The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, S.
Right arrow Articles by Lee, M.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, S.
Right arrow Articles by Lee, M.-S.
The Journal of Immunology, 2000, 164: 2931-2936.
Copyright © 2000 by The American Association of Immunologists

Inhibition of Autoimmune Diabetes by Fas Ligand: The Paradox Is Solved1

Sunshin Kim2,*, Kyoung-Ah Kim2,*, Dae-Youn Hwang*, Tae H. Lee{dagger}, Nobuhiko Kayagaki{ddagger}, Hideo Yagita{ddagger} and Myung-Shik Lee3,*

* Department of Medicine, Samsung Medical Center, Sungkyunkwan University Medical School, Seoul, Korea; {dagger} Department of Biology, Yonsei University College of Science, Seoul, Korea; and {ddagger} Department of Immunology, Juntendo University School of Medicine, Tokyo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous reports that diabetogenic lymphocytes did not induce diabetes in nonobese diabetic (NOD)-lpr mice suggested the critical role of Fas-Fas ligand (FasL) interaction in pancreatic ß cell apoptosis. However, recent works demonstrated that FasL is not an effector molecule in islet ß cell death. We addressed why diabetes cannot be transferred to NOD-lpr mice despite the nonessential role of Fas in ß cell apoptosis. Lymphocytes from NOD-lpr mice were constitutively expressing FasL. A decrease in the number of FasL+ lymphocytes by neonatal thymectomy facilitated the development of insulitis. Cotransfer of FasL+ lymphocytes from NOD-lpr mice completely abrogated diabetes after adoptive transfer of lymphocytes from diabetic NOD mice. The inhibition of diabetes by cotransferred lymphocytes was reversed by anti-FasL Ab, indicating that FasL on abnormal lymphocytes from NOD-lpr mice was responsible for the inhibition of diabetes transfer. Pretreatment of lymphocytes with soluble FasL (sFasL) also inhibited diabetes transfer. sFasL treatment decreased the number of CD4+CD45RBlow cells and increased the number of propidium iodide-stained cells among CD4+CD45RBlow cells, suggesting that sFasL induces apoptosis on CD4+CD45RBlow "memory" cells. These results resolve the paradox between previous findings and suggest a new role for FasL in the treatment of autoimmune disorders. Our data also suggest that sFasL is involved in the deletion of potentially hazardous peripheral "memory" cells, contrary to previous reports that Fas on unmanipulated peripheral lymphocytes is nonfunctional.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous reports that lymphocytes from nonobese diabetic (NOD)4 mice were unable to induce diabetes in Fas-deficient NOD-lpr/lpr mice were regarded as evidence indicating the necessity of Fas-Fas ligand (FasL) interaction in ß cell apoptosis and diabetes of NOD mice (1, 2). Additional in vitro or in vivo data supporting the role of Fas in autoimmune diabetes have been reported (3, 4). However, recent papers suggested that FasL is not an effector molecule in ß cell death and autoimmune diabetes (5, 6, 7). To resolve this paradox on the role of Fas-mediated apoptosis in autoimmune diabetes, we conducted the current investigation based on the hypothesis that resistance to diabetes transfer in NOD-lpr/lpr mice is due to abnormal (double-negative) lymphocytes in NOD-lpr/lpr mice (8). Through the course of this investigation, we unexpectedly found that FasL could be a therapeutic agent for autoimmune disorders and soluble FasL (sFasL) induces apoptosis on "memory" cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fas-deficient NOD-lpr mice

NOD mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and were maintained in a specific pathogen-free environment in the vivarium of Samsung Medical Center. The incidence of diabetes in female and male NOD mice was about 70% and 30%, respectively, at 24 wk of age. NOD mice were bred with MRL-lpr/lpr mice and F1 mice were backcrossed to NOD mice. N2 (backcross 1, BC1) mice heterozygous for Fas with an early transposable element (ETn) were selected by Southern blot or PCR typing of tail DNA and then backcrossed repeatedly to NOD mice to derive NOD-lpr/wild (lpr/w) BC8 mice. They were intercrossed to derive NOD-lpr/lpr as an experimental group and NOD-lpr/w mice as a control group. Heterozygous and homozygous mice were typed again by using Southern blot analysis or PCR amplification of tail DNA. For Southern blot analysis, 10 µg of tail DNA was digested with EcoRI and run on 0.6% agarose gel. After capillary transfer for 18 h, the membrane was denatured with 0.4 N NaOH followed by neutralization in 0.2 M Tris (pH 7.5), 2x SSC, 0.1% SDS. After UV cross-linking and prehybridization at 65°C, the membranes were hybridized for 18 h with a EcoRI-HindIII fragment of murine Fas cDNA labeled with [32P]dCTP (Amersham, Buckinghamshire, U.K.). After washing with 2x SSC, 2x SSC, 0.1% SDS and then with 0.1x SSC, 0.1% SDS, the membranes were exposed to x-ray films. A 13-kb band indicated the presence of the normal Fas allele, and a 11-kb band indicated that of a mutated Fas allele because of a new EcoRI restriction site in the inserted ETn sequence (9) (data not shown). PCR was conducted using a primer set to select heterozygotes for the mutated Fas allele (forward, CAGCAGGAATCCTATGAGCT; reverse, CTCGCAACGTGAACGGTTCG). Another primer set was used to distinguish heterozygotes and homozygotes for the mutated Fas (forward, CAGCAGGAATCCTATGAGCT; reverse, GCAGAGATGCTAAGCAGCAG) (2). MHC haplotype of the BC mice was determined by PCR amplification of tail DNA using a primer set specific for I-E{alpha} (forward, ATGAGCTCCCAGAAGTCATGGG; reverse, GGAGAGACAGCAGCTCTCAGC) (10) to confirm homozygosity for H-2g7. A one-way MLC was employed to verify genetic homogeneity between NOD mice and NOD-lpr/lpr (-lpr/w) mice. All animal studies were approved by the Institutional Review Board of Samsung Medical Center.

Adoptive transfer

Adoptive transfer of diabetes was conducted according to a previous report (11). In brief, 2 x 107 splenocytes from diabetic female or male NOD mice were infused into the tail vein of each 8- to 10-wk-old NOD or NOD-lpr/lpr (-lpr/w) mouse of the same sex. Recipient mice were sublethally irradiated (750 rad) using a Cesium irradiator (IBL 437, CIS Biointernational, Gif-sur-Yvette, France) 16 h before the transfer of splenocytes. The incidence of diabetes was above 90% at 4 wk after adoptive transfer to NOD mice in our previous experiments. For cotransfer experiments, 2 x 107 splenocytes from 4- to 5-mo-old NOD-lpr/lpr mice and the same number of splenocytes from diabetic NOD mice of the same sex were transferred together to the irradiated recipient NOD mice of the same sex. Splenocytes from 4- to 5-mo-old NOD-lpr/w littermate mice were cotransferred in control experiments.

RNase protection assay

RNA from lymphocytes was hybridized with a 32P-labeled riboprobe prepared by in vitro transcription of a linearized expression vector harboring FasL cDNA. The intensity of the protected band after hybridization was standardized against that of the mouse ß-actin band.

Neonatal thymectomy of NOD-lpr/lpr mice

Neonatal thymectomy of NOD-lpr/lpr mice was performed as described previously (12). In brief, the thymus was removed by a wire loop through a small longitudinal incision over the sternum before 1.5 days after birth. The absence of the thymus was confirmed by flow cytometric analyses using PE-labeled anti-CD3{epsilon} (PharMingen, La Jolla, CA) to determine the frequency of CD3{epsilon}+ cells in heparinized peripheral blood at 7–8 wk of age and also by inspecting the thymus at the time of sacrifice. The mice with CD3{epsilon}+ cell percentage above twice that of nude mice were excluded from the study. Donor lymphocytes were transferred to 8- to 10-wk-old neonatal thymectomized NOD-lpr/lpr of the same sex after sublethal irradiation.

Insulitis scoring

To determine the severity of insulitis, >30 pancreatic islets from three or more parallel sections of different cut levels were analyzed per mouse. The degree of insulitis was classified into four categories: 0, no insulitis; 1, periinsulitis with or without minimal lymphocytic infiltration in islets; 2, invasive insulitis with islet destruction <=50%; 3, islet destruction >50%.

Anti-FasL Ab treatment

A hybridoma producing K10 anti-FasL Ab (13) was injected i.p. into nude mice pretreated with Pristane (Sigma, St. Louis, MO). Ab was purified using a protein A-Sepharose (Pharmacia, Uppsala, Sweden) column. Bound IgG was eluted with 50 mM glycine-HCl, pH 2.5. The collected fraction was dialyzed against PBS and then filter-sterilized. Ab (1 mg) was injected i.p. three times a week into NOD mice before and after cotransfer. Control NOD mice were treated with the same dose of mouse IgG (Sigma) during the cotransfer experiments. Validity of the anti-FasL Ab preparation was confirmed by an almost complete abrogation of hepatitis after injection of 15 mg/kg Con A (Sigma) to C57BL6 and NOD mice (data not shown).

Ex vivo treatment with sFasL

sFasL was produced according to a previous report (14) with modifications. In brief, CD5 signal sequence was attached to Pro137 of human FasL. Chinese hamster ovary (CHO) K1 cells were stably transfected with the construct. Selected clones were cultured in a serum-free medium (CHO-S-SFM II; Life Technologies, Gaithersburg, MD). sFasL (10% culture supernatant) killed >50% of Jurkat cells and A20.2J murine B lymphoma cells (15) after treatment for 16 h (data not shown), consistent with previous reports that human FasL is effective against murine Fas (14, 16). Splenocytes from diabetic NOD mice were incubated with 10% sFasL culture supernatant for 16 h. After washing three times, they were transferred to the irradiated NOD recipient mice. CHO K1 culture supernatant (10%) without transfection was used as a control reagent.

Apoptosis staining

Cells were stained with 2.5 µg/ml Hoechst 33258 (Calbiochem, Cambridge, MA) after fixation in 4% paraformaldehyde.

Flow cytometry

A total of 1–3 x 106 lymphocytes were incubated with 10 µg/ml biotinylated anti-CD45RB Ab (PharMingen). They were then incubated with FITC-streptavidin (Vector, Burlingame, CA) and PE-anti-CD4 Ab (PharMingen) with or without 2.5 µg/ml propidium iodide (PI). Cells were gated by forward and side scatters, and further gated on CD4. CD45RBlow cells were defined as the dullest staining 20% of the untreated CD4+ cells (17). To count PI-stained cells, cells were gated on CD4 and CD45RB. For triple-colored analyses, Cy-Chrome-streptavidin (PharMingen), PE-anti-CD4 Ab, and FITC-anti-Fas Ab (PharMingen) were used for the second incubation. To examine the fraction of double-negative (CD4-CD8-) B220+ cells in NOD-lpr/lpr cells, splenocytes were first incubated with anti-B220 Ab (PharMingen). Then, they were incubated with FITC-anti-rat IgG. After blocking any free binding site by adding purified rat Ig (Phar-Mingen), cells were incubated with PE-anti-CD4 Ab and PE-anti-CD8 Ab (PharMingen).

Statistical analyses

The incidence of diabetes was plotted according to Kaplan-Meier method. The incidences were compared between the two groups using the log-rank test. Student’s t test was employed to compare mean values between the two groups. Values of p < 0.05 were regarded as statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NOD-lpr/lpr mice

NOD-lpr/lpr mice older than 3 mo had classical phenotypes of lpr mice such as generalized lymphadenopathy, splenomegaly, thymomegaly, nephritis, and increased CD4-CD8-B220+ cell fraction (>60%), while littermate NOD-lpr/w mice did not have such phenotypes (12). None of Fas-deficient female NOD-lpr/lpr mice (0/12) developed diabetes or insulitis up to 8 mo of age, while 60% (6/10) of control female NOD-lpr/w littermates had diabetes before 24 wk of age (Fig. 1GoA), consistent with previous reports (1, 2).



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 1. A, Incidence of spontaneous diabetes in NOD-lpr/lpr mice. B, Incidence of diabetes in NOD-lpr/lpr mice after adoptive transfer. NOD-lpr/lpr mice did not develop diabetes and were resistant to diabetes transfer.

 
Adoptive transfer to NOD-lpr/lpr mice

Because the absence of diabetes and insulitis in NOD-lpr/lpr mice could have been due to an accumulation of unusual (double-negative) cells and distortion of lymphocyte development (8, 18), we transferred lymphocytes from diabetic NOD mice to 8- to 10-wk-old irradiated NOD-lpr/lpr mice. NOD-lpr/lpr mice were resistant to diabetes transfer, confirming previous results (1, 2). None of the 12 NOD-lpr/lpr mice developed diabetes in 8 wk after adoptive transfer, while 73% (8/11) of the control NOD-lpr/w littermates developed diabetes during the same observation period, in three independent experiments showing similar results (Fig. 1GoB). Pancreatic islets of NOD-lpr/lpr mice were either completely free of insulitis or showed mild periinsulitis after adoptive transfer, while NOD-lpr/w mice had florid insulitis and/or paucity of pancreatic islets because of extensive destruction after adoptive transfer (data not shown).

Inhibition of diabetes transfer by FasL constitutively expressed on lpr lymphocytes

Because these results apparently contradicted recent reports that anti-FasL Ab treatment did not inhibit diabetes in NOD mice and Fas-deficient neonatal pancreas was destroyed by autoreactive lymphocytes in diabetic NOD mice (5, 6), we studied if abnormal (double-negative) lymphocytes in NOD-lpr/lpr mice were interfering with the adoptive transfer experiments (Fig. 1GoB). We investigated whether abnormal lymphocytes from NOD-lpr/lpr mice were expressing FasL like lpr mice of different backgrounds (19, 20). RNase protection assays showed that lymphocytes from 4-mo-old NOD-lpr/lpr mice were constitutively expressing high level of FasL mRNA (Fig. 2GoA). Because such FasL-expressing cells might affect the outcome of adoptive transfer by inducing apoptosis on transferred lymphocytes, neonatal thymectomy of NOD-lpr/lpr mice was performed to eliminate or reduce the effects of such abnormal lymphoid cells. Neonatal thymectomized NOD-lpr/lpr mice still did not develop diabetes after adoptive transfer (n = 6). However, histological analysis revealed insulitis after adoptive transfer that was not observed in unmanipulated NOD-lpr/lpr mice consistently in four independent experiments, suggesting that Fas-FasL interaction is not necessary at least for insulitis. The average insulitis score was 0.74 ± 0.39 at 6–8 wk after adoptive transfer (mean ± SD, n = 6), which was significantly higher than that after adoptive transfer to unmanipulated NOD-lpr/lpr mice (0.02 ± 0.02, n = 6) (p < 0.01) (Fig. 2GoB). In the recipient NOD-lpr/lpr mice with previous neonatal thymectomy, exocrine pancreatitis or cellular depletion of the splenic white pulp was not observed, despite the clear evidence of insulitis, suggesting that the insulitis was a specific phenomenon and not a manifestation of generalized inflammatory responses such as graft-vs-host diseases (GVHD).



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 2. A, Expression of FasL in lymphocytes from NOD-lpr/lpr mice. Lymphocytes from NOD-lpr/lpr mice were constitutively expressing huge amounts of FasL transcript detected by RNase protection assays. Arrows indicate the size of the protected bands, which were shorter than that of the respective probes. B, Development of insulitis in neonatal thymectomized NOD-lpr/lpr mice after adoptive transfer ({square}, no insulitis; , periinsulitis; , insulitis with islet destruction <= 50%; {blacksquare}, islet destruction > 50%). The mean insulitis score in the neonatal thymectomized recipients was significantly higher than that in unmanipulated mice.

 
To further prove that abnormal lymphoid cells in NOD-lpr/lpr mice inhibit transfer of autoimmune diabetes, lymphocytes from NOD-lpr/lpr mice were cotransferred to irradiated NOD mice together with splenocytes from diabetic NOD mice. Strikingly, none of the recipient NOD mice (n = 9) became diabetic in 8 wk after cotransfer, in three independent experiments showing similar results. In contrast, six of eight NOD mice (75%) became diabetic after cotransfer of lymphocytes from NOD-lpr/w mice in control experiments (Fig. 3GoA). Furthermore, administration of anti-FasL K10 Ab (13) (1 mg/injection, three times a week) reversed the inhibition of diabetes by cotransferred lymphocytes from NOD-lpr/lpr mice, indicating that abnormal FasL+ lymphocytes from NOD-lpr/lpr cells are responsible for the inhibition of diabetes transfer and sFasL is not an effector molecule in ß cell apoptosis (Fig. 3GoA). Control Ab did not affect the abrogation of diabetes transfer by lymphocytes from NOD-lpr/lpr mice. Recipient NOD mice of NOD-lpr/lpr lymphocytes showed signs of GVHD such as lymphoid infiltration around the portal triad of the liver and cellular depletion of splenic white pulp (data not shown), which has been described in lymphocyte transfer from lpr mice to wild-type congenic mice (21). As expected, these signs of GVHD were almost completely abrogated by anti-FasL K10 Ab treatment, which is consistent with previous reports that FasL constitutively expressed on abnormal double-negative lymphocytes in lpr mice is responsible for GVHD-like syndrome (19, 20). Recipient mice of NOD-lpr/w lymphocytes did not show signs of GVHD as expected, further indicating genetic homogeneity between NOD mice and NOD-lpr/lpr (lpr/w) mice.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 3. A, Inhibition of diabetes transfer by FasL+ lymphocytes (Fig. 2GoA) from NOD-lpr/lpr mice. FasL+ lymphocytes completely abrogated diabetes after adoptive transfer of lymphocytes from diabetic NOD mice ({blacktriangledown}). The inhibition was reversed by anti-FasL Ab treatment, indicating that FasL on lymphocytes from NOD-lpr/lpr mice was responsible for the inhibition of diabetes transfer (•). Control Ab did not affect the abrogation of diabetes transfer by FasL+ lymphocytes ({circ}). B, Inhibition of diabetes transfer by sFasL pretreatment. Pretreatment of lymphocytes from diabetic NOD mice with sFasL significantly decreased the incidence of diabetes after adoptive transfer.

 
Inhibition of diabetes transfer by ex vivo treatment with sFasL

Although these results suggested the possibility of FasL or FasL-expressing cells as a therapeutic agent for autoimmune diabetes, they cannot be directly employed because of the adverse effects of systemic FasL such as GVHD or hepatitis as observed in this study or other reports (22, 23). To exploit the effect of FasL on autoreactive lymphocytes without adverse effects of systemic FasL, we investigated if ex vivo pretreatment of splenocytes from diabetic NOD mice with sFasL has similar inhibitory effects on diabetes transfer. Pretreatment of splenocytes with sFasL for 16 h decreased the incidence of diabetes after adoptive transfer from 75% (6/8, pretreated with control CHO K1 cell supernatant) to 22% (2/9) (p < 0.01) (Fig. 3GoB), strongly indicating that sFasL could be a therapeutic or preventive agent against autoimmune diabetes. As expected, recipient mice of the lymphocytes treated ex vivo with sFasL did not show signs of GVHD (data not shown).

sFasL kills "memory" cells among peripheral lymphocytes

Because these results suggested that sFasL functionally affects peripheral lymphocytes in contrast to previous reports that agonistic anti-Fas Ab did not induce apoptosis on unmanipulated murine or human peripheral lymphocytes (24, 25, 26, 27), we next studied what kind of effect the sFasL treatment exerts on splenocytes from NOD mice. Staining with Hoechst 33258 showed no significant increase in the number of apoptotic cells after incubation with sFasL, compared with incubation with control CHO K1 supernatant (data not shown). We thought that sFasL might induce apoptosis on a small subset of splenocytes. Because previous reports showed that CD45RO+RBlow "memory" cells among CD4+ T cells expressed high level of Fas (25, 28), we examined the change in percentage of such cells after treatment with sFasL. Treatment of lymphocytes from diabetic (n = 3) or nondiabetic NOD mice (n = 4) with sFasL for 16 h decreased the portion of CD45RBlow cells among CD4+ T cells from 16.4 ± 2.7% (treated with control CHO K1 supernatant) to 10.2 ± 3.0% (mean ± SD, n = 7, p < 0.01) (Fig. 4GoA). The same treatment also increased the portion of PI-stained dead cells among CD4+CD45RBlow cells from 12.7 ± 5.5% (treated with CHO K1 supernatant) to 32.2 ± 12.1% (mean ± SD, n = 7, p < 0.01) (Fig. 4GoB). CD45RBlowCD4+ T lymphocytes from diabetic and nondiabetic NOD mice were equally susceptible to treatment with sFasL (data not shown). Those from diabetes-resistant mouse strains such as C57BL/6 or ICR were also susceptible to the sFasL treatment (data not shown). Triple-colored flow cytometry showed that the decrease in the number of CD4+CD45RBlow cells after sFasL treatment was due to the death (and decrease) of Fas+CD45RBlo cells as expected (7.3 ± 3.2% among CD4+ cells after treatment with control CHO K1 supernatant vs 3.6 ± 1.9% after treatment with sFasL; n = 8, p < 0.05) (Fig. 4Go, C and D). The portion of Fas+CD45RBhigh cells among CD4+ cells was not significantly decreased by sFasL treatment (19.0 ± 11.3% among CD4+ cells after treatment with control CHO K1 supernatant vs 14.8 ± 7.9% after treatment with sFasL; n = 8, p > 0.1). Treatment with 1 µg/ml agonistic anti-Fas Ab (Jo2) and 30 µg/ml cycloheximide also significantly decreased the fraction of CD45RBlow cells among CD4+ cells from 23.8 ± 2.2% (treated with cycloheximide alone) to 13.4 ± 4.1% (n = 5, p < 0.01) (Fig. 4GoE).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 4. Cytotoxicity of sFasL on CD4+CD45RBlow "memory" cells. A, The percentage of CD45RBlow cells among CD4+ cells was significantly decreased by overnight incubation with sFasL. B, The percentage of PI+ cells among CD4+CD45RBlow cells was increased by sFasL treatment. C and D, As expected, sFasL treatment decreased the percentage of Fas+ cells among CD4+CD45RBlow cells. The numbers in the figures are mean values from all tested mice and those in parentheses are from a single mouse illustrated. E, Agonistic anti-Fas Ab (Jo2) also decreased the percentage of CD45RBlow cells among CD4+ cells in the presence of cycloheximide (CHX). All figures (A–E) are from separate individual mice showing similar tendency and are representative of all data collected.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We unequivocally demonstrated that FasL is not an effector molecule in ß islet cell death. The inability to transfer diabetes to NOD-lpr/lpr was due to abnormal FasL+ lymphoid cells in NOD-lpr/lpr mice that could exert apoptosis on adoptive transferred lymphocytes and inhibit the development of diabetes. Because we hypothesized that abnormal FasL+ cells affect diabetes transfer, we used 4- to 5-mo-old NOD-lpr/lpr mice for cotransfer experiments or RNase protection assays to ensure sufficient FasL expression on abnormal (double-negative) lymphocytes. In other experiments such as adoptive transfer to NOD-lpr/lpr mice (Fig. 1GoB) or neonatal thymectomized NOD-lpr/lpr mice (Fig. 2GoB), 8- to 10-wk-old NOD-lpr/lpr mice were used to minimize artifactual effects arising from lymphoproliferation characteristic of lpr mice. Although we did not elucidate which cells were expressing FasL and could not exclude the effects of cells other than double-negative cells, FasL seems to be responsible for the inhibition of diabetes transfer regardless of the cell type(s) expressing it. A decrease in the number of such cells by neonatal thymectomy facilitated the development of insulitis, consistent with our hypothesis. Failure to transfer diabetes to neonatal thymectomized NOD-lpr/lpr mice could be due to the residual {alpha}ß+, {gamma}{delta}+ T cells, NK cells, or B cells expressing FasL. Furthermore, cotransfer of abnormal FasL+ cells from NOD-lpr/lpr mice completely inhibited diabetes transfer probably by exerting apoptosis on autoreactive lymphocytes, which is consistent with a previous report showing a shortened life span of transferred lymphocytes in NOD-lpr/lpr mice (5). GVHD observed in the recipient mice of the cotransfer was due to abnormal FasL on lymphocytes from NOD-lpr/lpr mice, consistent with the critical role of FasL as an effector molecule in GVHD (29). GVHD was not due to incomplete backcrossing in the production of NOD-lpr/lpr mice because no significant proliferative response was observed in MLC between NOD lymphocytes and NOD-lpr/lpr (or -lpr/w) lymphocytes (data not shown) and no such GVHD was observed in control recipient NOD mice to which lymphocytes from NOD-lpr/w mice were infused. Finally, diabetes was restored by anti-FasL Ab treatment in recipient mice into which FasL+ lymphocytes from NOD-lpr/lpr mice and lymphocytes from diabetic NOD mice were cotransferred. This result ultimately proves that FasL is not an effector molecule in ß cell death and lymphocytes from NOD-lpr/lpr mice induce apoptosis on cotransferred lymphocytes through Fas-FasL interaction. FasL might be an effector molecule only for a small number of CD8+ T lymphocytes that initially infiltrate pancreatic islets (4) but definitely not for the majority of diabetogenic lymphocytes because diabetes was actually provoked by blocking Fas-FasL interaction.

A significant decrease in the incidence of diabetes after ex vivo treatment of lymphocytes with sFasL suggests the possibility of a new treatment modality without the adverse effects of systemic FasL. A <100% inhibition of diabetes by sFasL pretreatment of splenocytes could be due to a weaker activity of sFasL compared with membrane FasL that can reportedly kill even naive lymphocytes (30). In an effort to investigate the effect of sFasL on peripheral lymphocytes that was evident in our ex vivo treatment model, we observed that "memory" T lymphocytes were selectively killed by sFasL. These results are in contrast to previous reports that agonistic anti-Fas Ab did not exert apoptosis on unmanipulated peripheral lymphocytes and Fas on peripheral lymphocytes is nonfunctional (24, 25, 26). sFasL produced by Suda et al. exerted cytotoxicity on peripheral lymphocytes including naive T cells; however, their sFasL was an artificially processed multimer acting like membrane FasL (27, 30). The previous inability to detect apoptotic peripheral lymphocyte fraction after anti-Fas Ab treatment seems to be due to a low frequency of apoptotic CD4+CDRBlow cells that escaped detection while using unfractionated total peripheral lymphocytes. The apoptotic population observed in our study would include autoreactive diabetogenic lymphocytes whose ablation leads to the abrogation of diabetes. Our observations are consistent with a successful transfer of diabetes by CD45RBlowCD4+ cells but not by CD45RBhighCD4+ cells (31). Recent papers suggested that memory cells could be divided into CD45RBlow and CD45RBhigh subsets. According to them, only the former cells (mostly Fas+) are able to respond rapidly and short-lived, representing "preactivated" lymphocytes, while the latter "memory revertants" (mostly Fas-) are quiescent and long-lived, persisting without Ag (32, 33). Their theory may explain why memory cells express Fas and are vulnerable to Fas-mediated apoptosis, contrary to the general notion that memory cells should live long. Our ex vivo treatment with sFasL seems to kill potentially dangerous "preactivated" cells with Fas up-regulation and may not affect "true" CD45RBhigh "memory" T cells without Fas up-regulation.

We conclude that FasL is not an effector molecule in autoimmune ß cell destruction and NOD-lpr/lpr mice are resistant to diabetes transfer because FasL constitutively expressed on their abnormal lymphocytes exerts cytotoxicity on diabetogenic lymphocytes, resolving the contradiction between previous papers. We also demonstrated that "memory" T cells are susceptible to sFasL or anti-Fas Ab. Physiological functions of sFasL in human beings are not known, while its pathological role has been reported (14, 34). sFasL might be involved in the deletion of potentially hazardous "memory" cells in vivo in human beings. More importantly, our data suggest the possibility that FasL could be used as a therapeutic agent for a variety of autoimmune disorders in which T lymphocytes are the major effector cells, such as autoimmune diabetes and experimental allergic encephalomyelitis. FasL has been expressed intraarticularly to ameliorate collagen-induced arthritis (35). Although administration of FasL+ cells cannot be considered as a therapeutic tool, ex vivo treatment of lymphocytes with sFasL or agonistic anti-Fas Ab after lymphopheresis could be employed to ameliorate full-blown clinical symptoms and signs of autoimmune diseases.


    Acknowledgments
 
This report is dedicated to the late Dr. Yong Chol Han, the founder of Samsung Medical Center. We thank Dr. Kyoungho Suk for helpful discussion and Dr. Jung-Hwan Park for excellent technical assistance in neonatal thymectomy.


    Footnotes
 
1 This work was supported by Korea Science and Engineering Foundation Grant (1999-1-207-003-3) and the Critical Technology 21 Grant from the Korea Institute of Science and Technology Evaluation and Planning (B-02-09-A-04). M.-S.L. is an recipient of the Juvenile Diabetes Foundation International Research Grant and Samsung Grant. Back

2 S.K. and K.-A. K. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Myung-Shik Lee, Department of Medicine, Samsung Medical Center, 50 Irwon-dong Kangnam-ku, Seoul 135-710, Korea. E-mail address: Back

4 Abbreviations used in this paper: NOD, nonobese diabetic; FasL, Fas ligand; sFasL, soluble Fas ligand; BC, backcross; ETn, early transposable element; lpr/w, lpr/wild; PI, propidium iodide; GVHD, graft-vs-host disease; CHO, Chinese hamster ovary. Back

Received for publication August 6, 1999. Accepted for publication January 4, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Chervonsky, A. V., Y. Wang, F. S. Wong, I. Visintin, R. A. Flavell, C. A. Janeway, L. A. Matis. 1997. The role of Fas in autoimmune diabetes. Cell 89:17.[Medline]
  2. Itoh, N., A. Imagawa, T. Hanafusa, M. Waguri, K. Yamamoto, H. Iwasashi, M. Moriwaki, H. Nakajima, M. Miyagawa, M. Namba, et al 1997. Requirement of Fas for the development of autoimmune diabetes in nonobese diabetic mice. J. Exp. Med. 186:613.[Abstract/Free Full Text]
  3. Suarez-Pinxon, W., O. Sorensen, R. C. Bleachley, J. F. Elliott, R. V. Rejotte, A. Rabinovitch. 1999. ß-cell destruction in NOD mice correlates with Fas (CD95) expression on ß-cells and proinflammatory cytokine expression in islets. Diabetes 48:21.[Abstract]
  4. Amrani, A., J. Verdaguer, B. Anderson, T. Utsugi, S. Bou, P. Santamaria. 1999. Perforin-independent ß-cell destruction by diabetogenic CD8+ T lymphocytes in transgenic nonobese diabetic mice. J. Clin. Invest. 103:1201.[Medline]
  5. Allison, J., A. Strasser. 1998. Mechanisms of ß cell death in diabetes: a minor role for CD95. Proc. Natl. Acad. Sci. USA 95:13818.[Abstract/Free Full Text]
  6. Kim, Y.-H., S. Kim, K.-A. Kim, H. Yagita, N. Kayagaki, K.-W. Kim, M.-S. Lee. 1999. Apoptosis of pancreatic ß-cells detected in accelerated diabetes of NOD mice: no role of Fas-Fas ligand interaction in autoimmune diabetes. Eur. J. Immunol. 29:455.[Medline]
  7. Pakala, S. V., M. Chivetta, C. B. Kelly, J. D. Katz. 1999. In autoimmune diabetes the transition from benign to pernicious insulitis requires an islet cell response to tumor necrosis factor {alpha}. J. Exp. Med. 189:1053.[Abstract/Free Full Text]
  8. Wofsy, D., R. R. Hardy, W. Seaman. 1984. The proliferating cells in autoimmune MRL/lpr mice lack L3T4, an antigen on "helper" T cells that is involved in the response to class II major histocompatibility antigens. J. Immunol. 132:2686.[Medline]
  9. Adachi, M., R. Watanabe-Fukunaga, S. Nagata. 1993. Aberrant transcription caused by the insertion of an early transposable element in an intron of the Fas antigen gene of lpr mice. Proc. Natl. Acad. Sci. USA 90:1756.[Abstract/Free Full Text]
  10. Hyldig-Nielsen, J. J., L. Schenning, U. Hammerling, E. Widmark, E. Heldin, P. Lind, B. Servenius, T. Lung, R. Flavell, J. S. Lee, et al 1983. The complete nucleotide sequence of the I-E{alpha}d response gene. Nucleic Acids Res. 11:5055.[Abstract/Free Full Text]
  11. Wicker, L. A., B. J. Miller, Y. Mullen. 1986. Transfer of autoimmune diabetes mellitus with splenocytes from nonobese diabetic (NOD) mice. Diabetes 35:855.[Abstract]
  12. Theofilopoulos, A. N., R. S. Balderas, D. L. Shawler, S. Lee, F. J. Dixon. 1981. Influence of thymic genotype on the systemic lupus erytthematosus-like disease and T cell proliferation on MRL/Mp-lpr/lpr mice. J. Exp. Med. 153:1405.[Abstract/Free Full Text]
  13. Kayagaki, N., N. Yamaguchi, F. Nagao, S. Matsuo, H. Maeda, K. Okumura, H. Yagita. 1997. Polymorphism of murine Fas ligand that affects the biological activity. Proc. Natl. Acad. Sci. USA 94:3914.[Abstract/Free Full Text]
  14. Tanaka, M., T. Suda, T. Takahashi, S. Nagata. 1995. Expression of the functional soluble form of human Fas ligand in activated lymphocytes. EMBO J. 14:1129.[Medline]
  15. Stalder, T., S. Hahn, P. Erb. 1994. Fas antigen is the major target molecule for CD4+ T cell-mediated cytotoxicity. J. Immunol. 152:1127.[Abstract]
  16. Takahashi, T., M. Tanaka, J. Inazawa, T. Abe, T. Suda, S. Nagata. 1994. Human Fas ligand: gene structure, chromosomal location and species specificity. Int. Immunol. 6:1567.[Abstract/Free Full Text]
  17. Powrie, F., R. Correa-Oliveira, S. Mauze, R. L. Coffman. 1994. Regulatory interactions between CD45RBhigh and CD45RBlow CD4+ T cells are important for the balance between protective and pathogenic cell-mediated immunity. J. Exp. Med. 179:589.[Abstract/Free Full Text]
  18. Davidson, W. F., F. J. Dumont, B. H. G., B. J. Fowlkes, and H. C. Morse. 1986. Phenotypic, functional, and molecular genetic comparisons of the abnormal lymphoid cells of C3H-lpr/lpr and C3H-gld/gld mice. J. Immunol. 136:4075.
  19. Watanabe, D., T. Suda, H. Hashimoto, S. Nagata. 1995. Constitutive activation of the Fas ligand gene in mouse lymphoproliferative disorders. EMBO J. 14:12.[Medline]
  20. Chu, J. L., P. Ramos, A. Rosendorff, J. Nikolic-Zugic, E. Lacy, A. Matsuzawa, K. B. Elkon. 1995. Massive upregulation of the Fas ligand in lpr and gld mice: implications for Fas regualtion and the graft-versus-host disease-like wasting syndrome. J. Exp. Med. 181:393.[Abstract/Free Full Text]
  21. Theofilopoulos, A. N., R. S. Balderas, Y. Gozes, M. T. Aguado, L. Hang, P. Morrow, F. Dixon. 1985. Association of lpr gene with graft-vs-host disease-like syndrome. J. Exp. Med. 162:1.[Abstract/Free Full Text]
  22. Ogasawara, J., R. Watanabe-Fukunaga, M. Adachi, A. Matsuzawa, T. Kasugai, Y. Kitamura, N. Itoh, T. Suda, S. Nagata. 1993. Lethal effect of the anti-Fas antibody in mice. Nature 364:806.[Medline]
  23. Tanaka, M., T. Suda, T. Yatomi, N. Nakamura, S. Nagata. 1997. Lethal effect of recombinant human Fas ligand in mice pretreated with Propionibacterium acnes. J. Immunol. 158:2303.[Abstract]
  24. Owen-Schaub, L. B., S. Yonehara, W. L. Crump, E. A. Grimm. 1992. DNA fragmentation and cell death is selectively triggered in activated human lymphocytes by Fas antigen engagement. Cell. Immunol. 140:197.[Medline]
  25. Miyawaki, T., T. Uehara, R. Nibu, T. Tsuji, A. Yachie, S. Yonehara, N. Taniguchi. 1992. Differential expression of apoptosis-related Fas antigen on lymphocytes subpopulations in human peripheral blood. J. Immunol. 149:3753.[Abstract]
  26. Nishimura, Y., A. Ishii, Y. Kobayashi, Y. Yamasaki, S. Yonehara. 1995. Expression and function of mouse Fas antigen on immature and mature T cells. J. Immunol. 154:4395.[Abstract]
  27. Suda, T., M. Tanaka, K. Miwa, S. Nagata. 1996. Apoptosis of mouse naive T cells induced by recombinant soluble Fas ligand and activation-induced resistance to Fas ligand. J. Immunol. 157:3918.[Abstract]
  28. Salmon, M., D. Pilling, N. J. Borthwick, N. Viner, G. Janossy, P. A. Bacon, A. N. Akbar. 1994. The progressive differentiation of primed T cells is associated with an increasing susceptibility to apoptosis. Eur. J. Immunol. 24:892.[Medline]
  29. Hattori, K., T. Hirano, H. Miyajima, N. Yamakawa, M. Tateno, K. Oshimi, N. Kayagaki, H. Yagita, K. Okumura. 1998. Differential effects of anti-Fas ligand and anti-TNF{alpha} antibodies on acute graft-versus-host disease pathologies. Blood 91:4051.[Abstract/Free Full Text]
  30. Suda, T., H. Hashimoto, M. Tanaka, T. Ochi, S. Nagata. 1997. Membrane Fas ligand kills human peripheral blood T lymphocytes, and soluble Fas ligand blocks the killing. J. Exp. Med. 186:2045.[Abstract/Free Full Text]
  31. Shimada, A., C. Rohane, C. G. Fathman, B. Charlton. 1996. Pathogenic and protective role of CD45RBlow CD4+ cells collrelate with cytokine profiles in the spontaneously autoimmune diabetic mouse. Diabetes 45:71.[Abstract]
  32. Michie, C. A., A. McLean, C. Alcock, P. C. Beverley. 1992. Lifespan of human lymphocytes subsets defined by CD45 isoforms. Nature 360:264.[Medline]
  33. Bell, E. B., S. M. Sparshott, C. Bunce. 1998. CD4+ T-cell memory, CD45R subsets and the persistence of antigen—a unifying concept. Immunol. Today 19:60.[Medline]
  34. Tanaka, M., T. Suda, K. Haze, N. Nakamura, K. Sato, F. Kimura, K. Motoyoshi, M. Mizuki, S. Tagawa, S. Ohga, K. Hatake, A. H. Drummond, S. Nagata. 1996. Fas ligand in human serum. Nat. Med. 2:317.[Medline]
  35. Zhang, H., Y. Yang, J. L. Horton, E. B. Samoilova, T. A. Judge, L. A. Turka, J. M. Wilson, Y. Chen. 1997. Amelioration of collagen-induced arthritis by CD95 (Apo-1/Fas)-ligand gene transfer. J. Clin. Invest. 100:1951.[Medline]



This article has been cited by other articles:


Home page
DiabetesHome page
S. Kim, H. S. Kim, K. W. Chung, S. H. Oh, J. W. Yun, S.-H. Im, M.-K. Lee, K.-W. Kim, and M.-S. Lee
Essential Role for Signal Transducer and Activator of Transcription-1 in Pancreatic {beta}-Cell Death and Autoimmune Type 1 Diabetes of Nonobese Diabetic Mice
Diabetes, October 1, 2007; 56(10): 2561 - 2568.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. S. Mohamood, M. L. Guler, Z. Xiao, D. Zheng, A. Hess, Y. Wang, H. Yagita, J. P. Schneck, and A. R. A. Hamad
Protection from Autoimmune Diabetes and T-Cell Lymphoproliferation Induced by FasL Mutation Are Differentially Regulated and Can Be Uncoupled Pharmacologically
Am. J. Pathol., July 1, 2007; 171(1): 97 - 106.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Kim, I. Millet, H. S. Kim, J. Y. Kim, M. S. Han, M.-K. Lee, K.-W. Kim, R. S. Sherwin, M. Karin, and M.-S. Lee
NF-{kappa}B prevents beta cell death and autoimmune diabetes in NOD mice
PNAS, February 6, 2007; 104(6): 1913 - 1918.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
A. S. Mohamood, C. J. Trujillo, D. Zheng, C. Jie, F. M. Murillo, J. P. Schneck, and A. R. A. Hamad
Gld mutation of Fas ligand increases the frequency and up-regulates cell survival genes in CD25+CD4+ TR cells
Int. Immunol., August 1, 2006; 18(8): 1265 - 1277.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Askenasy, E. S. Yolcu, I. Yaniv, and H. Shirwan
Induction of tolerance using Fas ligand: a double-edged immunomodulator
Blood, February 15, 2005; 105(4): 1396 - 1404.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
H.-Y. Qin, P. Chaturvedi, and B. Singh
In vivo apoptosis of diabetogenic T cells in NOD mice by IFN-{gamma}/TNF-{alpha}
Int. Immunol., December 1, 2004; 16(12): 1723 - 1732.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
L. Vence, C. Benoist, and D. Mathis
Fas Deficiency Prevents Type 1 Diabetes by Inducing Hyporesponsiveness in Islet {beta}-Cell-Reactive T-Cells
Diabetes, November 1, 2004; 53(11): 2797 - 2803.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. Chang, N. Cho, S. Kim, J. Y. Kim, E. Kim, J.-E. Woo, J. H. Nam, S. J. Kim, and M.-S. Lee
Role of Calcium in Pancreatic Islet Cell Death by IFN-{gamma}/TNF-{alpha}
J. Immunol., June 1, 2004; 172(11): 7008 - 7014.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
U. Christen, R. Darwiche, H. E. Thomas, T. Wolfe, E. Rodrigo, A. Chervonsky, R. A. Flavell, and M. G. von Herrath
Virally Induced Inflammation Triggers Fratricide of Fas-Ligand-Expressing {beta}-Cells
Diabetes, March 1, 2004; 53(3): 591 - 596.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
T. MANDRUP-POULSEN
Beta Cell Death and Protection
Ann. N.Y. Acad. Sci., November 1, 2003; 1005(1): 32 - 42.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. G. Silva, N. Petrovsky, L. Socha, R. Slattery, P. Gatenby, and B. Charlton
Mechanisms of Accelerated Immune-Mediated Diabetes Resulting from Islet {beta} Cell Expression of a Fas Ligand Transgene
J. Immunol., May 15, 2003; 170(10): 4996 - 5002.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Y. Savinov, A. Tcherepanov, E. A. Green, R. A. Flavell, and A. V. Chervonsky
Contribution of Fas to diabetes development
PNAS, January 21, 2003; 100(2): 628 - 632.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Nakayama, M. Nagata, H. Yasuda, K. Arisawa, R. Kotani, K. Yamada, S. A. Chowdhury, S. Chakrabarty, Z. Z. Jin, H. Yagita, et al.
Fas/Fas Ligand Interactions Play an Essential Role in the Initiation of Murine Autoimmune Diabetes
Diabetes, May 1, 2002; 51(5): 1391 - 1397.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
N. PETROVSKY, D. SILVA, L. SOCHA, R. SLATTERY, and B. CHARLTON
The Role of Fas Ligand in Beta Cell Destruction in Autoimmune Diabetes of NOD Mice
Ann. N.Y. Acad. Sci., April 1, 2002; 958(1): 204 - 208.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-H. Ahn, S.-M. Park, H.-S. Cho, M.-S. Lee, J.-B. Yoon, J. Vilcek, and T. H. Lee
Non-apoptotic Signaling Pathways Activated by Soluble Fas Ligand in Serum-starved Human Fibroblasts. MITOGEN-ACTIVATED PROTEIN KINASES AND NF-kappa B-DEPENDENT GENE EXPRESSION
J. Biol. Chem., December 7, 2001; 276(50): 47100 - 47106.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. I. Darville and D. L. Eizirik
Cytokine Induction of Fas Gene Expression in Insulin-Producing Cells Requires the Transcription Factors NF-{kappa}B and C/EBP
Diabetes, August 1, 2001; 50(8): 1741 - 1748.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Suk, S. Kim, Y.-H. Kim, K.-A. Kim, I. Chang, H. Yagita, M. Shong, and M.-S. Lee
IFN-{{gamma}}/TNF-{{alpha}} Synergism as the Final Effector in Autoimmune Diabetes: A Key Role for STAT1/IFN Regulatory Factor-1 Pathway in Pancreatic {{beta}} Cell Death
J. Immunol., April 1, 2001; 166(7): 4481 - 4489.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
Z. H. Lee, S. E. Lee, K. Kwack, W. Yeo, T. H. Lee, S. S. Bae, P.-G. Suh, and H.-H. Kim
Caspase-mediated cleavage of TRAF3 in FasL-stimulated Jurkat-T cells
J. Leukoc. Biol., March 1, 2001; 69(3): 490 - 496.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, S.
Right arrow Articles by Lee, M.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, S.
Right arrow