| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Servizio di Immunologia Clinica, Istituto Nazionale per la Ricerca sul Cancro, Genova, Italy;
Istituto di Medicina Interna, Università degli Studi di Milano, Milan, Italy;
Dipartimento di Scienze Neurologiche e della Visione, Università degli Studi di Genova, Genova, Italy;
§
Divisione di Anatomia Patologica, Ospedale Sant’Andrea, 19100 La Spezia, Italy;
¶
Department of Medicine, North Shore University Hospital and New York University School of Medicine, Manhasset, New York, NY 77030; and
||
Dipartimento di Oncologia, Biologia e Genetica, Università degli Studi di Genova, Genova, Italy
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The inflammatory infiltrates of MS are comprised of T cells, macrophages, and B cells. It is generally assumed that T cells play a pivotal role in initiating the inflammatory lesions, as indicated by studies on experimental animal models, especially experimental autoimmune encephalomyelitis (3, 4, 5). However, the production of autoantibodies, particularly those reactive with myelin, has relevance since they can contribute to the process of demyelinization (6, 7, 8, 9). The involvement of B cells in MS is suggested by a number of observations. For example, the cerebrospinal fluid (CSF) of MS patients is characterized by the presence of Ig molecules with restricted isoelectric focusing (IEF) mobility (10). These bands are not usually detected in the plasma and there is evidence indicating that they are produced intrathecally (11, 12, 13). Moreover, micromethods indicate that B cells producing anti-myelin Abs exist in the CSF of MS patients (14, 15, 16). However, the number of B cells present in the CSF is too low to permit studies with the classical methods of cellular immunology (17, 18).
The advent of PCR methodologies and the recent understanding of the control of Ig VH and VL gene assembly in B cells have made it possible to collect information on the developmental and maturational history of B cells by studying their Ig V region genes. During a T cell-dependent response, B cells accumulate point mutations in their VH and VL genes and B cells expressing those V gene variants that lead to increased affinity for the stimulating Ag are selected for survival and clonal expansion (19). This selection takes place mainly, but not necessarily (20, 21, 22), in the germinal centers of the lymphoid organs (19). Moreover, among these stimulated and Ag-selected B cells, there may be a predominance of B cells that are the progeny of a single precursor and share the same rearranged VH or VL gene, albeit with different numbers and distributions of point mutations. Thus, the accumulation of point mutations in clonally related V gene sequences within a given B cell population can be used as a marker of an ongoing response to stimulating Ag(s). By using PCR methodology and the above-illustrated criteria, we have collected evidence for an ongoing B cell response in the CSF of MS.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CSF and PBMC samples were obtained from each of 10
MS patients and 10 patients with other neurological disorders (OND).
The MS patients, with clinically or laboratory-supported definite MS
diagnosis, were categorized according to clinical course as
having either relapsing-remitting (RR, patient 1A and
patients 4A-10A, see Table I
) or secondary progressive disease (SP,
patients 2A and 3A, Table I). All cases were free of immunosuppressive
treatment and had not received steroid therapy in the 6 mo preceding
lumbar puncture. CSF examination was conducted for diagnostic purposes
or during exacerbation of neurological symptoms, and each patient gave
informed consent to perform the procedure. The OND patients included a
variety of nondemyelineating disorders as indicated in Table II.
|
|
Total RNA was extracted from either CSF cells (range, 1.3 x 104–2.5 x 105 cells, see Tables I and II) or PBMC (2.5 x 104– x 106) using RNA-Clean System (TB Molbiol, Berlin, Germany) and was reverse transcribed for first cDNA synthesis as detailed (23).
Genomic DNA was purified from either CSF cells or PBMC by cell lysis followed by digestion with proteinase K, "salting out" extraction, and precipitation by ethanol (24).
PCR amplification and cloning of rearranged Ig V genes have been
described previously (25). Briefly, first-strand cDNA
(1–5 µl) was amplified using sense IgVH gene
family-specific primers: VH1,
5'-GGAATTCATGGACTGGACCTGGAGGGTCTTCT; VH2,
5'-GGAATTCATGGACATACTTTGTTCCACGCTCC; VH3,
5'-GAGTTTGGGCTGAGCTGGGACTTTT; VH4,
5'-ATGAAACACCTGTGGTTCTTCCTCC; VH5,
5'-GGCTGTTCTCCAAGGAGTC; and VH6,
5'-GGAATTCATGTCTGTCTCCTTCCTCATCTTCC and antisense
CH constant region primers: µ,
5'-CAAGCTTAAGGAAGTCCTGTGCGAG;
, 5'-GTAGGACAGC(CT)GGGAAGGTGTGCAC, and 
,
5'-CCAAGCTTGAGGCTCAGCGGGAAGACCTT in independent reactions. PCR was
performed for 35–45 cycles under standard conditions
(25). In some experiments, a VH3-30
(5'-GGGTTTTCCTCGTTGCTCTTTT) gene-specific primer was used; this
strategy allows the amplification of VH3-30,
VH3-30.3, and
VH3-33 genes only.
When genomic DNA was used as template, a first amplification was conducted with the VH family-specific and a mixture of antisense JH-specific primers: JHA, CTGAGGAGACGGTGACCAGGGT; JHB, CTGAGGAGACAGTGACCAGGGT; JHC, CTGAGGAGACGGTGACCGTGGT; and JHD CTGATGAGACGGTGACCATTGT.
To analyze the third complementarity-determining region (CDR) of the H chain variable region gene (HCDR3) lengths, the first PCR products were reamplified using two nested consensus primers, a sense framework region (FR) 3 and an antisense JH primer (23), and the products were electrophoresed through a 7.5% acrylamide gel and the bands were visualized by a silver staining protocol (Promega, Madison, WI).
PCR specific for clonal sequences
In selected experiments, a strategy was applied to search for a particular V(D)J rearrangement. Primers specific for the CDR2 region of clone 1A-3G7 (5'-TTTCACCTGTCGGCAACG), for the CDR3 region of clone 1A-4G21 (5'-CAGAGGGGGTGGAAGT), and for the CDR3 region of clone 1A-4G29 (5'-GGACTGACTGGGAATGT) were designed. These primers were used in conjunction with the JH primer in nested PCR and their products were electrophoresed as described above.
cDNA sequencing
First PCR products were purified (Advantage PCR Pure kit; Clontech Laboratories, Palo Alto, CA), and cloned into TOPO TA vector (Invitrogen, Carlsbad, CA), processed using Wizard minipreps (Promega), and sequenced. Sequences were compared with those in the V BASE sequence directory (26) using the MacVector software version 6.0.1 (Eastern Kodak, New Haven, CT). The D segments were assigned to the appropriate family according to the criteria of Klein et al. (27). The intrinsic TAQ error in our system was 0.15%. Sequences are deposited in European Molecular Biology Laboratory (EMBL) under the accession numbers (AJ245201–AJ245361).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
PCR analysis of HCDR3 segments was conducted on the CSF cells from
10 patients with MS using primers specific for the
VH and CH (µ, , and
) genes of Ig molecules. Restricted and dominant (oligoclonal) HCDR3
lengths were identified in all of the CSF samples with each of the
VH family-specific primers, but they were more
numerous within the VH3 or
VH4 gene families. Oligoclonal HCDR3 lengths
also were detected in the DNA preparations of the same CSF samples,
thus excluding that the oligoclonal pattern observed was related to the
presence of activated B cells or plasma cells that are enriched in
homogeneous RNA. In contrast, only 3 of 10 patients with OND
displayed oligoclonal HCDR3 bands. Notably, these three patients had
viral encephalitis (patients 6B and 10B, see Table II
) or postinfection
radiculitis (patient 8B, Table II). Oligoclonal HCDR3 bands were not
observed by PCR using cDNA prepared from the PBMC of MS patients or
controls (Tables I and
II and Fig. 1).
|
VH3 and VH4
cDNA clones from the CSF of patient 1A (n = 20) and
patient 2A (n = 22) were sequenced (Table III). In patient 1A, certain
VH3 or VH4 genes
were predominantly expressed (Table III). Some of the molecular clones
were identical, whereas others, such as clones 1A-3G1, 1A-3G4, and
1A-3G8 were related (i.e., they shared the same HCDR3 and differed for
a number of point mutations in the VH gene). In
patient 2A, the expansion of VH3 and
VH4 sequences was more heterogeneous,
although there were two molecular clones (2A-3G22, 2A-3G26) that
carried the same VH3 gene and shared HCDR3-related
sequences. In both patients, the VH3 and
VH4 genes analyzed displayed deviations from
the germline genes. In patient 1A, these differences ranged from a
minimum of 4.1% to a maximum of 15% (average, 9.2%), and, in patient
2A, these differences were between 1.1 and 10.5% (average, 5.6%).
|
Among the cDNA clones that shared the same HCDR3 sequence, the
VH3 or VH4 genes
were either identical or differed by a few mutations, indicating an
ongoing process of intraclonal diversification. To analyze larger
numbers of related clones, we designed a strategy of PCR amplification
in which primers specific for the VH3-30 and
VH3-30.3 genes were employed in conjunction
with -chain-specific primers. These primers also could amplify the
VH3-33 gene. With this method, we isolated
15 of 15 molecular clones from patient 1A that carried the
VH3-30.3 gene and 15 of 15 clones from
patient 2A carrying the VH3-30 gene. Thus,
despite some degeneracy of the VH3-30 primers,
only molecular clones that harbored the rearranged
VH3-30.3 (for patient 1A) and
VH3-30 (for patient 2A) genes most commonly
represented in the samples analyzed above were isolated. In patient 1A,
15 of 15 of these molecular clones shared identical or related HCDR3
sequences, whereas 10 of 15 clones from patient 2A had related HCDR3.
Fig. 2 reports the all of the clonally
related sequences detected in the two patients with the two different
primers (i.e., VH3 and
VH3-30-specific primers). These findings allowed
us to depict possible patterns of evolution of each group of related
clones (Fig. 3). Notably, mutations of
certain codons were repeatedly observed during clonal evolution (see,
for example, the replacement Val
Ala at codon 2 in clones 2A-3G1.4,
2A-3G1.14, 2A-3G1.20, 2A-3G12, and 2A-3G1.22 or GlnTyr at codon 82
of clones 2A-3G1.13, 2A-3G1.20, 2A-3G1.12, and 2A-3G1.16).
|
|
cDNA since
they constantly differed in the HCDR3 sequences. However, in both
patients, there were groups of clonally related sequences (one
group of two clones from patient 1A, four groups of two clones each
from patient 2A) as determined by the HCDR3 identity and the expression
of the same VH3 gene with different patterns of
mutations (data not shown; the sequences are available in the EMBL
database, accession numbers AJ245273–AJ245311).
Search for the presence in PBMC of the same cDNA detected in
the CSF cells
In this study, we investigated whether a particular V(D)J sequence
(clone 1A-3G7) detected in the cDNA from the CSF of patient 1A
could also be found in PBMC of the same individual. To this end, two
different approaches were used. First, the cDNA from PBMC of
patient 1A was PCR amplified by using the
VH3-30-specific primer. Among the 20 molecular
clones sequenced, none was found to be related to the
VH3-30-carrying molecular clones expanded in
the CSF of the same patient (data not shown). Second, the V(D)J segment
characteristic of the clone (1A-3G7) was amplified from PBMC of the
same patient by using a nested PCR methodology. With this method, the
first PCR product was reamplified using clone-specific primers (see
Fig. 4). As shown in Fig. 4, a distinct
band (lane 3) was observed by acrylamide gel
electrophoresis in the PBMC of patient 1A, which comigrated with both
the PCR product of the clone 1A-3G7 and with the PCR product amplified
from the CSF of patient 1A (lanes 1 and
2). Conversely, no bands were observed in the PBMC or CSF of
an unrelated patient amplified as described (Fig. 4, lanes 4
and 5). The sequence of the band detected on the PBMC of
patient 1A proved to be identical to clone 1A-3G1 (data not shown). The
same methodology was employed to search for the sequence of clones
1A-4G21 and 1A-4G29 from the CSF of patient 1A in the PBMC of the same
patient. In both cases, no obvious bands were detected. Collectively,
these data demonstrate an imbalanced expression of B cell clones
between CSF and PBL.
|
cDNA from the CSF of an OND patient
In these studies, the VH3
transcripts from the CSF of an OND patient (10B) that displayed
oligoclonal PCR bands (Table II) were sequenced. All of the
VH3 genes (n = 16) analyzed
showed significant deviations from the germline (average mutation
frequency, 7.1%). Among the sequences, there were four groups, of two
clones each, that contained repeated sequences (i.e., identical HCDR3
and identical pattern of mutations on the VH
gene). One group of these clones carried the
VH3-30 and another the
VH3-33 gene (Table IV). Therefore, to determine whether
intraclonal diversity had developed among these clones, we employed the
same strategy of amplification with
VH3-30-specific primers used above. Fourteen
molecular clones were isolated and sequenced. Notably, although there
was evidence for amplification of identical clones expressing the
VH3-33 gene (see Table IV), there were no
instances of intraclonal diversification.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). These observations suggest a correlation between
the presence of accumulations of B cell clones detected by PCR and
oligoclonal IgG bands. Studies are currently in progress to explore
whether PCR can be an additional or even an alternative test to
IEF.
The striking finding that emerged from these studies was that in the
CSF of two patients with different clinical forms of MS, there were
clonally related sequences that differed from each other by the
accumulation of distinct point mutations. The use of a PCR strategy
designed to amplify gene-specific sequences verified the presence of
clonal lineages. The VH genes in cDNA were
highly mutated and mutations of certain codons were repeatedly observed
during clonal evolution, thus reinforcing the notion that a strong
pressure was imposed upon the proliferating B cells by the
stimulating/selecting Ag(s). In connection with this, it is perhaps
worth mentioning that studies on CSF samples taken from the same
patient at 1-year intervals have demonstrated the presence of the same
V(D)J sequences, possibly reinforcing the hypothesis of the presence of
a continuous selective stimulation. Longitudinal studies are currently
in progress.
The search for clonally related sequences was also extended to the µ
cDNA. Although these studies demonstrated the presence of clonally
related V gene sequences also in µ cDNA, they failed to reveal
sequences shared by the µ and cDNA from the same patient,
suggesting that isotype switching was a rare event.
Despite gene-specific PCR strategies, clonal diversification was not demonstrated in the CSF of one patient with viral meningitis. Although these studies revealed the presence of VH genes with abundant point mutations, they failed to demonstrate clonal lineages, suggesting that clonal diversification is more frequent in MS and may represent a peculiar characteristic of this and certain other demyelineating diseases.
The presence of clonally related sequences is a relatively common
finding in B cells purified from germinal centers, but it is uncommon
for B cells of other subsets (34, 35). In this respect,
the B cells from the CSF of MS patients resemble those developing in
the germinal centers in the course of an immune response
(34). Notably, the majority of clones isolated from MS
patients presented evidence for Ag stimulation and not for Ag
selection, at least based upon calculations according to the
replacement (R):silent (S) ratio in the CDR vs FR (Table III) or to the
Chang-Casali algorithm (data not shown) (36, 37, 38). However,
the R:S ratio calculated in the FR (1.43 for patient 1A and 1.53 for
patient 2A) suggested some counter selection by the stimulating Ag.
Accumulations of clonally related B cells have been described in
tissues that are presumptive targets of autoimmune reactions such as
the synovia of patients with rheumatoid arthritis (28, 29, 30, 31)
or the salivary glands of patients with Sjogren’s syndrome (39, 40). In the case of MS, there are many parameters that need to
be clarified. These include the site where B cells are first
stimulated, the potential mechanism of subsequent
stimulation/selection, and the mode of migration of activated B cells
to and from the CNS, in addition to the nature of the stimulating
autoantigens (41, 42, 43). Notably, it is not known what are
the sites of antigenic stimulation/selection in the CNS that are
possibly characterized by accumulation of follicular dendritic
cells.
Whatever the fine pathogenic mechanisms may be, our data indicate that in the CSF of MS patients there may be an intensive antigenic stimulation, possibly by a relatively restricted number of Ags. In connection with this, Owens et al. (44) found accumulations of related VH4-expressing clones in different areas of an acute MS brain. These and other observations demonstrating a restricted pattern of Ig mRNA within the plaque lesions (45) are consistent with the present description of oligoclonal B cell expansion and diversification in the CSF. Recently, using a RT-PCR methodology with primers specific for the V(D)J segments, Qin et al. (46) demonstrated oligoclonal and sometimes monoclonal B cell expansions in the CSF of MS patients. The expanded clones were somatically mutated with a distribution of mutations suggesting Ag selection. However, the presence of clonally related sequences was not detected. An explanation for these discrepancies is not easy, particularly in view of the many methodological differences, but is likely to be somehow related to the lower sensitivity of the RT-PCR method, the different primers, and the more limited number of molecular clones sequenced by Qin et al. (46).
The search for dominant HCDR3 cDNA lengths and V(D)J sequences in the PBMC corresponding to those detected in the CSF was virtually negative. These findings support the notion that in MS there is an expansion of B cells possibly occurring within the CSF. Alternatively, the B cells from the same clones detected in the CSF may preferentially home and possibly expand at certain particular sites, like cervical lymph nodes, as it has been proposed (41, 42, 47, 48, 49). The available RT-PCR methodology may now permit to explore the possibilities and to trace relationships between B lymphocytes in the CSF and those found at other anatomical sites.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Manlio Ferrarini, Istituto Nazionale per la Ricerca sul Cancro, IST, Servizio di Immunologia Clinica, Largo Rosanna Benzi, No. 10, 16132 Genova GE, Italy. E-mail address:
3 Abbreviations used in this paper: MS, multiple sclerosis; CSF, cerebrospinal fluid; IEF, isoelectric focusing; CDR, complementarity-determining region; HCDR3, third CDR of the heavy chain variable region gene; FR, framework region; OND, other neurological disorders; RR, relapsing-remitting; SP, secondary progressive; R, replacement mutation; S, silent mutation.
Received for publication October 6, 1999. Accepted for publication December 12, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-deficient mice. Nature 382:462.[Medline]
This article has been cited by other articles:
|
|
 |
|
  V. Somers, C. Govarts, K. Somers, R. Hupperts, R. Medaer, and P. Stinissen Autoantibody Profiling in Multiple Sclerosis Reveals Novel Antigenic Candidates J. Immunol., March 15, 2008; 180(6): 3957 - 3963. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. L. Hauser, E. Waubant, D. L. Arnold, T. Vollmer, J. Antel, R. J. Fox, A. Bar-Or, M. Panzara, N. Sarkar, S. Agarwal, et al. B-Cell Depletion with Rituximab in Relapsing-Remitting Multiple Sclerosis N. Engl. J. Med., February 14, 2008; 358(7): 676 - 688. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Serafini, B. Rosicarelli, D. Franciotta, R. Magliozzi, R. Reynolds, P. Cinque, L. Andreoni, P. Trivedi, M. Salvetti, A. Faggioni, et al. Dysregulated Epstein-Barr virus infection in the multiple sclerosis brain J. Exp. Med., November 26, 2007; 204(12): 2899 - 2912. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. P. Owens, K. M. Winges, A. M. Ritchie, S. Edwards, M. P. Burgoon, L. Lehnhoff, K. Nielsen, J. Corboy, D. H. Gilden, and J. L. Bennett VH4 Gene Segments Dominate the Intrathecal Humoral Immune Response in Multiple Sclerosis J. Immunol., November 1, 2007; 179(9): 6343 - 6351. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Lunemann, T. Kamradt, R. Martin, and C. Munz Epstein-Barr Virus: Environmental Trigger of Multiple Sclerosis? J. Virol., July 1, 2007; 81(13): 6777 - 6784. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Booman, J. Douwes, M.-C. Legdeur, J. van Baarlen, E. Schuuring, and P. Kluin From brain to testis: immune escape and clonal selection in a B cell lymphoma with selective out-growth in two immune sanctuariesy Haematologica, June 1, 2007; 92(6): e69 - e71. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Magliozzi, O. Howell, A. Vora, B. Serafini, R. Nicholas, M. Puopolo, R. Reynolds, and F. Aloisi Meningeal B-cell follicles in secondary progressive multiple sclerosis associate with early onset of disease and severe cortical pathology Brain, April 1, 2007; 130(4): 1089 - 1104. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Bradshaw, A. Orihuela, S. L. McArdel, M. Salajegheh, A. A. Amato, D. A. Hafler, S. A. Greenberg, and K. C. O'Connor A Local Antigen-Driven Humoral Response Is Present in the Inflammatory Myopathies J. Immunol., January 1, 2007; 178(1): 547 - 556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kolln, H.-M. Ren, R.-R. Da, Y. Zhang, E. Spillner, M. Olek, N. Hermanowicz, L. G. Hilgenberg, M. A. Smith, S. van den Noort, et al. Triosephosphate Isomerase- and Glyceraldehyde-3-Phosphate Dehydrogenase-Reactive Autoantibodies in the Cerebrospinal Fluid of Patients with Multiple Sclerosis J. Immunol., October 15, 2006; 177(8): 5652 - 5658. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Krumbholz, D. Theil, S. Cepok, B. Hemmer, P. Kivisakk, R. M. Ransohoff, M. Hofbauer, C. Farina, T. Derfuss, C. Hartle, et al. Chemokines in multiple sclerosis: CXCL12 and CXCL13 up-regulation is differentially linked to CNS immune cell recruitment Brain, January 1, 2006; 129(1): 200 - 211. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. C. O'Connor, H. Appel, L. Bregoli, M. E. Call, I. Catz, J. A. Chan, N. H. Moore, K. G. Warren, S. J. Wong, D. A. Hafler, et al. Antibodies from Inflamed Central Nervous System Tissue Recognize Myelin Oligodendrocyte Glycoprotein J. Immunol., August 1, 2005; 175(3): 1974 - 1982. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Cepok, B. Rosche, V. Grummel, F. Vogel, D. Zhou, J. Sayn, N. Sommer, H.-P. Hartung, and B. Hemmer Short-lived plasma blasts are the main B cell effector subset during the course of multiple sclerosis Brain, July 1, 2005; 128(7): 1667 - 1676. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Burgoon, K. M. Keays, G. P. Owens, A. M. Ritchie, P. R. Rai, C. D. Cool, and D. H. Gilden Laser-capture microdissection of plasma cells from subacute sclerosing panencephalitis brain reveals intrathecal disease-relevant antibodies PNAS, May 17, 2005; 102(20): 7245 - 7250. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Hohlfeld and H. Wekerle Autoimmune concepts of multiple sclerosis as a basis for selective immunotherapy: From pipe dreams to (therapeutic) pipelines PNAS, October 5, 2004; 101(suppl_2): 14599 - 14606. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Corcione, S. Casazza, E. Ferretti, D. Giunti, E. Zappia, A. Pistorio, C. Gambini, G. L. Mancardi, A. Uccelli, and V. Pistoia Recapitulation of B cell differentiation in the central nervous system of patients with multiple sclerosis PNAS, July 27, 2004; 101(30): 11064 - 11069. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Ritchie, D. H. Gilden, R. A. Williamson, M. P. Burgoon, X. Yu, K. Helm, J. R. Corboy, and G. P. Owens Comparative Analysis of the CD19+ and CD138+ Cell Antibody Repertoires in the Cerebrospinal Fluid of Patients with Multiple Sclerosis J. Immunol., July 1, 2004; 173(1): 649 - 656. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. P. Owens, A. M. Ritchie, M. P. Burgoon, R. A. Williamson, J. R. Corboy, and D. H. Gilden Single-Cell Repertoire Analysis Demonstrates that Clonal Expansion Is a Prominent Feature of the B Cell Response in Multiple Sclerosis Cerebrospinal Fluid J. Immunol., September 1, 2003; 171(5): 2725 - 2733. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zocher, P. A. Baeuerle, T. Dreier, and A. Iglesias Specific depletion of autoreactive B lymphocytes by a recombinant fusion protein in vitro and in vivo Int. Immunol., July 1, 2003; 15(7): 789 - 796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T Holmoy, B Vandvik, and F Vartdal T cells from multiple sclerosis patients recognize immunoglobulin G from cerebrospinal fluid Multiple Sclerosis, June 1, 2003; 9(3): 228 - 234. [Abstract] [PDF]
|
|
|
|
 |
|
 D. Giunti, G. Borsellino, R. Benelli, M. Marchese, E. Capello, M. T. Valle, E. Pedemonte, D. Noonan, A. Albini, G. Bernardi, et al. Phenotypic and functional analysis of T cells homing into the CSF of subjects with inflammatory diseases of the CNS J. Leukoc. Biol., May 1, 2003; 73(5): 584 - 590. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-C. von Budingen, S. L. Hauser, A. Fuhrmann, C. B. Nabavi, J. I. Lee, and C. P. Genain Molecular characterization of antibody specificities against myelin/oligodendrocyte glycoprotein in autoimmune demyelination PNAS, June 11, 2002; 99(12): 8207 - 8212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Jacobsen, S. Cepok, E. Quak, M. Happel, R. Gaber, A. Ziegler, S. Schock, W. H. Oertel, N. Sommer, and B. Hemmer Oligoclonal expansion of memory CD8+ T cells in cerebrospinal fluid from multiple sclerosis patients Brain, March 1, 2002; 125(3): 538 - 550. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. N. A. Klaren and R. Peek Evidence for a Compartmentalized B Cell Response as Characterized by IgG Epitope Specificity in Human Ocular Toxoplasmosis J. Immunol., December 1, 2001; 167(11): 6263 - 6269. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Williamson, M. P. Burgoon, G. P. Owens, O. Ghausi, E. Leclerc, L. Firme, S. Carlson, J. Corboy, P. W. H. I. Parren, P. P. Sanna, et al. Anti-DNA antibodies are a major component of the intrathecal B cell response in multiple sclerosis PNAS, February 1, 2001; (2001) 31567598. [Abstract] [Full Text]
|
|
|
|
 |
|
 D. H. Gilden, M. P. Burgoon, B. K. Kleinschmidt-DeMasters, R. A. Williamson, O. Ghausi, D. R. Burton, and G. P. Owens Molecular Immunologic Strategies to Identify Antigens and B-Cell Responses Unique to Multiple Sclerosis Arch Neurol, January 1, 2001; 58(1): 43 - 48. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Williamson, M. P. Burgoon, G. P. Owens, O. Ghausi, E. Leclerc, L. Firme, S. Carlson, J. Corboy, P. W. H. I. Parren, P. P. Sanna, et al. Anti-DNA antibodies are a major component of the intrathecal B cell response in multiple sclerosis PNAS, February 13, 2001; 98(4): 1793 - 1798. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
