclooxygenase 2 Expression by C2-Ceramide via c-Jun N-Terminal Kinase-Mediated Activation of CCAAT/Enhancer Binding Protein beta in Macrophages Mol. Pharmacol., March 1, 2003; 63(3): 512 - 523. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Roach and J. S. Schorey Differential Regulation of the Mitogen-Activated Protein Kinases by Pathogenic and Nonpathogenic Mycobacteria Infect. Immun., June 1, 2002; 70(6): 3040 - 3052. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Wiggin, A. Soloaga, J. M. Foster, V. Murray-Tait, P. Cohen, and J. S. C. Arthur MSK1 and MSK2 Are Required for the Mitogen- and Stress-Induced Phosphorylation of CREB and ATF1 in Fibroblasts Mol. Cell. Biol., April 15, 2002; 22(8): 2871 - 2881. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.J. Webb, J.R. McPherson, K. Pahan, and S. Koka Regulation of TNF-{alpha}-induced IL-6 Production in MG-63 Human Osteoblast-like Cells Journal of Dental Research, January 1, 2002; 81(1): 17 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. de Magalhaes, A. A. Andrade, P. N. G. Silva, L. P. Sousa, C. Ropert, P. C. P. Ferreira, E. G. Kroon, R. T. Gazzinelli, and C. A. Bonjardim A Mitogenic Signal Triggered at an Early Stage of Vaccinia Virus Infection. IMPLICATION OF MEK/ERK AND PROTEIN KINASE A IN VIRUS MULTIPLICATION J. Biol. Chem., October 12, 2001; 276(42): 38353 - 38360. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shimomura, M. Matsuura, S. Saito, Y. Hirai, Y. Isshiki, and K. Kawahara Lipopolysaccharide of Burkholderia cepacia and Its Unique Character To Stimulate Murine Macrophages with Relative Lack of Interleukin-1{beta}-Inducing Ability Infect. Immun., June 1, 2001; 69(6): 3663 - 3669. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ikegami, Y. Sugimoto, E. Segi, M. Katsuyama, H. Karahashi, F. Amano, T. Maruyama, H. Yamane, S. Tsuchiya, and A. Ichikawa The Expression of Prostaglandin E Receptors EP2 and EP4 and Their Different Regulation by Lipopolysaccharide in C3H/HeN Peritoneal Macrophages J. Immunol., April 1, 2001; 166(7): 4689 - 4696. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Sapkota, A. Kieloch, J. M. Lizcano, S. Lain, J. S. C. Arthur, M. R. Williams, N. Morrice, M. Deak, and D. R. Alessi Phosphorylation of the Protein Kinase Mutated in Peutz-Jeghers Cancer Syndrome, LKB1/STK11, at Ser431 by p90RSK and cAMP-dependent Protein Kinase, but Not Its Farnesylation at Cys433, Is Essential for LKB1 to Suppress Cell Growth J. Biol. Chem., May 25, 2001; 276(22): 19469 - 19482. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Caivano, B. Gorgoni, P. Cohen, and V. Poli The Induction of Cyclooxygenase-2 mRNA in Macrophages Is Biphasic and Requires both CCAAT Enhancer-binding protein beta (C/EBPbeta ) and C/EBPdelta Transcription Factors J. Biol. Chem., December 21, 2001; 276(52): 48693 - 48701. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. R. Sunil, A. J. Connor, Y. Guo, J. D. Laskin, and D. L. Laskin Activation of type II alveolar epithelial cells during acute endotoxemia Am J Physiol Lung Cell Mol Physiol, April 1, 2002; 282(4): L872 - L880. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |