| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Medicine, University of Michigan, and
Veterans Affairs Medical Center, Ann Arbor MI 48109
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1010 monocytes daily, and
this production must be balanced by a similar rate of destruction.
Monocytes/macrophages can undergo apoptosis after activating
CD4+ T cells, suggesting one mechanism that may contribute
to macrophage homeostasis. Previous reports indicate that Fas-Fas
ligand interactions are the principle molecules mediating this
response. However, D10, an Iak-restricted cloned Th2 line,
will similarly induce apoptosis in Ag-presenting macrophages, and D10
cells lack Fas ligand. To confirm that D10 cells kill macrophages
through Fas-independent pathways, D10 cells were shown to kill MRL
lpr/lpr (Iak) macrophages in an Ag-dependent
fashion, indicating additional mechanisms. Recent reports demonstrate
that TNF-related apoptosis-inducing ligand (TRAIL), interacting with
Apo2, and TNF-like weak inducer of apoptosis (TWEAK), interacting with
Apo3, will induce apoptosis in some cells. Using Abs to TRAIL and an
Apo3-IgG Fc fusion protein, we demonstrated that D10 cells express both
TRAIL and TWEAK. The Apo3 fusion protein, but not human IgG, inhibited
D10-induced macrophage apoptosis, as did anti-TRAIL. Further
studies demonstrated that AE7, a cloned Th1 line, and splenic T cells
express TWEAK, TRAIL, and Fas ligand, and inhibiting these molecules
also inhibited macrophage killing. These results indicate that D10
cells induce macrophage apoptosis through TRAIL- and
TWEAK-dependent pathways. Because normal T cells also express these
molecules, these results support the concept that T cells have multiple
pathways by which to induce macrophage apoptosis. These pathways may be
important in immune processes such as macrophage homeostasis as well as
in down-regulation of immune responses and elimination of
macrophages infected with intracellular
organisms. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
)3 lineage. The
adult human bone marrow produces 10 billion M a day (1, 2). The molecular signals stimulating this massive M
production have been well characterized (3, 4), but the
mechanisms involved in their elimination are incompletely defined.
Numerous mechanisms are likely to contribute to M homeostasis. A
role for IL-4 in inducing M apoptosis has been proposed
(5) as well as a protective effect of TNF-
and IL-1ß
(6, 7). One mechanism potentially contributing to M
elimination is killing by CD4+ T cells. We
reported that the process of CD4+ T cell
activation can result in apoptosis of the stimulating M, and
proposed that this mechanism could be important in M homeostasis as
well as serving to down-regulate immune responses and eliminate M
infected with intracellular organisms (8). We also
reported that a more promiscuous M killing by autoreactive
CD4+ T cells may provide a source of antigenic
nucleic acids in a lupus model (9, 10) and in patients
with active lupus (11, 12), further emphasizing the
importance of this phenomenon. The mechanisms involved in this response
are incompletely defined. Others have proposed that T lymphocytes kill
most target cells through either perforin- or Fas-mediated mechanisms
(13, 14). We subsequently determined that some M
express Fas, and that ligation of M Fas can induce apoptosis
(15). Other reports suggest that Fas is the principle
receptor mediating M killing by cloned Th1 cells (16).
However, D10 cells, a cloned Th2 line, also kill Ag-presenting
syngeneic M (10, 17), but lack Fas ligand (FasL) and
perforin expression (16, 18, 19). This suggests that T
cells express additional mechanisms capable of inducing M
apoptosis.
Our group has examined a number of pathways by which D10 cells might
induce M apoptosis. We report that TNF-related
apoptosis-inducing ligand (TRAIL) (Apo2 ligand) and TNF-like weak
inducer of apoptosis (TWEAK) (Apo3 ligand) death receptor pathways
mediate D10-induced M killing, supporting the concept that T cells
express multiple genes capable of inducing M apoptosis. The
redundancy of the mechanisms mediating this response supports the
contention that this mechanism is important in homeostasis, similar to
other essential pathways.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Six- to eight-week-old female AKR, MRL+/+,
MRL lpr/lpr, and B10.A mice were obtained from The Jackson
Laboratory (Bar Harbor, ME). Peritoneal M were elicited by i.p.
injection of thioglycolate (Becton Dickinson, Cockeysville, MD), and
the cells were recovered 3 days later as previously described
(9). D10.G4.1 (D10), a cloned Th2,
H-2k restricted, conalbumin-reactive Th2 line was
obtained from American Type Culture Collection (Manassas, VA)
and was maintained by repeated restimulation with irradiated
splenocytes and conalbumin (Sigma, St. Louis, MO) and the regular
addition of IL-2 as previously described (10). Because of
a report that the D10.G4.1 cell line may contain an autoreactive subset
(20), the D10 cells were subcloned by limiting dilution at
<0.2 cells/well, and a nonautoreactive subclone was selected for use
in these studies. Cells were studied 6 days after challenge to avoid
interference by irradiated stimulator cells (10). Where
indicated, the cells were stimulated with 1 ng/ml PMA and 1 µg/ml
ionomycin (Sigma). AE7 cells were obtained from Dr. Ronald Schwartz
(21) and cultured by repeated stimulation with syngeneic
(B10.A) irradiated splenocytes and Ag (100 µg/ml pigeon
cytochrome-c, from Sigma), in Clicks medium supplemented
with penicillin/streptomycin and L-glutamine,
10% FBS, 2 mM L-glutamine, 50 µM 2-ME, and
IL-2 (9). CTLL cells were obtained from American Type
Culture Collection and maintained according to the instructions
provided. Where indicated, AKR and B10.A splenocytes were stimulated by
culture for 18 h in flat-bottom 96-well microtiter plates (Costar,
Cambridge, MA) coated with 10 µg/ml anti-CD3 (2C11, PharMingen,
San Diego CA). Alternatively, cells were stimulated with 2 µg/ml of
Con A (Sigma). AKR and B10.A splenocytes were obtained by gently
mincing the spleens through a steel screen, and the collected
splenocytes were washed twice with PBS/5% FBS, then purified by
density gradient centrifugation. Where indicated,
CD4+ cells were enriched by treating the
splenocytes with anti-CD8 and complement (9). This
typically gave 40% CD4+ and 0%
CD8+ cells by flow cytometric analysis. Cell
viability was measured with propidium iodide staining and was >95% in
each cell preparation used. Splenocytes were cultured in RPMI 1640
supplemented with 10% heat-inactivated FBS, 100 U/ml penicillin, 100
µg/ml streptomycin, 10 mM HEPES (pH 7.2), and 2 mM glutamine at
37°C with 5% CO2 in a humidified
atmosphere.
Abs and reagents
Anti-murine CD40, anti-murine CD40 ligand (CD40L), anti-murine FasL, and anti-murine CD3-FITC were obtained from PharMingen; recombinant TNF was obtained from R&D Systems (Minneapolis, MN); and an inhibitory anti-murine TNF was a gift from Dr. Steven Kunkel. Anti-IL-4 was obtained from Endogen (Cambridge, MA), and rIL-4 was purchased from R&D Systems. A murine TRAMP (Apo3)/human IgG1 Fc fusion protein (anti-TWEAK) was a gift from Immunex (Seattle, WA). The S-Hd9c rabbit anti-mouse TRAIL Ab was a gift from Dr. Peter Krammer. MsIg-FITC, human anti-rabbit-FITC, and rat anti-human IgG-FITC were obtained from Coulter (Miami, FL). Anti-FasL was purchased from PharMingen. PHA was obtained from Murex Diagnostics (Norcross, GA).
Flow cytometric analysis
For D10 and AE7 cells, one million cells were incubated for 30 min at 4°C with anti-TWEAK or anti-TRAIL diluted to 5 µg/ml in PBS, washed three times, then incubated for 30 min at 4°C with FITC-conjugated Abs to human or rabbit IgG, respectively. Cells were washed three times, fixed in formaldehyde, and analyzed in a FACScan flow cytometer (Becton Dickinson, Mountain View, CA) using previously described protocols (9, 10). FasL expression was similarly detected using anti-FasL and FITC-conjugated anti-hamster IgG (PharMingen). For splenocytes, the stained cells were washed three times, then incubated with anti-CD3-PE (PharMingen) and analyzed by two-color flow cytometry using published protocols (9, 10). Peritoneal macrophages were similarly stained, then analyzed by gating on the macrophage population as assessed by light scatter. This population contained <1% CD3+ cells as detected by staining with anti-CD3-PE.
Electron microscopy
Transmission electron microscopy of T cells and M was
performed as previously described (8).
Cytotoxicity assays
D10 M killing assays were performed as previously described
(9, 10). Briefly, thioglycolate-elicited peritoneal M
were radiolabeled with 51Cr (New England Nuclear,
Boston, MA) for 1 h. The cells were washed, then 5,000 labeled
M were cultured with 125,000 D10 cells and 100 µg/ml conalbumin in
a total volume of 200 µl of medium lacking IL-2, using round-bottom
microtiter plates. Where indicated, Abs or fusion proteins were added
to the wells. Eighteen hours later chromium release was measured using
a scintillation spectrometer. AE7 killing assays were performed
similarly, except that an E:T cell ratio of 10:1 was used, and the Ag
was pigeon cytochrome c, added at 100 µg/ml. Splenocyte
killing assays were performed by stimulating CD4-enriched splenocytes
with Con A for 72 h, then the cells were washed three times and
cultured with 51Cr-labeled allogeneic peritoneal
M at an E:T cell ratio of 25:1 in medium containing 0.1 M
-methyl-D-mannoside. Cytotoxicity was measured
18 h later as described for D10 and AE7 cells.
Proliferation assays
Proliferation assays were performed as previously described (9, 10). Briefly, 125,000 D10 cells were cultured with 5,000 irradiated AKR splenocytes and 100 µg/ml conalbumin in a total volume of 200 µl, again using IL-2-free medium. Where indicated anti-TWEAK, anti-TRAIL, or a control Ig was added at concentrations identical with those used for the cytotoxicity assays. After 72 h tritiated thymidine (New England Nuclear) was added, and 4 h later cells were harvested, and radioactivity was measured using a scintillation spectrometer.
Northern analysis
Northern analysis was performed as previously described (22, 23). In brief, mRNA was isolated from unstimulated D10 cells, from D10 cells stimulated with PMA and ionomycin, from CTLL cells, or from AKR splenocytes that had been treated with PHA or PMA and ionomycin. The RNA was fractionated by electrophoresis, transferred to nylon membrane, hybridized with a 32P-radiolabeled probe, and developed as an autoradiogram. The probes used included FasL, amplified by RT-PCR from CTLL cells using primers CTTTCCTGGGGCTGGGTGCCATGC and TCCTGTCCTTGACACTTCAGTCTCC and previously described protocols (22, 23). A perforin probe was similarly amplified using primers CGCACTTTATCACGGCTGTGGACCTCGCTG and GTGGGCAGCAGTCCTGGTTGGTGACCTTTG.
Statistical analysis
The difference between means was tested using Student’s t test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
apoptosis
Initial experiments confirmed that D10 cells kill M by
apoptosis. Electron microscopy was used to distinguish apoptosis from
necrosis (8). Fig. 1
a shows two normal,
thioglycolate-stimulated, AKR peritoneal M cultured alone for
18 h. The M have prominent vacuolar inclusions due to the
thioglycolate. Fig. 1b shows a T cell adherent to a M,
with what appears to be early nuclear condensation, in cultures of AKR
M, D10 cells, and conalbumin. Fig. 1, c and d,
shows representative electron micrographs of AKR M similarly
cultured with D10 cells and conalbumin, showing typical nuclear
condensation with preservation of cytoplasmic structures. These changes
are typical of apoptosis. To exclude the possibility that the apoptotic
M observed represent spontaneous apoptosis of the M, low power
electron micrographs of the entire cell pellet were made, and the
percentage of apoptotic M was determined by visual inspection. For
each determination, five fields were examined, and the percentage of
apoptotic M in 100 total M was determined. In cultures of M
without D10 cells, 8 ± 1% of the M were apoptotic, while
cultures of M with D10 cells and Ag contained 40 ± 3%
apoptotic cells (p < 0.001).
|
,
evidence for perforin and FasL expression was sought to exclude the
possibility that this D10 subclone differed from those previously
reported. Northern analysis was used to demonstrate that splenocytes
treated with PMA and ionomycin express FasL mRNA, but that D10 cells
and D10 cells similarly treated with PHA do not (not shown). Similarly,
flow cytometric analysis demonstrated that stimulated splenocytes
expressed FasL (typically 15–25% positive; see Fig. 7), while D10
cells did not (MCF 0.325 vs 0.431, FasL vs isotype control staining of
D10 cells). In similar experiments using Northern analysis and CTLL
cells as positive controls, we were also unable to induce perforin
expression in D10 cells (not shown). These results confirm previous
studies with D10 cells (16, 18, 19).
|
killing, we used MRL lpr/lpr peritoneal M. This
strain is derived from the MRL+/+ strain, but has
a retroviral insertion in the Fas gene, resulting in a nonfunctional
transcript (24). Importantly, the MRL strains are also
H-2k, similar to the D10 cells (25).
Varying numbers of D10 cells were cultured with 5,000
51Cr-labeled AKR, MRL+/+,
or MRL lpr/lpr M (Fig. 2).
The D10 cells lysed AKR and MRL lpr/lpr M equally well.
Lysis of the MRL+/+ M was somewhat less
efficient, but maximum lysis was as great as that seen with AKR and
lpr/lpr target cells. This argues that M Fas is not
required for D10-mediated M killing.
|
apoptosis
These results prompted studies of other mechanisms proposed for
apoptosis. Because D10 cells secrete IL-4 (10), and this
cytokine has been implicated in inducing M apoptosis
(5), 0.01–1.0 ng/ml IL-4 was added to AKR M cultures
for 18 h. No cytotoxicity was observed (1 ± 1.2% chromium
release above background, using 1 ng/ml IL-4). In addition, no
significant inhibition was seen when 0.25–25 µg/ml neutralizing
anti-IL-4 was added to cultures of D10 cells, M, and Ag (maximum
specific killing, 41 ± 1.8% in the presence of 25 µg/ml
anti-IL-4 vs 56 ± 8% killing in controls
(p > 0.05), with less inhibition at lower
concentrations). This argues against a prominent role for IL-4 in this
response. In B cells, CD40-CD40L interactions protect from apoptosis
(26), so it was possible that a lack of CD40L expression
on D10 cells could increase apoptosis. However, flow cytometric
analysis demonstrated that D10 expressed CD40L (MCF 5.45 vs 0.56
anti-CD40L vs control, 79.4% positive).
Role of TWEAK and TRAIL in D10-induced M apoptosis
More recently, two newly identified molecules have been implicated
in triggering apoptosis. These include TRAIL, which interacts with
molecules including Apo2 (27, 28, 29, 30, 31), and TWEAK, which
interacts with Apo3 (32, 33). TRAIL was detected using a
rabbit anti-mouse TRAIL antisera, while TWEAK was detected using a
TRAMP (Apo3)/human IgG1 Fc fusion protein. Fig. 3, a and b, shows
flow cytometric histograms demonstrating that D10 cells express both
TWEAK and TRAIL.
|
apoptosis was due to TWEAK
and/or TRAIL interactions. Graded amounts of the anti-TRAIL or the
Apo3 fusion protein (anti-TWEAK) were added to cultures of AKR
peritoneal M, D10 cells, and conalbumin. Fig. 4a demonstrates that both
inhibited killing, but anti-TRAIL was somewhat more potent under
the conditions used. Concentrations of anti-FasL equal to the
highest tested concentrations of anti-TWEAK had no significant
inhibitory effect (24 ± 14.8% inhibition, mean ± SEM of
three independent experiments, each performed in quadruplicate). The
possibility that anti-TWEAK or anti-TRAIL inhibited D10 killing
through a toxic effect on the D10 cells was excluded by propidium
iodide staining. Control D10 cells were 21% propidium iodide positive,
while cells incubated with anti-TWEAK and anti-TRAIL ranged
from 19–23% propidium iodide positive. Since we had previously
reported that inhibiting T cell activation with mAb to molecules such
as LFA-1 or class II MHC also prevents M killing (8),
it was important to exclude the possibility that the anti-TWEAK and
TRAIL reagents were inhibiting T cell activation. Using conditions
similar to the cytotoxicity assay, anti-TWEAK had no effect on D10
activation, while anti-TRAIL had an inhibitory effect that was
smaller in magnitude than the effect on killing (Fig. 4b).
|
). This
argues against steric hindrance.
|
apoptosis
These results indicate that TWEAK and TRAIL can participate in
D10-induced M apoptosis. However, FasL can also mediate M
apoptosis (16), so it was of interest to compare the
relative contributions of these three molecules in macrophage killing
by CD4+ T cells. AE7 cells were used for these
studies, because they have been reported to delete macrophages through
a Fas-dependent pathway (16). Fig. 6A compares the relative
expressions of FasL, TWEAK, and TRAIL on AE7 cells. All three molecules
are expressed. Fig. 6B compares the inhibitory effects of
Abs to each of these molecules. As was seen for D10 cells, both
anti-TWEAK and anti-TRAIL inhibit M killing. In addition,
anti-FasL inhibits at concentrations similar to those of
anti-TWEAK.
|
apoptosis were also
compared using splenic T cells. Splenocytes were stimulated for 18
h with anti-CD3 immobilized on flat-bottom tissue culture plates,
then stained with anti-CD3-PE and anti-TWEAK, anti- TRAIL,
or anti-FasL as before. Fig. 7
,
A–C, shows that TWEAK, TRAIL, and FasL are expressed on
unstimulated CD3+ cells, and expression increases
following stimulation. The effects of anti-TWEAK, anti-TRAIL,
and anti-FasL on splenocyte killing of allogeneic macrophages were
then tested. Con A-stimulated, CD8-depleted splenocytes from B10.A mice
(H-2a) were cultured with
51Cr-labeled AKR (H-2k)
peritoneal M and the same concentrations of anti-TRAIL,
anti-TWEAK, and anti-FasL as those given in Fig. 6. Again, all
three proteins inhibited M killing (Fig. 7D), supporting
a role for these molecules in inducing M apoptosis.
Expression of TRAIL, TWEAK, and FasL on peritoneal M
Finally, the possibility that M express TWEAK and TRAIL was
explored. AKR peritoneal M were stained with anti-TRAIL,
anti-TWEAK, and anti-FasL as before and were analyzed by flow
cytometry. TRAIL was expressed on 24.9 ± 8.2% of the M, while
TWEAK was expressed on 63.6 ± 3.8% and FasL on 14.8 ±
4.0% (mean ± SEM of three independent experiments relative to
negatively staining controls).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
death response, which commonly occurs after
CD4+ T cell clones are stimulated by
Ag-presenting M. Using human cells, we reported that optimal
induction of apoptosis requires physical contact between T cells and
M and could not be induced by soluble mediators released from the T
cells (8), although we were unable to exclude the
possibility that locally high concentrations of a secreted molecule
acted at close range. Additional studies demonstrated that
cross-linking specific M surface molecules, including class I and II
MHC, ICAM-1 (CD54), LFA-1 (CD11a/CD18), and LFA-3 (CD58), alone or in
combination, was similarly ineffective (8). Others have
since reported that M killing by Th1 T cell clones is largely
mediated through Fas-FasL interactions (16). However, D10
cells, which lack FasL expression (16, 18, 19), are also
capable of killing syngeneic Ag-presenting M (10, 17).
Similarly, others have reported that polyclonal CTLs deficient in both
FasL and perforin have residual cytolytic activity (34),
and that FasL and perforin/granzyme mechanisms account for 40% of
the total cytotoxicity of CD4+ CTLs
(35). TNF has been implicated in inducing apoptosis in
some systems and inhibiting it in others (35, 36, 37).
However, neither addition of TNF nor inhibition with neutralizing Abs
had any effect on D10 killing of M (our unpublished observations).
Together, these observations indicate the existence of additional
cytotoxic mechanisms.
The present studies demonstrate that D10 cells as well as AE7 and
freshly isolated murine T cells express TWEAK and TRAIL, and that these
molecules participate in M apoptosis. TRAIL is a TNF family member
that activates apoptosis and binds to death receptor 4 (DR4) and DR5
(27, 28, 29, 30, 31). DR5 is also referred to as Apo2
(38). TRAIL mRNA is also expressed in PBMC, spleen,
thymus, prostate, ovary, small intestine, colon, and placenta, but
not in brain, liver, or testis (27). TRAIL has been
found to be involved in the activation-induced death of Jurkat and
human peripheral blood T cells (39) and to induce
apoptosis in Fas ligand-resistant melanoma cells (28).
TRAIL also mediates CD4 T cell killing of target cancer cells
(35). Others have suggested that TRAIL primarily
participates in the killing of transformed cells (31). Our
results suggest a homeostatic role for this molecule as well.
TWEAK is a recently described, 249-amino acid, type II transmembrane
protein, whose extracellular sequence shows highest identity to that of
TNF. It is expressed on a majority of adult and fetal tissues
(32, 33). TWEAK binds Apo3, which is also referred to as
DR3, WSL-1, TRAMP, or LARD (33, 40). Significantly, Apo3
expression appears to be restricted to lymphocyte-rich tissues such as
PBMC and spleen (40, 41, 42, 43, 44). Soluble TWEAK has been reported
to induce apoptosis and NF-
B activation in human cell lines
(41), and caspase inhibitors can block apoptosis induction
by TWEAK (32). TWEAK has overlapping signaling functions
with TNF. However, TWEAK is generally less effective in inducing
apoptosis than other molecules, giving rise to its name, TNF-like weak
inducer of apoptosis (32).
Proteins binding both molecules appear to inhibit the apoptotic
response, and at high concentrations both completely inhibit this
response in D10 cells. Trivial explanations, such as a toxic effect,
were excluded. The inhibition is not due to blocking T cell activation,
because concentrations of the inhibitors that blocked killing had
lesser effects on T cell proliferative responses. Similar inhibition
experiments performed using AE7 cells, a cloned Th1 line that expresses
FasL, TWEAK, and TRAIL, as well as CD4-enriched splenocytes
demonstrated that proteins binding all three molecules similarly
inhibit killing by >80%. These results suggest that TWEAK and TRAIL
are excellent candidates for the molecules mediating D10 killing of
Ag-presenting syngeneic M. The reason for nearly complete inhibition
by each inhibitor is uncertain, but possibilities include a steric
inhibition not detected by the competitive inhibition approach used, or
that signals generated by binding any one of these molecules on the T
cell surface inhibit the ability of the other molecules to deliver an
apoptotic signal. Future studies will examine these possibilities.
These results also raise the possibility that TWEAK and TRAIL may be
responsible for the residual cytotoxic activity observed in other
CD4+ CTLs (34, 35).
These studies may be important for M homeostasis. As noted
previously (8), the human bone marrow generates 7 x
106 monocytes/kg body weight/h (1, 2). Because M can be long-lived, mechanisms for their
elimination are necessary. It is also possible that killing of
Ag-presenting M by CD4+ T cells serves to
down-regulate immune responses by eliminating the APC. This would
suggest that a constant supply of both Ag and APC is required to
maintain an immune response. Finally, M killing may be necessary to
eliminate cells infected with intracellular parasites. It is relevant
to note that mice lacking both perforin and FasL develop an autoimmune
disease with largely lymphocytic mononuclear cell infiltration of the
pancreas and uterus (45). This suggests that TWEAK and
TRAIL are insufficient to compensate for loss of perforin and FasL in
the homeostasis of lymphocytes. However, analysis of the lymphoid and
other tissues of these mice does not demonstrate an increase in
monocytes/macrophages, further suggesting that TWEAK and TRAIL are able
to compensate for macrophage homeostasis.
These results may also be important for the development of
autoantibodies in at least one animal model of lupus and possibly
idiopathic human systemic lupus erythematosus. D10 cells overexpressing
LFA-1 become autoreactive and respond to syngeneic M without
conalbumin, promiscuously killing M in vitro (17). The
same cells induce anti-DNA Abs in vivo (17),
suggesting that this killing might contribute to the autoantibody
response by providing a source of antigenic DNA. In support of this,
patients with idiopathic systemic lupus erythematosus have increased
numbers of circulating apoptotic monocytes (11), which may
serve a similar function. Now that candidates for the responsible
molecules have been identified, it is possible to test whether
inhibiting D10-mediated M killing in vivo prevents the development
of autoantibodies.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Bruce Richardson, 5310 Cancer Center and Geriatrics Center Building, Ann Arbor, MI 48109-0940 E-mail address:
3 Abbreviations used in this paper: M, macrophage; FasL, Fas ligand; CD40L, CD40 ligand; DR, death receptor; TRAIL, TNF-related apoptosis-inducing ligand; TWEAK, TNF-like weak inducer of apoptosis.
Received for publication June 29, 1999. Accepted for publication January 3, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, and IL-1ß prevent programmed cell death (apoptosis) in human peripheral blood monocytes. J. Immunol. 146:1541.[Abstract]
B. Curr. Biol. 6:1669.[Medline]
This article has been cited by other articles:
|
|
 |
|
  M. Razmara, B. Hilliard, A. K. Ziarani, R. Murali, S. Yellayi, M. Ghazanfar, Y. H. Chen, and M. L. Tykocinski Fn14-TRAIL, a Chimeric Intercellular Signal Exchanger, Attenuates Experimental Autoimmune Encephalomyelitis Am. J. Pathol., February 1, 2009; 174(2): 460 - 474. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Rus, V. Nguyen, R. Puliaev, I. Puliaeva, V. Zernetkina, I. Luzina, J. C. Papadimitriou, and C. S. Via T Cell TRAIL Promotes Murine Lupus by Sustaining Effector CD4 Th Cell Numbers and by Inhibiting CD8 CTL Activity J. Immunol., March 15, 2007; 178(6): 3962 - 3972. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Secchiero, R. Candido, F. Corallini, S. Zacchigna, B. Toffoli, E. Rimondi, B. Fabris, M. Giacca, and G. Zauli Systemic Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Delivery Shows Antiatherosclerotic Activity in Apolipoprotein E-Null Diabetic Mice Circulation, October 3, 2006; 114(14): 1522 - 1530. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. F. H. M. Boonman, L. R. H. M. Schurmans, N. van Rooijen, C. J. M. Melief, R. E. M. Toes, and M. J. Jager Macrophages are vital in spontaneous intraocular tumor eradication. Invest. Ophthalmol. Vis. Sci., July 1, 2006; 47(7): 2959 - 2965. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Ishikawa, M. Nakazawa, M. Yoshinari, and M. Minami Role of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand in Immune Response to Influenza Virus Infection in Mice J. Virol., June 15, 2005; 79(12): 7658 - 7663. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-H. Chou, H.-F. Tsai, Y.-Y. Wu, C.-Y. Hu, L.-H. Hwang, P.-I. Hsu, and P.-N. Hsu Hepatitis C Virus Core Protein Modulates TRAIL-Mediated Apoptosis by Enhancing Bid Cleavage and Activation of Mitochondria Apoptosis Signaling Pathway J. Immunol., February 15, 2005; 174(4): 2160 - 2166. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Bergeron, M. Beauchemin, and R. Bertrand Camptothecin- and etoposide-induced apoptosis in human leukemia cells is independent of cell death receptor-3 and -4 aggregation but accelerates tumor necrosis factor-related apoptosis-inducing ligand-mediated cell death Mol. Cancer Ther., December 1, 2004; 3(12): 1659 - 1669. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wang, Z. F. H. M. Boonman, H.-C. Li, Y. He, M. J. Jager, R. E. M. Toes, and J. Y. Niederkorn Role of TRAIL and IFN-{gamma} in CD4+ T Cell-Dependent Tumor Rejection in the Anterior Chamber of the Eye J. Immunol., September 15, 2003; 171(6): 2789 - 2796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lonergan, D. Aponso, K. W. Marvin, R. J. A. Helliwell, T. A. Sato, M. D. Mitchell, T. Chaiwaropongsa, R. Romero, and J. A. Keelan Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL), TRAIL Receptors, and the Soluble Receptor Osteoprotegerin in Human Gestational Membranes and Amniotic Fluid during Pregnancy and Labor at Term and Preterm J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3835 - 3844. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q.-S. Mi, D. Ly, S.-E. Lamhamedi-Cherradi, K. V. Salojin, L. Zhou, M. Grattan, C. Meagher, P. Zucker, Y. H. Chen, J. Nagle, et al. Blockade of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Exacerbates Type 1 Diabetes in NOD Mice Diabetes, August 1, 2003; 52(8): 1967 - 1975. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R.-R. Mo, J. K. Eisenbraun, J. Sonstein, R. A. Craig, J. L. Curtis, L. M. Stoolman, J. Chen, and R. L. Yung CD49d Overexpression and T Cell Autoimmunity J. Immunol., July 15, 2003; 171(2): 745 - 753. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Kaplan, E. E. Lewis, E. A. Shelden, E. Somers, R. Pavlic, W. J. McCune, and B. C. Richardson The Apoptotic Ligands TRAIL, TWEAK, and Fas Ligand Mediate Monocyte Death Induced by Autologous Lupus T Cells J. Immunol., November 15, 2002; 169(10): 6020 - 6029. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Le Roy, M. Baron, W. Faigle, D. Clement, D. M. Lewinsohn, D. N. Streblow, J. A. Nelson, S. Amigorena, and J.-L. Davignon Infection of APC by Human Cytomegalovirus Controlled Through Recognition of Endogenous Nuclear Immediate Early Protein 1 by Specific CD4+ T Lymphocytes J. Immunol., August 1, 2002; 169(3): 1293 - 1301. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M. Baetu, H. Kwon, S. Sharma, N. Grandvaux, and J. Hiscott Disruption of NF-{kappa}B Signaling Reveals a Novel Role for NF-{kappa}B in the Regulation of TNF-Related Apoptosis-Inducing Ligand Expression J. Immunol., September 15, 2001; 167(6): 3164 - 3173. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R Yung, M Kaplan, D Ray, K Schneider, R-R Mo, K Johnson, and B Richardson Autoreactive murine Th1 and Th2 cells kill syngeneic macrophages and induce autoantibodies Lupus, August 1, 2001; 10(8): 539 - 546. [Abstract] [PDF]
|
|
|
|
|
|
M. L. Jelachich and H. L. Lipton Theiler's Murine Encephalomyelitis Virus Induces Apoptosis in Gamma Interferon-Activated M1 Differentiated Myelomonocytic Cells through a Mechanism Involving Tumor Necrosis Factor Alpha (TNF-{alpha}) and TNF-{alpha}-Related Apoptosis-Inducing Ligand J. Virol., July 1, 2001; 75(13): 5930 - 5938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kuhlmann, A. Bitsch, C. Stadelmann, H. Siebert, and W. Bruck Macrophages Are Eliminated from the Injured Peripheral Nerve via Local Apoptosis and Circulation to Regional Lymph Nodes and the Spleen J. Neurosci., May 15, 2001; 21(10): 3401 - 3408. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Nakayama, N. Kayagaki, N. Yamaguchi, K. Okumura, and H. Yagita Involvement of Tweak in Interferon {gamma}-Stimulated Monocyte Cytotoxicity J. Exp. Med., November 6, 2000; 192(9): 1373 - 1380. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
