|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



*
Department of Medicine, Samsung Medical Center, Sungkyunkwan University Medical School, Seoul, Korea;
Department of Biology, Yonsei University College of Science, Seoul, Korea; and
Department of Immunology, Juntendo University School of Medicine, Tokyo, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
NOD mice were purchased from The Jackson Laboratory (Bar
Harbor, ME) and were maintained in a specific pathogen-free environment
in the vivarium of Samsung Medical Center. The incidence of diabetes in
female and male NOD mice was about 70% and 30%, respectively, at 24
wk of age. NOD mice were bred with MRL-lpr/lpr mice and
F1 mice were backcrossed to NOD mice. N2
(backcross 1, BC1) mice heterozygous for Fas with an early transposable
element (ETn) were selected by Southern blot or PCR typing
of tail DNA and then backcrossed repeatedly to NOD mice to derive
NOD-lpr/wild (lpr/w) BC8 mice. They were
intercrossed to derive NOD-lpr/lpr as an experimental group
and NOD-lpr/w mice as a control group. Heterozygous and
homozygous mice were typed again by using Southern blot analysis or PCR
amplification of tail DNA. For Southern blot analysis, 10 µg of tail
DNA was digested with EcoRI and run on 0.6% agarose gel.
After capillary transfer for 18 h, the membrane was denatured with
0.4 N NaOH followed by neutralization in 0.2 M Tris (pH 7.5), 2x SSC,
0.1% SDS. After UV cross-linking and prehybridization at 65°C, the
membranes were hybridized for 18 h with a
EcoRI-HindIII fragment of murine Fas cDNA labeled
with [32P]dCTP (Amersham, Buckinghamshire,
U.K.). After washing with 2x SSC, 2x SSC, 0.1% SDS and then with
0.1x SSC, 0.1% SDS, the membranes were exposed to x-ray films. A
13-kb band indicated the presence of the normal Fas allele,
and a 11-kb band indicated that of a mutated Fas allele
because of a new EcoRI restriction site in the inserted
ETn sequence (9) (data not shown). PCR was
conducted using a primer set to select heterozygotes for the mutated
Fas allele (forward, CAGCAGGAATCCTATGAGCT; reverse,
CTCGCAACGTGAACGGTTCG). Another primer set was used to distinguish
heterozygotes and homozygotes for the mutated Fas (forward,
CAGCAGGAATCCTATGAGCT; reverse, GCAGAGATGCTAAGCAGCAG)
(2). MHC haplotype of the BC mice was determined by PCR
amplification of tail DNA using a primer set specific for I-E
(forward, ATGAGCTCCCAGAAGTCATGGG; reverse, GGAGAGACAGCAGCTCTCAGC)
(10) to confirm homozygosity for
H-2g7. A one-way MLC was employed to verify
genetic homogeneity between NOD mice and NOD-lpr/lpr
(-lpr/w) mice. All animal studies were approved by the
Institutional Review Board of Samsung Medical Center.
Adoptive transfer
Adoptive transfer of diabetes was conducted according to a previous report (11). In brief, 2 x 107 splenocytes from diabetic female or male NOD mice were infused into the tail vein of each 8- to 10-wk-old NOD or NOD-lpr/lpr (-lpr/w) mouse of the same sex. Recipient mice were sublethally irradiated (750 rad) using a Cesium irradiator (IBL 437, CIS Biointernational, Gif-sur-Yvette, France) 16 h before the transfer of splenocytes. The incidence of diabetes was above 90% at 4 wk after adoptive transfer to NOD mice in our previous experiments. For cotransfer experiments, 2 x 107 splenocytes from 4- to 5-mo-old NOD-lpr/lpr mice and the same number of splenocytes from diabetic NOD mice of the same sex were transferred together to the irradiated recipient NOD mice of the same sex. Splenocytes from 4- to 5-mo-old NOD-lpr/w littermate mice were cotransferred in control experiments.
RNase protection assay
RNA from lymphocytes was hybridized with a 32P-labeled riboprobe prepared by in vitro transcription of a linearized expression vector harboring FasL cDNA. The intensity of the protected band after hybridization was standardized against that of the mouse ß-actin band.
Neonatal thymectomy of NOD-lpr/lpr mice
Neonatal thymectomy of NOD-lpr/lpr mice was performed
as described previously (12). In brief, the thymus was
removed by a wire loop through a small longitudinal incision over the
sternum before 1.5 days after birth. The absence of the thymus was
confirmed by flow cytometric analyses using PE-labeled anti-CD3
(PharMingen, La Jolla, CA) to determine the frequency of
CD3
+ cells in heparinized peripheral blood at
78 wk of age and also by inspecting the thymus at the time of
sacrifice. The mice with CD3
+ cell percentage
above twice that of nude mice were excluded from the study. Donor
lymphocytes were transferred to 8- to 10-wk-old neonatal thymectomized
NOD-lpr/lpr of the same sex after sublethal irradiation.
Insulitis scoring
To determine the severity of insulitis, >30 pancreatic islets
from three or more parallel sections of different cut levels were
analyzed per mouse. The degree of insulitis was classified into four
categories: 0, no insulitis; 1, periinsulitis with or without minimal
lymphocytic infiltration in islets; 2, invasive insulitis with islet
destruction
50%; 3, islet destruction >50%.
Anti-FasL Ab treatment
A hybridoma producing K10 anti-FasL Ab (13) was injected i.p. into nude mice pretreated with Pristane (Sigma, St. Louis, MO). Ab was purified using a protein A-Sepharose (Pharmacia, Uppsala, Sweden) column. Bound IgG was eluted with 50 mM glycine-HCl, pH 2.5. The collected fraction was dialyzed against PBS and then filter-sterilized. Ab (1 mg) was injected i.p. three times a week into NOD mice before and after cotransfer. Control NOD mice were treated with the same dose of mouse IgG (Sigma) during the cotransfer experiments. Validity of the anti-FasL Ab preparation was confirmed by an almost complete abrogation of hepatitis after injection of 15 mg/kg Con A (Sigma) to C57BL6 and NOD mice (data not shown).
Ex vivo treatment with sFasL
sFasL was produced according to a previous report (14) with modifications. In brief, CD5 signal sequence was attached to Pro137 of human FasL. Chinese hamster ovary (CHO) K1 cells were stably transfected with the construct. Selected clones were cultured in a serum-free medium (CHO-S-SFM II; Life Technologies, Gaithersburg, MD). sFasL (10% culture supernatant) killed >50% of Jurkat cells and A20.2J murine B lymphoma cells (15) after treatment for 16 h (data not shown), consistent with previous reports that human FasL is effective against murine Fas (14, 16). Splenocytes from diabetic NOD mice were incubated with 10% sFasL culture supernatant for 16 h. After washing three times, they were transferred to the irradiated NOD recipient mice. CHO K1 culture supernatant (10%) without transfection was used as a control reagent.
Apoptosis staining
Cells were stained with 2.5 µg/ml Hoechst 33258 (Calbiochem, Cambridge, MA) after fixation in 4% paraformaldehyde.
Flow cytometry
A total of 13 x 106 lymphocytes were incubated with 10 µg/ml biotinylated anti-CD45RB Ab (PharMingen). They were then incubated with FITC-streptavidin (Vector, Burlingame, CA) and PE-anti-CD4 Ab (PharMingen) with or without 2.5 µg/ml propidium iodide (PI). Cells were gated by forward and side scatters, and further gated on CD4. CD45RBlow cells were defined as the dullest staining 20% of the untreated CD4+ cells (17). To count PI-stained cells, cells were gated on CD4 and CD45RB. For triple-colored analyses, Cy-Chrome-streptavidin (PharMingen), PE-anti-CD4 Ab, and FITC-anti-Fas Ab (PharMingen) were used for the second incubation. To examine the fraction of double-negative (CD4-CD8-) B220+ cells in NOD-lpr/lpr cells, splenocytes were first incubated with anti-B220 Ab (PharMingen). Then, they were incubated with FITC-anti-rat IgG. After blocking any free binding site by adding purified rat Ig (Phar-Mingen), cells were incubated with PE-anti-CD4 Ab and PE-anti-CD8 Ab (PharMingen).
Statistical analyses
The incidence of diabetes was plotted according to Kaplan-Meier method. The incidences were compared between the two groups using the log-rank test. Students t test was employed to compare mean values between the two groups. Values of p < 0.05 were regarded as statistically significant.
| Results |
|---|
|
|
|---|
NOD-lpr/lpr mice older than 3 mo had classical
phenotypes of lpr mice such as generalized lymphadenopathy,
splenomegaly, thymomegaly, nephritis, and increased
CD4-CD8-B220+
cell fraction (>60%), while littermate NOD-lpr/w mice did
not have such phenotypes (12). None of Fas-deficient
female NOD-lpr/lpr mice (0/12) developed diabetes or
insulitis up to 8 mo of age, while 60% (6/10) of control female
NOD-lpr/w littermates had diabetes before 24 wk of age (Fig. 1
A), consistent with previous
reports (1, 2).
|
Because the absence of diabetes and insulitis in
NOD-lpr/lpr mice could have been due to an accumulation of
unusual (double-negative) cells and distortion of lymphocyte
development (8, 18), we transferred lymphocytes from
diabetic NOD mice to 8- to 10-wk-old irradiated NOD-lpr/lpr
mice. NOD-lpr/lpr mice were resistant to diabetes transfer,
confirming previous results (1, 2). None of the 12
NOD-lpr/lpr mice developed diabetes in 8 wk after adoptive
transfer, while 73% (8/11) of the control NOD-lpr/w
littermates developed diabetes during the same observation period, in
three independent experiments showing similar results (Fig. 1
B). Pancreatic islets of NOD-lpr/lpr mice were
either completely free of insulitis or showed mild periinsulitis after
adoptive transfer, while NOD-lpr/w mice had florid insulitis
and/or paucity of pancreatic islets because of extensive destruction
after adoptive transfer (data not shown).
Inhibition of diabetes transfer by FasL constitutively expressed on lpr lymphocytes
Because these results apparently contradicted recent reports that
anti-FasL Ab treatment did not inhibit diabetes in NOD mice and
Fas-deficient neonatal pancreas was destroyed by autoreactive
lymphocytes in diabetic NOD mice (5, 6), we studied if
abnormal (double-negative) lymphocytes in NOD-lpr/lpr mice
were interfering with the adoptive transfer experiments (Fig. 1
B). We investigated whether abnormal lymphocytes from
NOD-lpr/lpr mice were expressing FasL like lpr
mice of different backgrounds (19, 20). RNase protection
assays showed that lymphocytes from 4-mo-old NOD-lpr/lpr
mice were constitutively expressing high level of FasL mRNA (Fig. 2
A). Because such
FasL-expressing cells might affect the outcome of adoptive transfer by
inducing apoptosis on transferred lymphocytes, neonatal thymectomy of
NOD-lpr/lpr mice was performed to eliminate or reduce the
effects of such abnormal lymphoid cells. Neonatal thymectomized
NOD-lpr/lpr mice still did not develop diabetes after
adoptive transfer (n = 6). However, histological
analysis revealed insulitis after adoptive transfer that was not
observed in unmanipulated NOD-lpr/lpr mice consistently in
four independent experiments, suggesting that Fas-FasL interaction is
not necessary at least for insulitis. The average insulitis score was
0.74 ± 0.39 at 68 wk after adoptive transfer (mean ± SD,
n = 6), which was significantly higher than that after
adoptive transfer to unmanipulated NOD-lpr/lpr mice
(0.02 ± 0.02, n = 6) (p
< 0.01) (Fig. 2
B). In the recipient NOD-lpr/lpr
mice with previous neonatal thymectomy, exocrine pancreatitis or
cellular depletion of the splenic white pulp was not observed, despite
the clear evidence of insulitis, suggesting that the insulitis was a
specific phenomenon and not a manifestation of generalized inflammatory
responses such as graft-vs-host diseases (GVHD).
|
|
Although these results suggested the possibility of FasL or
FasL-expressing cells as a therapeutic agent for autoimmune diabetes,
they cannot be directly employed because of the adverse effects of
systemic FasL such as GVHD or hepatitis as observed in this study or
other reports (22, 23). To exploit the effect of FasL on
autoreactive lymphocytes without adverse effects of systemic FasL, we
investigated if ex vivo pretreatment of splenocytes from diabetic NOD
mice with sFasL has similar inhibitory effects on diabetes transfer.
Pretreatment of splenocytes with sFasL for 16 h decreased the
incidence of diabetes after adoptive transfer from 75% (6/8,
pretreated with control CHO K1 cell supernatant) to 22% (2/9)
(p < 0.01) (Fig. 3
B), strongly
indicating that sFasL could be a therapeutic or preventive agent
against autoimmune diabetes. As expected, recipient mice of the
lymphocytes treated ex vivo with sFasL did not show signs of GVHD (data
not shown).
sFasL kills "memory" cells among peripheral lymphocytes
Because these results suggested that sFasL functionally affects
peripheral lymphocytes in contrast to previous reports that agonistic
anti-Fas Ab did not induce apoptosis on unmanipulated murine or
human peripheral lymphocytes (24, 25, 26, 27), we next studied
what kind of effect the sFasL treatment exerts on splenocytes from NOD
mice. Staining with Hoechst 33258 showed no significant increase in the
number of apoptotic cells after incubation with sFasL, compared with
incubation with control CHO K1 supernatant (data not shown). We thought
that sFasL might induce apoptosis on a small subset of splenocytes.
Because previous reports showed that
CD45RO+RBlow "memory"
cells among CD4+ T cells expressed high level of
Fas (25, 28), we examined the change in percentage of such
cells after treatment with sFasL. Treatment of lymphocytes from
diabetic (n = 3) or nondiabetic NOD mice
(n = 4) with sFasL for 16 h decreased the portion
of CD45RBlow cells among
CD4+ T cells from 16.4 ± 2.7% (treated
with control CHO K1 supernatant) to 10.2 ± 3.0% (mean ±
SD, n = 7, p < 0.01) (Fig. 4
A). The same treatment also
increased the portion of PI-stained dead cells among
CD4+CD45RBlow cells from
12.7 ± 5.5% (treated with CHO K1 supernatant) to 32.2 ±
12.1% (mean ± SD, n = 7, p <
0.01) (Fig. 4
B).
CD45RBlowCD4+ T lymphocytes
from diabetic and nondiabetic NOD mice were equally susceptible to
treatment with sFasL (data not shown). Those from diabetes-resistant
mouse strains such as C57BL/6 or ICR were also susceptible to the sFasL
treatment (data not shown). Triple-colored flow cytometry showed that
the decrease in the number of
CD4+CD45RBlow cells after
sFasL treatment was due to the death (and decrease) of
Fas+CD45RBlo cells as
expected (7.3 ± 3.2% among CD4+ cells
after treatment with control CHO K1 supernatant vs 3.6 ± 1.9%
after treatment with sFasL; n = 8, p <
0.05) (Fig. 4
, C and D). The portion of
Fas+CD45RBhigh cells among
CD4+ cells was not significantly decreased by
sFasL treatment (19.0 ± 11.3% among CD4+
cells after treatment with control CHO K1 supernatant vs 14.8 ±
7.9% after treatment with sFasL; n = 8,
p > 0.1). Treatment with 1 µg/ml agonistic
anti-Fas Ab (Jo2) and 30 µg/ml cycloheximide also significantly
decreased the fraction of CD45RBlow cells among
CD4+ cells from 23.8 ± 2.2% (treated with
cycloheximide alone) to 13.4 ± 4.1% (n = 5,
p < 0.01) (Fig. 4
E).
|
| Discussion |
|---|
|
|
|---|
ß+, 
+ T cells,
NK cells, or B cells expressing FasL. Furthermore, cotransfer of
abnormal FasL+ cells from NOD-lpr/lpr
mice completely inhibited diabetes transfer probably by exerting
apoptosis on autoreactive lymphocytes, which is consistent with a
previous report showing a shortened life span of transferred
lymphocytes in NOD-lpr/lpr mice (5). GVHD
observed in the recipient mice of the cotransfer was due to abnormal
FasL on lymphocytes from NOD-lpr/lpr mice, consistent with
the critical role of FasL as an effector molecule in GVHD
(29). GVHD was not due to incomplete backcrossing in the
production of NOD-lpr/lpr mice because no significant
proliferative response was observed in MLC between NOD lymphocytes and
NOD-lpr/lpr (or -lpr/w) lymphocytes (data not
shown) and no such GVHD was observed in control recipient NOD mice to
which lymphocytes from NOD-lpr/w mice were infused. Finally,
diabetes was restored by anti-FasL Ab treatment in recipient mice
into which FasL+ lymphocytes from
NOD-lpr/lpr mice and lymphocytes from diabetic NOD mice were
cotransferred. This result ultimately proves that FasL is not an
effector molecule in ß cell death and lymphocytes from
NOD-lpr/lpr mice induce apoptosis on cotransferred
lymphocytes through Fas-FasL interaction. FasL might be an effector
molecule only for a small number of CD8+ T
lymphocytes that initially infiltrate pancreatic islets
(4) but definitely not for the majority of diabetogenic
lymphocytes because diabetes was actually provoked by blocking Fas-FasL
interaction. A significant decrease in the incidence of diabetes after ex vivo treatment of lymphocytes with sFasL suggests the possibility of a new treatment modality without the adverse effects of systemic FasL. A <100% inhibition of diabetes by sFasL pretreatment of splenocytes could be due to a weaker activity of sFasL compared with membrane FasL that can reportedly kill even naive lymphocytes (30). In an effort to investigate the effect of sFasL on peripheral lymphocytes that was evident in our ex vivo treatment model, we observed that "memory" T lymphocytes were selectively killed by sFasL. These results are in contrast to previous reports that agonistic anti-Fas Ab did not exert apoptosis on unmanipulated peripheral lymphocytes and Fas on peripheral lymphocytes is nonfunctional (24, 25, 26). sFasL produced by Suda et al. exerted cytotoxicity on peripheral lymphocytes including naive T cells; however, their sFasL was an artificially processed multimer acting like membrane FasL (27, 30). The previous inability to detect apoptotic peripheral lymphocyte fraction after anti-Fas Ab treatment seems to be due to a low frequency of apoptotic CD4+CDRBlow cells that escaped detection while using unfractionated total peripheral lymphocytes. The apoptotic population observed in our study would include autoreactive diabetogenic lymphocytes whose ablation leads to the abrogation of diabetes. Our observations are consistent with a successful transfer of diabetes by CD45RBlowCD4+ cells but not by CD45RBhighCD4+ cells (31). Recent papers suggested that memory cells could be divided into CD45RBlow and CD45RBhigh subsets. According to them, only the former cells (mostly Fas+) are able to respond rapidly and short-lived, representing "preactivated" lymphocytes, while the latter "memory revertants" (mostly Fas-) are quiescent and long-lived, persisting without Ag (32, 33). Their theory may explain why memory cells express Fas and are vulnerable to Fas-mediated apoptosis, contrary to the general notion that memory cells should live long. Our ex vivo treatment with sFasL seems to kill potentially dangerous "preactivated" cells with Fas up-regulation and may not affect "true" CD45RBhigh "memory" T cells without Fas up-regulation.
We conclude that FasL is not an effector molecule in autoimmune ß cell destruction and NOD-lpr/lpr mice are resistant to diabetes transfer because FasL constitutively expressed on their abnormal lymphocytes exerts cytotoxicity on diabetogenic lymphocytes, resolving the contradiction between previous papers. We also demonstrated that "memory" T cells are susceptible to sFasL or anti-Fas Ab. Physiological functions of sFasL in human beings are not known, while its pathological role has been reported (14, 34). sFasL might be involved in the deletion of potentially hazardous "memory" cells in vivo in human beings. More importantly, our data suggest the possibility that FasL could be used as a therapeutic agent for a variety of autoimmune disorders in which T lymphocytes are the major effector cells, such as autoimmune diabetes and experimental allergic encephalomyelitis. FasL has been expressed intraarticularly to ameliorate collagen-induced arthritis (35). Although administration of FasL+ cells cannot be considered as a therapeutic tool, ex vivo treatment of lymphocytes with sFasL or agonistic anti-Fas Ab after lymphopheresis could be employed to ameliorate full-blown clinical symptoms and signs of autoimmune diseases.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 S.K. and K.-A. K. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Myung-Shik Lee, Department of Medicine, Samsung Medical Center, 50 Irwon-dong Kangnam-ku, Seoul 135-710, Korea. E-mail address: ![]()
4 Abbreviations used in this paper: NOD, nonobese diabetic; FasL, Fas ligand; sFasL, soluble Fas ligand; BC, backcross; ETn, early transposable element; lpr/w, lpr/wild; PI, propidium iodide; GVHD, graft-vs-host disease; CHO, Chinese hamster ovary. ![]()
Received for publication August 6, 1999. Accepted for publication January 4, 2000.
| References |
|---|
|
|
|---|
. J. Exp. Med. 189:1053.
d response gene. Nucleic Acids Res. 11:5055.
antibodies on acute graft-versus-host disease pathologies. Blood 91:4051.This article has been cited by other articles:
![]() |
N. Iijima, M. M. Linehan, M. Zamora, D. Butkus, R. Dunn, M. R. Kehry, T. M. Laufer, and A. Iwasaki Dendritic cells and B cells maximize mucosal Th1 memory response to herpes simplex virus J. Exp. Med., December 22, 2008; 205(13): 3041 - 3052. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Woodworth, Y. Wu, and S. M. Behar Mycobacterium tuberculosis-Specific CD8+ T Cells Require Perforin to Kill Target Cells and Provide Protection In Vivo J. Immunol., December 15, 2008; 181(12): 8595 - 8603. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Waid, G. M. Vaitaitis, N. D. Pennock, and D. H. Wagner Jr Disruption of the homeostatic balance between autoaggressive (CD4+CD40+) and regulatory (CD4+CD25+FoxP3+) T cells promotes diabetes J. Leukoc. Biol., August 1, 2008; 84(2): 431 - 439. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kim, H. S. Kim, K. W. Chung, S. H. Oh, J. W. Yun, S.-H. Im, M.-K. Lee, K.-W. Kim, and M.-S. Lee Essential Role for Signal Transducer and Activator of Transcription-1 in Pancreatic {beta}-Cell Death and Autoimmune Type 1 Diabetes of Nonobese Diabetic Mice Diabetes, October 1, 2007; 56(10): 2561 - 2568. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Mohamood, M. L. Guler, Z. Xiao, D. Zheng, A. Hess, Y. Wang, H. Yagita, J. P. Schneck, and A. R. A. Hamad Protection from Autoimmune Diabetes and T-Cell Lymphoproliferation Induced by FasL Mutation Are Differentially Regulated and Can Be Uncoupled Pharmacologically Am. J. Pathol., July 1, 2007; 171(1): 97 - 106. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kim, I. Millet, H. S. Kim, J. Y. Kim, M. S. Han, M.-K. Lee, K.-W. Kim, R. S. Sherwin, M. Karin, and M.-S. Lee NF-{kappa}B prevents beta cell death and autoimmune diabetes in NOD mice PNAS, February 6, 2007; 104(6): 1913 - 1918. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Mohamood, C. J. Trujillo, D. Zheng, C. Jie, F. M. Murillo, J. P. Schneck, and A. R. A. Hamad Gld mutation of Fas ligand increases the frequency and up-regulates cell survival genes in CD25+CD4+ TR cells Int. Immunol., August 1, 2006; 18(8): 1265 - 1277. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Askenasy, E. S. Yolcu, I. Yaniv, and H. Shirwan Induction of tolerance using Fas ligand: a double-edged immunomodulator Blood, February 15, 2005; 105(4): 1396 - 1404. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Qin, P. Chaturvedi, and B. Singh In vivo apoptosis of diabetogenic T cells in NOD mice by IFN-{gamma}/TNF-{alpha} Int. Immunol., December 1, 2004; 16(12): 1723 - 1732. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Vence, C. Benoist, and D. Mathis Fas Deficiency Prevents Type 1 Diabetes by Inducing Hyporesponsiveness in Islet {beta}-Cell-Reactive T-Cells Diabetes, November 1, 2004; 53(11): 2797 - 2803. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Chang, N. Cho, S. Kim, J. Y. Kim, E. Kim, J.-E. Woo, J. H. Nam, S. J. Kim, and M.-S. Lee Role of Calcium in Pancreatic Islet Cell Death by IFN-{gamma}/TNF-{alpha} J. Immunol., June 1, 2004; 172(11): 7008 - 7014. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Christen, R. Darwiche, H. E. Thomas, T. Wolfe, E. Rodrigo, A. Chervonsky, R. A. Flavell, and M. G. von Herrath Virally Induced Inflammation Triggers Fratricide of Fas-Ligand-Expressing {beta}-Cells Diabetes, March 1, 2004; 53(3): 591 - 596. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Silva, N. Petrovsky, L. Socha, R. Slattery, P. Gatenby, and B. Charlton Mechanisms of Accelerated Immune-Mediated Diabetes Resulting from Islet {beta} Cell Expression of a Fas Ligand Transgene J. Immunol., May 15, 2003; 170(10): 4996 - 5002. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. Savinov, A. Tcherepanov, E. A. Green, R. A. Flavell, and A. V. Chervonsky Contribution of Fas to diabetes development PNAS, January 21, 2003; 100(2): 628 - 632. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nakayama, M. Nagata, H. Yasuda, K. Arisawa, R. Kotani, K. Yamada, S. A. Chowdhury, S. Chakrabarty, Z. Z. Jin, H. Yagita, et al. Fas/Fas Ligand Interactions Play an Essential Role in the Initiation of Murine Autoimmune Diabetes Diabetes, May 1, 2002; 51(5): 1391 - 1397. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Ahn, S.-M. Park, H.-S. Cho, M.-S. Lee, J.-B. Yoon, J. Vilcek, and T. H. Lee Non-apoptotic Signaling Pathways Activated by Soluble Fas Ligand in Serum-starved Human Fibroblasts. MITOGEN-ACTIVATED PROTEIN KINASES AND NF-kappa B-DEPENDENT GENE EXPRESSION J. Biol. Chem., December 7, 2001; 276(50): 47100 - 47106. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Darville and D. L. Eizirik Cytokine Induction of Fas Gene Expression in Insulin-Producing Cells Requires the Transcription Factors NF-{kappa}B and C/EBP Diabetes, August 1, 2001; 50(8): 1741 - 1748. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Suk, S. Kim, Y.-H. Kim, K.-A. Kim, I. Chang, H. Yagita, M. Shong, and M.-S. Lee IFN-{{gamma}}/TNF-{{alpha}} Synergism as the Final Effector in Autoimmune Diabetes: A Key Role for STAT1/IFN Regulatory Factor-1 Pathway in Pancreatic {{beta}} Cell Death J. Immunol., April 1, 2001; 166(7): 4481 - 4489. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. H. Lee, S. E. Lee, K. Kwack, W. Yeo, T. H. Lee, S. S. Bae, P.-G. Suh, and H.-H. Kim Caspase-mediated cleavage of TRAF3 in FasL-stimulated Jurkat-T cells J. Leukoc. Biol., March 1, 2001; 69(3): 490 - 496. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |