The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Colombo, M.
Right arrow Articles by Ferrarini, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Colombo, M.
Right arrow Articles by Ferrarini, M.
The Journal of Immunology, 2000, 164: 2782-2789.
Copyright © 2000 by The American Association of Immunologists

Accumulation of Clonally Related B Lymphocytes in the Cerebrospinal Fluid of Multiple Sclerosis Patients1

Monica Colombo*,{dagger}, Mariella Dono*, Paola Gazzola{ddagger}, Silvio Roncella*, Angelo Valetto, Nicholas Chiorazzi, Giovanni L. Mancardi{ddagger} and Manlio Ferrarini2,*,||

* Servizio di Immunologia Clinica, Istituto Nazionale per la Ricerca sul Cancro, Genova, Italy; {dagger} Istituto di Medicina Interna, Università degli Studi di Milano, Milan, Italy; {ddagger} Dipartimento di Scienze Neurologiche e della Visione, Università degli Studi di Genova, Genova, Italy; § Divisione di Anatomia Patologica, Ospedale Sant’Andrea, 19100 La Spezia, Italy; Department of Medicine, North Shore University Hospital and New York University School of Medicine, Manhasset, New York, NY 77030; and || Dipartimento di Oncologia, Biologia e Genetica, Università degli Studi di Genova, Genova, Italy


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The accumulation of B lymphocyte clones in the cerebrospinal fluid (CSF) of patients with multiple sclerosis (MS) and patients with other neurological disorders was investigated using PCR technologies. Oligoclonal B cell accumulations were detected in 10 of 10 MS patients, but only in 3 of 10 of the patients with other neurological disorders. Analyses of the Ig V(D)J sequences on the CSF from MS patients disclosed that VH3 and VH4 genes were extensively mutated compared with germline sequences. Moreover, a substantial proportion of the molecular clones analyzed shared the same third CDR of the H chain variable region gene (HCDR3) and the same VH genes, albeit with different numbers and locations of point mutations, thus indicating an ongoing process of intraclonal diversification. A larger number of clonally related VH sequences could be obtained by using a VH3 gene-specific PCR so that genealogical trees depicting the process of diversification could be drawn. Analyses of the Ig V(D)J from the CSF of a patient with viral meningitis and oligoclonal B cell accumulations revealed that VH3 genes were extensively mutated. However, no intraclonal diversification could be observed even using VH3 gene-specific PCR methodologies. Clone-specific PCR and sequencing was used to detect the V(D)J found in the CSF of one MS patient in the PBL of the same patient. Only 1/3 of the V(D)J sequences investigated could be demonstrated in the PBL, indicating that the V(D)J genes utilized by B cells in the CSF are much less represented in the PBL. Collectively, the data suggest that in MS there is a compartmentalized clonal expansion.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Multiple sclerosis (MS)3 is a chronic demyelinating disease of the CNS for which two alternative etiological explanations are traditionally offered (1, 2). One postulates that an infection by a virus or by another pathogen results in the recruitment of inflammatory cells within the CNS; such inflammatory reactions may eventually contribute to the onset of autoimmunity. The other proposes that the disease is initiated by an autoimmune reaction primarily directed toward myelin Ags.

The inflammatory infiltrates of MS are comprised of T cells, macrophages, and B cells. It is generally assumed that T cells play a pivotal role in initiating the inflammatory lesions, as indicated by studies on experimental animal models, especially experimental autoimmune encephalomyelitis (3, 4, 5). However, the production of autoantibodies, particularly those reactive with myelin, has relevance since they can contribute to the process of demyelinization (6, 7, 8, 9). The involvement of B cells in MS is suggested by a number of observations. For example, the cerebrospinal fluid (CSF) of MS patients is characterized by the presence of Ig molecules with restricted isoelectric focusing (IEF) mobility (10). These bands are not usually detected in the plasma and there is evidence indicating that they are produced intrathecally (11, 12, 13). Moreover, micromethods indicate that B cells producing anti-myelin Abs exist in the CSF of MS patients (14, 15, 16). However, the number of B cells present in the CSF is too low to permit studies with the classical methods of cellular immunology (17, 18).

The advent of PCR methodologies and the recent understanding of the control of Ig VH and VL gene assembly in B cells have made it possible to collect information on the developmental and maturational history of B cells by studying their Ig V region genes. During a T cell-dependent response, B cells accumulate point mutations in their VH and VL genes and B cells expressing those V gene variants that lead to increased affinity for the stimulating Ag are selected for survival and clonal expansion (19). This selection takes place mainly, but not necessarily (20, 21, 22), in the germinal centers of the lymphoid organs (19). Moreover, among these stimulated and Ag-selected B cells, there may be a predominance of B cells that are the progeny of a single precursor and share the same rearranged VH or VL gene, albeit with different numbers and distributions of point mutations. Thus, the accumulation of point mutations in clonally related V gene sequences within a given B cell population can be used as a marker of an ongoing response to stimulating Ag(s). By using PCR methodology and the above-illustrated criteria, we have collected evidence for an ongoing B cell response in the CSF of MS.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients

CSF and PBMC samples were obtained from each of 10 MS patients and 10 patients with other neurological disorders (OND). The MS patients, with clinically or laboratory-supported definite MS diagnosis, were categorized according to clinical course as having either relapsing-remitting (RR, patient 1A and patients 4A-10A, see Table IGo) or secondary progressive disease (SP, patients 2A and 3A, Table IGo). All cases were free of immunosuppressive treatment and had not received steroid therapy in the 6 mo preceding lumbar puncture. CSF examination was conducted for diagnostic purposes or during exacerbation of neurological symptoms, and each patient gave informed consent to perform the procedure. The OND patients included a variety of nondemyelineating disorders as indicated in Table IIGo.


View this table:
[in this window]
[in a new window]
 
Table I. Major features of the MS patients

 

View this table:
[in this window]
[in a new window]
 
Table II. Major features of the OND patients

 
PCR methodologies

Total RNA was extracted from either CSF cells (range, 1.3 x 104–2.5 x 105 cells, see Tables I and II) or PBMC (2.5 x 104x 106) using RNA-Clean System (TB Molbiol, Berlin, Germany) and was reverse transcribed for first cDNA synthesis as detailed (23).

Genomic DNA was purified from either CSF cells or PBMC by cell lysis followed by digestion with proteinase K, "salting out" extraction, and precipitation by ethanol (24).

PCR amplification and cloning of rearranged Ig V genes have been described previously (25). Briefly, first-strand cDNA (1–5 µl) was amplified using sense IgVH gene family-specific primers: VH1, 5'-GGAATTCATGGACTGGACCTGGAGGGTCTTCT; VH2, 5'-GGAATTCATGGACATACTTTGTTCCACGCTCC; VH3, 5'-GAGTTTGGGCTGAGCTGGGACTTTT; VH4, 5'-ATGAAACACCTGTGGTTCTTCCTCC; VH5, 5'-GGCTGTTCTCCAAGGAGTC; and VH6, 5'-GGAATTCATGTCTGTCTCCTTCCTCATCTTCC and antisense CH constant region primers: µ, 5'-CAAGCTTAAGGAAGTCCTGTGCGAG; {gamma}, 5'-GTAGGACAGC(CT)GGGAAGGTGTGCAC, and {alpha}, 5'-CCAAGCTTGAGGCTCAGCGGGAAGACCTT in independent reactions. PCR was performed for 35–45 cycles under standard conditions (25). In some experiments, a VH3-30 (5'-GGGTTTTCCTCGTTGCTCTTTT) gene-specific primer was used; this strategy allows the amplification of VH3-30, VH3-30.3, and VH3-33 genes only.

When genomic DNA was used as template, a first amplification was conducted with the VH family-specific and a mixture of antisense JH-specific primers: JHA, CTGAGGAGACGGTGACCAGGGT; JHB, CTGAGGAGACAGTGACCAGGGT; JHC, CTGAGGAGACGGTGACCGTGGT; and JHD CTGATGAGACGGTGACCATTGT.

To analyze the third complementarity-determining region (CDR) of the H chain variable region gene (HCDR3) lengths, the first PCR products were reamplified using two nested consensus primers, a sense framework region (FR) 3 and an antisense JH primer (23), and the products were electrophoresed through a 7.5% acrylamide gel and the bands were visualized by a silver staining protocol (Promega, Madison, WI).

PCR specific for clonal sequences

In selected experiments, a strategy was applied to search for a particular V(D)J rearrangement. Primers specific for the CDR2 region of clone 1A-3G7 (5'-TTTCACCTGTCGGCAACG), for the CDR3 region of clone 1A-4G21 (5'-CAGAGGGGGTGGAAGT), and for the CDR3 region of clone 1A-4G29 (5'-GGACTGACTGGGAATGT) were designed. These primers were used in conjunction with the JH primer in nested PCR and their products were electrophoresed as described above.

cDNA sequencing

First PCR products were purified (Advantage PCR Pure kit; Clontech Laboratories, Palo Alto, CA), and cloned into TOPO TA vector (Invitrogen, Carlsbad, CA), processed using Wizard minipreps (Promega), and sequenced. Sequences were compared with those in the V BASE sequence directory (26) using the MacVector software version 6.0.1 (Eastern Kodak, New Haven, CT). The D segments were assigned to the appropriate family according to the criteria of Klein et al. (27). The intrinsic TAQ error in our system was 0.15%. Sequences are deposited in European Molecular Biology Laboratory (EMBL) under the accession numbers (AJ245201–AJ245361).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Oligoclonal expansions of B cells in the CSF from MS patients

PCR analysis of HCDR3 segments was conducted on the CSF cells from 10 patients with MS using primers specific for the VH and CH (µ, {gamma}, and {alpha}) genes of Ig molecules. Restricted and dominant (oligoclonal) HCDR3 lengths were identified in all of the CSF samples with each of the VH family-specific primers, but they were more numerous within the VH3 or VH4 gene families. Oligoclonal HCDR3 lengths also were detected in the DNA preparations of the same CSF samples, thus excluding that the oligoclonal pattern observed was related to the presence of activated B cells or plasma cells that are enriched in homogeneous RNA. In contrast, only 3 of 10 patients with OND displayed oligoclonal HCDR3 bands. Notably, these three patients had viral encephalitis (patients 6B and 10B, see Table IIGo) or postinfection radiculitis (patient 8B, Table IIGo). Oligoclonal HCDR3 bands were not observed by PCR using cDNA prepared from the PBMC of MS patients or controls (Tables I and II and Fig. 1Go).



View larger version (65K):
[in this window]
[in a new window]
 
FIGURE 1. PCR analysis of HCDR3 length in CSF cells and in PBMC from MS patients. This 7.5% acrylamide gel shows the relative lengths of the VH3 and VH4 CDR3 cDNA (A) and DNA (B) from the CSF and PBMC of an MS patient (patient 10A). The cDNA was amplified using VH3 and VH4 primers along with µ-, {gamma}-, and {alpha}-specific primers; the PCR on the DNA was performed by using VH3- or VH4-specific primers and JH primers.

 
Somatic mutations in the VH3 and VH4 genes from the CSF of two MS patients

VH3 and VH4 {gamma} cDNA clones from the CSF of patient 1A (n = 20) and patient 2A (n = 22) were sequenced (Table IIIGo). In patient 1A, certain VH3 or VH4 genes were predominantly expressed (Table IIIGo). Some of the molecular clones were identical, whereas others, such as clones 1A-3G1, 1A-3G4, and 1A-3G8 were related (i.e., they shared the same HCDR3 and differed for a number of point mutations in the VH gene). In patient 2A, the expansion of VH3 and VH4 sequences was more heterogeneous, although there were two molecular clones (2A-3G22, 2A-3G26) that carried the same VH3 gene and shared HCDR3-related sequences. In both patients, the VH3 and VH4 genes analyzed displayed deviations from the germline genes. In patient 1A, these differences ranged from a minimum of 4.1% to a maximum of 15% (average, 9.2%), and, in patient 2A, these differences were between 1.1 and 10.5% (average, 5.6%).


View this table:
[in this window]
[in a new window]
 
Table III. Molecular genetic characteristics of the VH3 and VH4 genes in {gamma} cDNA from two MS patients1

 
Clonally related VH3 sequences in the CSF of MS patients

Among the cDNA clones that shared the same HCDR3 sequence, the VH3 or VH4 genes were either identical or differed by a few mutations, indicating an ongoing process of intraclonal diversification. To analyze larger numbers of related clones, we designed a strategy of PCR amplification in which primers specific for the VH3-30 and VH3-30.3 genes were employed in conjunction with {gamma}-chain-specific primers. These primers also could amplify the VH3-33 gene. With this method, we isolated 15 of 15 molecular clones from patient 1A that carried the VH3-30.3 gene and 15 of 15 clones from patient 2A carrying the VH3-30 gene. Thus, despite some degeneracy of the VH3-30 primers, only molecular clones that harbored the rearranged VH3-30.3 (for patient 1A) and VH3-30 (for patient 2A) genes most commonly represented in the samples analyzed above were isolated. In patient 1A, 15 of 15 of these molecular clones shared identical or related HCDR3 sequences, whereas 10 of 15 clones from patient 2A had related HCDR3. Fig. 2Go reports the all of the clonally related sequences detected in the two patients with the two different primers (i.e., VH3 and VH3-30-specific primers). These findings allowed us to depict possible patterns of evolution of each group of related clones (Fig. 3Go). Notably, mutations of certain codons were repeatedly observed during clonal evolution (see, for example, the replacement Val->Ala at codon 2 in clones 2A-3G1.4, 2A-3G1.14, 2A-3G1.20, 2A-3G12, and 2A-3G1.22 or Gln->Tyr at codon 82 of clones 2A-3G1.13, 2A-3G1.20, 2A-3G1.12, and 2A-3G1.16).



View larger version (73K):
[in this window]
[in a new window]
 
FIGURE 2. Intraclonal diversification of {gamma} VH3 transcripts in the CSF from two MS patients. Clonally related sequences from patients 1A and 2A amplified with VH3 or VH3-30 primers were pooled, aligned, and compared with the most homologous germline VH3 sequences (VH3-30.3 for patient 1A and VH3-30 for patient 2A, respectively). The dots denote germline identity. Capital and lower case letters represent replacement and silent mutations, respectively.

 


View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 3. Patterns of clonal evolution in MS. The diversification of two clones, one from patient 1A and one from patient 2A, respectively, is depicted. The clone from patient 1A expressed the VH3-30.3 gene and that from patient 2A the VH3-30 gene. ? indicates all hypothetical intermediate sequences. *Ancestor gene differing from the germline gene by 39 substitutions (patient 1A) or 4 substitutions (patient 2A). Numbers beside the arrows refer to the amino acid residues where the mutations are found.

 
In a subsequent experiment, cDNA from patients 1A and 2A were PCR amplified with the same VH3-30 primers employed above in conjunction with a µ-chain-specific primer. Twenty molecular clones from patient 1A and 19 from patient 2A were sequenced. None of the clones detected was related to those observed in the {gamma} cDNA since they constantly differed in the HCDR3 sequences. However, in both patients, there were groups of clonally related sequences (one group of two clones from patient 1A, four groups of two clones each from patient 2A) as determined by the HCDR3 identity and the expression of the same VH3 gene with different patterns of mutations (data not shown; the sequences are available in the EMBL database, accession numbers AJ245273–AJ245311).

Search for the presence in PBMC of the same {gamma} cDNA detected in the CSF cells

In this study, we investigated whether a particular V(D)J sequence (clone 1A-3G7) detected in the {gamma} cDNA from the CSF of patient 1A could also be found in PBMC of the same individual. To this end, two different approaches were used. First, the {gamma} cDNA from PBMC of patient 1A was PCR amplified by using the VH3-30-specific primer. Among the 20 molecular clones sequenced, none was found to be related to the VH3-30-carrying molecular clones expanded in the CSF of the same patient (data not shown). Second, the V(D)J segment characteristic of the clone (1A-3G7) was amplified from PBMC of the same patient by using a nested PCR methodology. With this method, the first PCR product was reamplified using clone-specific primers (see Fig. 4Go). As shown in Fig. 4Go, a distinct band (lane 3) was observed by acrylamide gel electrophoresis in the PBMC of patient 1A, which comigrated with both the PCR product of the clone 1A-3G7 and with the PCR product amplified from the CSF of patient 1A (lanes 1 and 2). Conversely, no bands were observed in the PBMC or CSF of an unrelated patient amplified as described (Fig. 4Go, lanes 4 and 5). The sequence of the band detected on the PBMC of patient 1A proved to be identical to clone 1A-3G1 (data not shown). The same methodology was employed to search for the sequence of clones 1A-4G21 and 1A-4G29 from the CSF of patient 1A in the PBMC of the same patient. In both cases, no obvious bands were detected. Collectively, these data demonstrate an imbalanced expression of B cell clones between CSF and PBL.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 4. Detection of a V(D)J sequence characteristic of CSF cells in PBMC of patient 1A. A, Schematic diagram showing the PCR procedure used for the search of the V(D)J sequence characteristic clone 1A-3G7 found in the CSF cells of patient 1A. Total cDNA was amplified first using VH3- and {gamma}-specific primers and then reamplified by using clone-specific CDR2 and JH primers. B, 7.5% acrylamide gel electrophoresis analysis of amplified V(D)J cDNA. Lane 1, molecular clone 1A-3G7 isolated from the CSF of patient 1A; lane 2, CSF of patient 1A; lane 3, PBMC of patient 1A; lanes 4 and 5, CSF and PBMC, respectively, of an unrelated patient (patient 8A).

 
Analyses of VH3 {gamma} cDNA from the CSF of an OND patient

In these studies, the VH3 {gamma} transcripts from the CSF of an OND patient (10B) that displayed oligoclonal PCR bands (Table IIGo) were sequenced. All of the VH3 genes (n = 16) analyzed showed significant deviations from the germline (average mutation frequency, 7.1%). Among the sequences, there were four groups, of two clones each, that contained repeated sequences (i.e., identical HCDR3 and identical pattern of mutations on the VH gene). One group of these clones carried the VH3-30 and another the VH3-33 gene (Table IVGo). Therefore, to determine whether intraclonal diversity had developed among these clones, we employed the same strategy of amplification with VH3-30-specific primers used above. Fourteen molecular clones were isolated and sequenced. Notably, although there was evidence for amplification of identical clones expressing the VH3-33 gene (see Table IVGo), there were no instances of intraclonal diversification.


View this table:
[in this window]
[in a new window]
 
Table IV. Molecular genetic characteristics of the VH3 gene in {gamma} chain cDNA from an OND patient (10B)1

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Analyses of HCDR3 length revealed oligoclonal bands in the CSF cells from 10 of 10 MS patients. Detection of oligoclonal bands by PCR is not unusual when low cell concentrations are employed and we have observed those bands in the PBMC of normal individuals by diluting out their B cells (data not shown). However, when artifacts related to the presence of restricted B cells or plasma cells or to the preferential amplification of certain V genes or gene families are ruled out, the observation of HCDR3 gene segments of different lengths is taken as broad evidence for the nonrandom distribution of B cells, most likely consequent to accumulation of certain clonal progenies. Indeed, such accumulations are observed in the synovial tissues of rheumatoid arthritis patients, where an active B cell response, causing a compartmentalized B cell proliferation, is occurring (28, 29, 30, 31, 32, 33). Notably, accumulation of oligoclonal bands was also revealed in 3 of 10 OND patients, possibly indicating that nonrandom distribution of B cell clones in the CSF is not a distinctive feature of MS, but may characterize a variety of infectious or autoimmune disorders. In connection with this, it is of note that two of three OND patients studied had oligoclonal IgG in the CSF detected by IEF (see Table IIGo). These observations suggest a correlation between the presence of accumulations of B cell clones detected by PCR and oligoclonal IgG bands. Studies are currently in progress to explore whether PCR can be an additional or even an alternative test to IEF.

The striking finding that emerged from these studies was that in the CSF of two patients with different clinical forms of MS, there were clonally related sequences that differed from each other by the accumulation of distinct point mutations. The use of a PCR strategy designed to amplify gene-specific sequences verified the presence of clonal lineages. The VH genes in {gamma} cDNA were highly mutated and mutations of certain codons were repeatedly observed during clonal evolution, thus reinforcing the notion that a strong pressure was imposed upon the proliferating B cells by the stimulating/selecting Ag(s). In connection with this, it is perhaps worth mentioning that studies on CSF samples taken from the same patient at 1-year intervals have demonstrated the presence of the same V(D)J sequences, possibly reinforcing the hypothesis of the presence of a continuous selective stimulation. Longitudinal studies are currently in progress.

The search for clonally related sequences was also extended to the µ cDNA. Although these studies demonstrated the presence of clonally related V gene sequences also in µ cDNA, they failed to reveal sequences shared by the µ and {gamma} cDNA from the same patient, suggesting that isotype switching was a rare event.

Despite gene-specific PCR strategies, clonal diversification was not demonstrated in the CSF of one patient with viral meningitis. Although these studies revealed the presence of VH genes with abundant point mutations, they failed to demonstrate clonal lineages, suggesting that clonal diversification is more frequent in MS and may represent a peculiar characteristic of this and certain other demyelineating diseases.

The presence of clonally related sequences is a relatively common finding in B cells purified from germinal centers, but it is uncommon for B cells of other subsets (34, 35). In this respect, the B cells from the CSF of MS patients resemble those developing in the germinal centers in the course of an immune response (34). Notably, the majority of clones isolated from MS patients presented evidence for Ag stimulation and not for Ag selection, at least based upon calculations according to the replacement (R):silent (S) ratio in the CDR vs FR (Table IIIGo) or to the Chang-Casali algorithm (data not shown) (36, 37, 38). However, the R:S ratio calculated in the FR (1.43 for patient 1A and 1.53 for patient 2A) suggested some counter selection by the stimulating Ag. Accumulations of clonally related B cells have been described in tissues that are presumptive targets of autoimmune reactions such as the synovia of patients with rheumatoid arthritis (28, 29, 30, 31) or the salivary glands of patients with Sjogren’s syndrome (39, 40). In the case of MS, there are many parameters that need to be clarified. These include the site where B cells are first stimulated, the potential mechanism of subsequent stimulation/selection, and the mode of migration of activated B cells to and from the CNS, in addition to the nature of the stimulating autoantigens (41, 42, 43). Notably, it is not known what are the sites of antigenic stimulation/selection in the CNS that are possibly characterized by accumulation of follicular dendritic cells.

Whatever the fine pathogenic mechanisms may be, our data indicate that in the CSF of MS patients there may be an intensive antigenic stimulation, possibly by a relatively restricted number of Ags. In connection with this, Owens et al. (44) found accumulations of related VH4-expressing clones in different areas of an acute MS brain. These and other observations demonstrating a restricted pattern of Ig mRNA within the plaque lesions (45) are consistent with the present description of oligoclonal B cell expansion and diversification in the CSF. Recently, using a RT-PCR methodology with primers specific for the V(D)J segments, Qin et al. (46) demonstrated oligoclonal and sometimes monoclonal B cell expansions in the CSF of MS patients. The expanded clones were somatically mutated with a distribution of mutations suggesting Ag selection. However, the presence of clonally related sequences was not detected. An explanation for these discrepancies is not easy, particularly in view of the many methodological differences, but is likely to be somehow related to the lower sensitivity of the RT-PCR method, the different primers, and the more limited number of molecular clones sequenced by Qin et al. (46).

The search for dominant HCDR3 cDNA lengths and V(D)J sequences in the PBMC corresponding to those detected in the CSF was virtually negative. These findings support the notion that in MS there is an expansion of B cells possibly occurring within the CSF. Alternatively, the B cells from the same clones detected in the CSF may preferentially home and possibly expand at certain particular sites, like cervical lymph nodes, as it has been proposed (41, 42, 47, 48, 49). The available RT-PCR methodology may now permit to explore the possibilities and to trace relationships between B lymphocytes in the CSF and those found at other anatomical sites.


    Acknowledgments
 
We thank T. Tavilla for secretarial assistance.


    Footnotes
 
1 This work was supported by a research project on multiple sclerosis of the Istituto Superiore di Sanita’ (Rome, Italy) and by National Institutes of Health Grant AI 10811. Back

2 Address correspondence and reprint requests to Dr. Manlio Ferrarini, Istituto Nazionale per la Ricerca sul Cancro, IST, Servizio di Immunologia Clinica, Largo Rosanna Benzi, No. 10, 16132 Genova GE, Italy. E-mail address: Back

3 Abbreviations used in this paper: MS, multiple sclerosis; CSF, cerebrospinal fluid; IEF, isoelectric focusing; CDR, complementarity-determining region; HCDR3, third CDR of the heavy chain variable region gene; FR, framework region; OND, other neurological disorders; RR, relapsing-remitting; SP, secondary progressive; R, replacement mutation; S, silent mutation. Back

Received for publication October 6, 1999. Accepted for publication December 12, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hafler, D., H. L. Weiner. 1995. Immunologic mechanisms and therapy in multiple sclerosis. Immunol. Rev. 144:75.[Medline]
  2. Steinman, L.. 1996. Multiple sclerosis: a coordinated immunological attack against myelin in the central nervous system. Cell 85:299.[Medline]
  3. Wekerle, H., K. Kojma, J. Lannes-Vieira, H. Lassman, C. Linngton. 1994. Animal models. Ann. Neurol. 36:S47.
  4. Olsson, T.. 1995. Critical influences of the cytokine orchestration on the outcome of myelin antigen-specific T-cell autoimmunity in experimental autoimmune encephalomyelitis and multiple sclerosis. Immunol. Rev. 144:245.[Medline]
  5. Wekerle, H.. 1999. Remembering MOG: autoantibody mediated demyelination in multiple sclerosis?. Nat. Med. 5:153.[Medline]
  6. Storch, M. K., A. Stefferl, U. Brehm, R. Weissert, E. Wallstrom, M. Kerschensteiner. 1998. Autoimmunity to myelin oligodendrocyte glycoprotein in rats mimics the spectrum of multiple sclerosis pathology. Brain Pathol. 8:681.[Medline]
  7. Genain, C. P., M. H. Nguyen, N. L. Letvin, R. Pearl, R. L. Davis, M. Adelman, M. B. Lees. 1995. Antibody facilitation of multiple sclerosis-like lesions in a non human primate. J. Clin. Invest. 96:2966.
  8. Litzenburger, T., R. Fässler, J. Bauer, H. Lassmann, C. Linington, H. Wekerle, A. Iglesias. 1998. B lymphocytes producing demyelinating autoantibodies: development and function in gene-targeted transgenic mice. J. Exp. Med. 188:169.[Abstract/Free Full Text]
  9. Genain, C. P., B. Cannella, S. L. Hauser, C. S. Raine. 1999. Identification of autoantibodies associated with myelin damage in multiple sclerosis. Nat. Med. 5:170.[Medline]
  10. Andersson, M., J. Alvarez-Cermeno, G. Bernardi, I. Cogato, P. Fredman, J. Frederiksen. 1994. Cerebrospinal fluid in the diagnosis of multiple sclerosis: a consensus report. J. Neurol. Neurosurg. Psychiatry 57:897.[Abstract/Free Full Text]
  11. Link, H., G. Tibbling. 1977. Principles of albumin and IgG analyses in neurological disorders. Scand. J. Clin. Lab. Invest. 37:397.[Medline]
  12. McLean, B. N., R. W. Luxton, E. J. Thompson. 1990. A study of immunoglobulin G in the cerebrospinal fluid of 1007 patients with suspected neurological disease using isoelectric focusing and the log IgG-index: a comparison and diagnostic applications. Brain 113:1269.[Abstract/Free Full Text]
  13. Tourtellotte, W. W., R. W. Baumhefner, K. Syndulko, P. Shapshak, M. Osborne, G. Rubinshtein, L. Newton. 1988. The long march of the cerebrospinal fluid profile indicative of clinical definite multiple sclerosis; and still marching. J. Neuroimmunol. 20:217.[Medline]
  14. Olsson, T., S. Baig, B. Hojeberg, H. Link. 1990. Antimyelin basic protein and antimyelin antibody-producing cells in multiple sclerosis. Ann. Neurol. 27:132.[Medline]
  15. Baig, S., T. Olsson, J. Yu-Ping, B. Hojeberg, M. Cruz, H. Link. 1991. Multiple sclerosis: cells secreting antibodies against myelin-associated. Scand. J. Immunol. 33:73.[Medline]
  16. Sun, J.B., H. Link, T. Olsson, B. G. Xiao, G. Andersson, H. P. Ekre, C. Linington, P. Diener. 1991. T and B cell responses to myelin-oligodendrocyte glycoprotein in multiple sclerosis. J. Immunol. 146:1490.[Abstract]
  17. Svenningsson, A., O. Andersen, M. Edsbagge, S. Stemme. 1995. Lymphocyte phenotype and subset distribution in normal cerebrospinal fluid. J. Neuroimmunol. 63:39.[Medline]
  18. Oreja-Guevara, C., E. Sindern, M. Raulf-Heimsoth, J. P. Malin. 1998. Analysis of lymphocyte subpopulations in cerebrospinal fluid and peripheral blood with multiple sclerosis and inflammatory diseases of the nervous system. Acta Neurol. Scand. 98:310.[Medline]
  19. Rajewsky, K.. 1996. Clonal selection and learning in the antibody system. Nature 381:751.[Medline]
  20. Matsumoto, M., S. F. Lo, C. J. Carruthers, J. Min, S. Mariathasan, G. Huang, D. R. Plas. 1996. Affinity maturation without germinal centres in lymphotoxin-{alpha}-deficient mice. Nature 382:462.[Medline]
  21. Chu, Y. W., E. Marin, R. Fuleihan, N. Ramesh, F. S. Rosen, R. S. Geha, R. A. Insel. 1995. Somatic mutation of human immunoglobulin V genes in the X-linked hyperIgM. J. Clin. Invest. 95:1389.
  22. Kelsoe, G.. 1999. V(D)J hypermutation and receptor revision: coloring outside the lines. Curr. Opin. Immunol. 11:70.[Medline]
  23. Fais, F., F. Ghiotto, S. Hashimoto, B. Sellars, A. Valetto, S. L. Allen, P. Schulman. 1998. Chronic lymphocytic leukemia B cells express restricted sets of mutated and unmutated antigen receptors. J. Clin. Invest. 102:1515.[Medline]
  24. Hashimoto, S., M. Dono, M. Wakai, S. L. Allen, S. M. Lichtman, P. Schulman, V. P. Vinciguerra. 1995. Somatic diversification and selection of immunoglobulin heavy and light chain variable region genes in IgG+ CD5+ chronic lymphocytic leukemia B cells. J. Exp. Med. 181:1507.[Abstract/Free Full Text]
  25. Dono, M., S. Hashimoto, F. Fais, V. Trejo, S. L. Allen, S. M. Lichtman, P. Schulman. 1996. Evidence for progenitors of chronic lymphocytic leukemia B cells that undergo intraclonal differentiation and diversification. Blood 87:1586.[Abstract/Free Full Text]
  26. Tomlinson, I. M., S. C. Williams, S. J. Corbett, J. B. L. Cox, G. Winter. 1996. V base sequence directory MRC Centre for Protein Engineering, Cambridge, UK.
  27. Klein, U., R. Kuppers, K. Rajewsky. 1994. Variable region gene analysis of B cell subsets derived from a 4-year-old. J. Exp. Med. 180:1383.[Abstract/Free Full Text]
  28. Schroder, A. E., A. Greiner, C. Seyfert, C. Berek. 1996. Differentiation of B cells in the nonlymphoid tissue of the synovial membrane of patients with rheumatoid arthritis. Proc. Natl. Acad. Sci. USA 93:221.[Abstract/Free Full Text]
  29. Lee, S. K., S. L. J. Bridges, P. M. Kirkham, W. J. Koopman, H. W. J. Schroeder. 1994. Evidence of antigen receptor-influenced oligoclonal B lymphocyte expansion in the synovium of a patient with longstanding rheumatoid arthritis. J. Clin. Invest. 93:361.
  30. Kim, H. J., V. Krenn, G. Steinhauser, C. Berek. 1999. Plasma cell development in synovial germinal centers in patients with rheumatoid and reactive arthritis. J. Immunol. 162:3053.[Abstract/Free Full Text]
  31. Randen, I., D. Brown, K. M. Thompson, N. Hughes-Jones, V. Pascual, K. Victor, J. D. Capra. 1992. Clonally related IgM rheumatoid factors undergo affinity maturation in the rheumatoid synovial tissue. J. Immunol. 148:3296.[Abstract]
  32. Kaplan, S., K. Hyman, R. Brooks, M. Wakai, S. Hashimoto, R. Furie, N. Chiorazzi. 1993. Monoclonal IgM, IgG, and IgA human rheumatoid factors produced by synovial tissue-derived, EBV-transformed B cell lines. Clin. Immunol. Immunopathol. 66:18.[Medline]
  33. Patki, V., J. Monteiro, P. K. Gregersen, N. Chiorazzi. 1997. Evidence for B cell oligoclonality in the blood and joints of patients with rheumatoid arthritis. Ann. NY Acad. Sci. 815:472.[Medline]
  34. Kuppers, R., M. Zhao, M. L. Hansmann, K. Rajewsky. 1993. Tracing B cell development in human germinal centres by molecular analysis of single cells picked from histological section. EMBO J. 12:4955.[Medline]
  35. Pascual, V., Y. J. Liu, A. Magalski, O. de Bouteiller, J. Banchereau, J. D. Capra. 1994. Analysis of somatic mutation in five B cell subsets of human tonsil. J. Exp. Med. 180:329.[Abstract/Free Full Text]
  36. Shlomchik, M. J., A. H. Aucoin, D. S. Pisetsky, M. G. Weigert. 1987. Structure and function of anti-DNA autoantibodies derived from a single autoimmune mouse. Proc. Natl. Acad. Sci. USA 84:9150.[Abstract/Free Full Text]
  37. Chang, B., P. Casali. 1994. The CDR1 sequences of a major proportion of human germline Ig VH genes are inherently susceptible to amino acid replacement. Immunol. Today 15:367.[Medline]
  38. Dorner, T., S. J. Foster, H. P. Brezinschek, P. E. Lipsky. 1998. Analysis of the targeting of the hypermutational machinery and the impact of subsequent selection on the distribution of nucleotide changes in human VHDJH rearrangements. Immunol. Rev. 162:161.[Medline]
  39. Bahler, D. W., S. H. Swerdlow. 1998. Clonal salivary gland infiltrates associated with myoepithelial sialadenitis. Blood 91:1864.[Abstract/Free Full Text]
  40. Stott, D. I., F. Hiepe, M. Hummel, G. Steinhauser, C. Berek. 1998. Antigen-driven clonal proliferation of B cells within the target tissue of an autoimmune disease: the salivary glands of patients with Sjogren’s syndrome. J. Clin. Invest. 102:938.[Medline]
  41. Knopf, P. M., C. J. Harling-Berg, H. F. Cserr, D. Basu, E. J. Sirulnick, S. C. Nolan, J. T. Park. 1998. Antigen-dependent intrathecal antibody synthesis in the normal rat brain: tissue entry and local retention of antigen-specific B cells. J. Immunol. 161:692.[Abstract/Free Full Text]
  42. Harling-Berg, C., P. M. Knopf, J. Merriam, H. F. Cserr. 1989. Role of cervical lymph nodes in the systemic humoral immune response to human serum albumin microinfused into rat cerebrospinal fluid. J. Neuroimmunol. 25:185.[Medline]
  43. Wolf, S. D., B. N. Dittel, F. Hardardottir, C. A. J. Janeway. 1996. Experimental autoimmune encephalomyelitis induction in genetically B cell-deficient-mice. J. Exp. Med. 184:2271.[Abstract/Free Full Text]
  44. Owens, G. P., H. Kraus, M. P. Burgoon, T. Smith-Jensen, M. E. Devlin, D. H. Gilden. 1998. Restricted use of VH4 germline segments in an acute multiple sclerosis brain. Ann. Neurol. 43:236.[Medline]
  45. Baranzini, S. E., M. C. Jeong, C. Butunoi, R. S. Murray, C. C. Bernard, J. R. Oksenberg. 1999. B cell repertoire diversity and clonal expansion in multiple sclerosis brain lesions. J. Immunol. 163:5133.[Abstract/Free Full Text]
  46. Qin, Y., P. Duquette, Y. Zhang, P. Talbot, R. Poole, J. Antel. 1998. Clonal expansion and somatic hypermutation of V(H) genes of B cells from cerebrospinal fluid in multiple sclerosis. J. Clin. Invest. 102:1045.[Medline]
  47. Hochwald, G. M., A. Van Driel, M. E. Robinson, G. J. Thorbecke. 1988. Immune response in draining lymph nodes and spleen after intraventricular injection of antigen. Int. J. Neurosci. 39:299.[Medline]
  48. Widner, H., G. Moller, B. B. Johansson. 1988. Immune response in deep cervical lymph nodes and spleen in the mouse after antigen deposition. Scand. J. Immunol. 28:563.[Medline]
  49. Cserr, H. F., P. M. Knopf. 1992. Cervical lymphatics, the blood-brain barrier and the immunoreactivity of the brain: a new view. Immunol. Today 13:507.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
V. Somers, C. Govarts, K. Somers, R. Hupperts, R. Medaer, and P. Stinissen
Autoantibody Profiling in Multiple Sclerosis Reveals Novel Antigenic Candidates
J. Immunol., March 15, 2008; 180(6): 3957 - 3963.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
S. L. Hauser, E. Waubant, D. L. Arnold, T. Vollmer, J. Antel, R. J. Fox, A. Bar-Or, M. Panzara, N. Sarkar, S. Agarwal, et al.
B-Cell Depletion with Rituximab in Relapsing-Remitting Multiple Sclerosis
N. Engl. J. Med., February 14, 2008; 358(7): 676 - 688.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
B. Serafini, B. Rosicarelli, D. Franciotta, R. Magliozzi, R. Reynolds, P. Cinque, L. Andreoni, P. Trivedi, M. Salvetti, A. Faggioni, et al.
Dysregulated Epstein-Barr virus infection in the multiple sclerosis brain
J. Exp. Med., November 26, 2007; 204(12): 2899 - 2912.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. P. Owens, K. M. Winges, A. M. Ritchie, S. Edwards, M. P. Burgoon, L. Lehnhoff, K. Nielsen, J. Corboy, D. H. Gilden, and J. L. Bennett
VH4 Gene Segments Dominate the Intrathecal Humoral Immune Response in Multiple Sclerosis
J. Immunol., November 1, 2007; 179(9): 6343 - 6351.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. D. Lunemann, T. Kamradt, R. Martin, and C. Munz
Epstein-Barr Virus: Environmental Trigger of Multiple Sclerosis?
J. Virol., July 1, 2007; 81(13): 6777 - 6784.
[Full Text] [PDF]


Home page
haematolHome page
M. Booman, J. Douwes, M.-C. Legdeur, J. van Baarlen, E. Schuuring, and P. Kluin
From brain to testis: immune escape and clonal selection in a B cell lymphoma with selective out-growth in two immune sanctuariesy
Haematologica, June 1, 2007; 92(6): e69 - e71.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
R. Magliozzi, O. Howell, A. Vora, B. Serafini, R. Nicholas, M. Puopolo, R. Reynolds, and F. Aloisi
Meningeal B-cell follicles in secondary progressive multiple sclerosis associate with early onset of disease and severe cortical pathology
Brain, April 1, 2007; 130(4): 1089 - 1104.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. M. Bradshaw, A. Orihuela, S. L. McArdel, M. Salajegheh, A. A. Amato, D. A. Hafler, S. A. Greenberg, and K. C. O'Connor
A Local Antigen-Driven Humoral Response Is Present in the Inflammatory Myopathies
J. Immunol., January 1, 2007; 178(1): 547 - 556.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Kolln, H.-M. Ren, R.-R. Da, Y. Zhang, E. Spillner, M. Olek, N. Hermanowicz, L. G. Hilgenberg, M. A. Smith, S. van den Noort, et al.
Triosephosphate Isomerase- and Glyceraldehyde-3-Phosphate Dehydrogenase-Reactive Autoantibodies in the Cerebrospinal Fluid of Patients with Multiple Sclerosis
J. Immunol., October 15, 2006; 177(8): 5652 - 5658.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
M. Krumbholz, D. Theil, S. Cepok, B. Hemmer, P. Kivisakk, R. M. Ransohoff, M. Hofbauer, C. Farina, T. Derfuss, C. Hartle, et al.
Chemokines in multiple sclerosis: CXCL12 and CXCL13 up-regulation is differentially linked to CNS immune cell recruitment
Brain, January 1, 2006; 129(1): 200 - 211.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. C. O'Connor, H. Appel, L. Bregoli, M. E. Call, I. Catz, J. A. Chan, N. H. Moore, K. G. Warren, S. J. Wong, D. A. Hafler, et al.
Antibodies from Inflamed Central Nervous System Tissue Recognize Myelin Oligodendrocyte Glycoprotein
J. Immunol., August 1, 2005; 175(3): 1974 - 1982.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
S. Cepok, B. Rosche, V. Grummel, F. Vogel, D. Zhou, J. Sayn, N. Sommer, H.-P. Hartung, and B. Hemmer
Short-lived plasma blasts are the main B cell effector subset during the course of multiple sclerosis
Brain, July 1, 2005; 128(7): 1667 - 1676.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. P. Burgoon, K. M. Keays, G. P. Owens, A. M. Ritchie, P. R. Rai, C. D. Cool, and D. H. Gilden
Laser-capture microdissection of plasma cells from subacute sclerosing panencephalitis brain reveals intrathecal disease-relevant antibodies
PNAS, May 17, 2005; 102(20): 7245 - 7250.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Hohlfeld and H. Wekerle
Autoimmune concepts of multiple sclerosis as a basis for selective immunotherapy: From pipe dreams to (therapeutic) pipelines
PNAS, October 5, 2004; 101(suppl_2): 14599 - 14606.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Corcione, S. Casazza, E. Ferretti, D. Giunti, E. Zappia, A. Pistorio, C. Gambini, G. L. Mancardi, A. Uccelli, and V. Pistoia
Recapitulation of B cell differentiation in the central nervous system of patients with multiple sclerosis
PNAS, July 27, 2004; 101(30): 11064 - 11069.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. M. Ritchie, D. H. Gilden, R. A. Williamson, M. P. Burgoon, X. Yu, K. Helm, J. R. Corboy, and G. P. Owens
Comparative Analysis of the CD19+ and CD138+ Cell Antibody Repertoires in the Cerebrospinal Fluid of Patients with Multiple Sclerosis
J. Immunol., July 1, 2004; 173(1): 649 - 656.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. P. Owens, A. M. Ritchie, M. P. Burgoon, R. A. Williamson, J. R. Corboy, and D. H. Gilden
Single-Cell Repertoire Analysis Demonstrates that Clonal Expansion Is a Prominent Feature of the B Cell Response in Multiple Sclerosis Cerebrospinal Fluid
J. Immunol., September 1, 2003; 171(5): 2725 - 2733.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Zocher, P. A. Baeuerle, T. Dreier, and A. Iglesias
Specific depletion of autoreactive B lymphocytes by a recombinant fusion protein in vitro and in vivo
Int. Immunol., July 1, 2003; 15(7): 789 - 796.
[Abstract] [Full Text] [PDF]


Home page
Mult SclerHome page
T Holmoy, B Vandvik, and F Vartdal
T cells from multiple sclerosis patients recognize immunoglobulin G from cerebrospinal fluid
Multiple Sclerosis, June 1, 2003; 9(3): 228 - 234.
[Abstract] [PDF]


Home page
J. Leukoc. Biol.Home page
D. Giunti, G. Borsellino, R. Benelli, M. Marchese, E. Capello, M. T. Valle, E. Pedemonte, D. Noonan, A. Albini, G. Bernardi, et al.
Phenotypic and functional analysis of T cells homing into the CSF of subjects with inflammatory diseases of the CNS
J. Leukoc. Biol., May 1, 2003; 73(5): 584 - 590.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H.-C. von Budingen, S. L. Hauser, A. Fuhrmann, C. B. Nabavi, J. I. Lee, and C. P. Genain
Molecular characterization of antibody specificities against myelin/oligodendrocyte glycoprotein in autoimmune demyelination
PNAS, June 11, 2002; 99(12): 8207 - 8212.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
M. Jacobsen, S. Cepok, E. Quak, M. Happel, R. Gaber, A. Ziegler, S. Schock, W. H. Oertel, N. Sommer, and B. Hemmer
Oligoclonal expansion of memory CD8+ T cells in cerebrospinal fluid from multiple sclerosis patients
Brain, March 1, 2002; 125(3): 538 - 550.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. N. A. Klaren and R. Peek
Evidence for a Compartmentalized B Cell Response as Characterized by IgG Epitope Specificity in Human Ocular Toxoplasmosis
J. Immunol., December 1, 2001; 167(11): 6263 - 6269.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. A. Williamson, M. P. Burgoon, G. P. Owens, O. Ghausi, E. Leclerc, L. Firme, S. Carlson, J. Corboy, P. W. H. I. Parren, P. P. Sanna, et al.
Anti-DNA antibodies are a major component of the intrathecal B cell response in multiple sclerosis
PNAS, February 1, 2001; (2001) 31567598.
[Abstract] [Full Text]


Home page
Arch NeurolHome page
D. H. Gilden, M. P. Burgoon, B. K. Kleinschmidt-DeMasters, R. A. Williamson, O. Ghausi, D. R. Burton, and G. P. Owens
Molecular Immunologic Strategies to Identify Antigens and B-Cell Responses Unique to Multiple Sclerosis
Arch Neurol, January 1, 2001; 58(1): 43 - 48.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. A. Williamson, M. P. Burgoon, G. P. Owens, O. Ghausi, E. Leclerc, L. Firme, S. Carlson, J. Corboy, P. W. H. I. Parren, P. P. Sanna, et al.
Anti-DNA antibodies are a major component of the intrathecal B cell response in multiple sclerosis
PNAS, February 13, 2001; 98(4): 1793 - 1798.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Colombo, M.
Right arrow Articles by Ferrarini, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Colombo, M.
Right arrow Articles by Ferrarini, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS