The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wild, J. S.
Right arrow Articles by Sur, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wild, J. S.
Right arrow Articles by Sur, S.
The Journal of Immunology, 2000, 164: 2701-2710.
Copyright © 2000 by The American Association of Immunologists

IFN-{gamma}-Inducing Factor (IL-18) Increases Allergic Sensitization, Serum IgE, Th2 Cytokines, and Airway Eosinophilia in a Mouse Model of Allergic Asthma1

James S. Wild*, Anastasia Sigounas{dagger}, Nilanjana Sur*, Mohammed S. Siddiqui{dagger}, Rafeul Alam*, Masashi Kurimoto{ddagger} and Sanjiv Sur2,*

* Department of Internal Medicine, Division of Allergy and Immunology, University of Texas Medical Branch, Galveston, TX 77555; {dagger} Department of Medicine, East Carolina University School of Medicine, Greenville, NC; and {ddagger} Fujisaki Institute, Hayashibara Biochemical Labs, Okayama, Japan


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We investigated the effects of IFN-{gamma}-inducing factor (IL-18) in a ragweed (RW) mouse model of allergic asthma. Administration of IL-18 in conjunction with allergic sensitization and challenge in wild-type, but not IFN-{gamma} -/- mice, inhibited the bronchoalveolar lavage (BAL) eosinophilia induced by RW challenge, and increased serum levels of RW-specific IgG2a and production of IFN-{gamma} from splenocytes cultured with RW, indicating a critical role for IFN-{gamma} in mediating these effects. Paradoxically, the same treatment schedule in WT mice increased serum levels of RW-specific IgE and IgG1, and production of IL-4 and IL-5 from splenocytes cultured with RW. When the effects of the same IL-18 treatment schedule were allowed to mature for 3 wk, the inhibition of lung eosinophil recruitment was replaced by augmentation of lung eosinophil recruitment. In another experiment, IL-18 administered only with allergic sensitization increased BAL eosinophilia and lung expression of IL-5 and IFN-{gamma}, while IL-18 administered only with RW challenge decreased BAL eosinophilia and increased lung IFN-{gamma} expression, while lung expression of IL-5 remained unchanged. IL-18 administered without RW or adjuvant to naive mice increased total serum IgE levels. Finally, intrapulmonary administrations of IL-18 plus RW in naive mice dramatically increased Th2 cytokine production, IgE levels, eosinophil recruitment, and airway mucus, demonstrating induction of allergic sensitization. This is the first report demonstrating that IL-18 promotes a Th2 phenotype in vivo, and potently induces allergic sensitization. These results suggest that IL-18 may contribute to the pathogenesis of allergic asthma.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Late phase pulmonary inflammation in allergic asthma is modulated by Th cells that have been classified into Th1 and Th2 types in accordance with their cytokine patterns. Substantial evidence has been presented implicating Th2 cytokines IL-4 and IL-5 in the pathology of allergic asthma and demonstrating the protective effect of Th1 cells. The number of cells producing Th2 cytokine mRNA is increased during allergic inflammation (1, 2). IL-4 knockout (KO)3 mice and animals treated with anti-IL-4 demonstrate inhibited eosinophil recruitment (3, 4). Also, anti-IL-5 Ab treatment inhibits allergen-induced eosinophil recruitment and bronchial hyperresponsiveness in animals (5, 6). In contrast, the Th1 cytokine IFN-{gamma} has been shown to attenuate eosinophil recruitment (7, 8). These data suggest that agents that shift the T cell population from a Th2 profile to a Th1 profile are likely to protect against eosinophilic inflammation in asthma. This hypothesis is supported by the observation that IL-12, a cytokine that enhances production of the Th1 cytokine IFN-{gamma}, inhibits Th2 cytokine synthesis and IgE synthesis in vitro and in vivo (9, 10, 11). We and others have shown that IL-12 inhibits allergen-induced eosinophil recruitment, airway responsiveness, and allergen-specific IgE synthesis in murine models of asthma (12, 13, 14).

Originally called IFN-{gamma}-inducing factor, IL-18 has been reported to have properties similar to IL-12, including its ability to stimulate production of IFN-{gamma} in T cells, NK cells, and B cells (15). IL-18 and IL-12 act synergistically to promote IFN-{gamma} production (16), but IL-18 has also been reported to produce host-defense functions independent of IL-12 and IFN-{gamma} (17). Among the immunoregulatory effects of IL-18 that appear to be distinct from costimulation of IFN-{gamma} production are induction of Fas ligand (18, 19), TNF-{alpha}, IL-1ß, and CC and CXC chemokines (20). More recently, IL-18 was reported to induce the production of the Th2 cytokine, IL-13, from T cells and NK cells in vitro (21).

We have recently shown that CpG DNA, motifs that are overrepresented in bacterial DNA and induce IFN-{gamma}, IL-12, and IL-18 (22), protect against eosinophilic lung inflammation in a mouse model of asthma (23). Because both IFN-{gamma} and IL-12 inhibit eosinophilic lung inflammation, we sought to determine whether IL-18 would contribute similar or opposing effects in a mouse model of asthma. The results of our study indicate that IL-18 produced an early inhibition of allergen-specific lung eosinophilia that was mediated by IFN-{gamma}, but also increased allergen-specific serum IgE levels, IL-4 and IL-5 production from splenocytes cultured with the RW, and increased eosinophilic lung inflammation.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Experimental animals

Six- to 8-wk-old female BALB/c mice were purchased from Harlan Laboratories (Indianapolis, IN) to perform all experiments except those requiring IFN-{gamma}-/- and IFN-{gamma}+/+ mice. The latter (IFN-{gamma}-/- and IFN-{gamma}+/+ mice) were 5-wk-old female BALB/c mice purchased from The Jackson Laboratory (Bar Harbor, ME). All mice were maintained in a specific pathogen-free environment throughout the experiment at University of Texas Medical Branch (Galveston, TX).

Two-week model of allergic sensitization and challenge

Using a protocol described previously (14), mice were sensitized by two i.p. injections of RW (150 µg) and alum on days 0 and 4. On day 11, an intratracheal (i.t.) or intranasal (i.n.) instillation of RW (200 µg) was performed in anesthetized mice. Three days later on day 14, the mice were sacrificed and bronchoalveolar lavage (BAL) fluid, blood, and lung specimens were collected.

Murine rIL-18

Murine rIL-18 (MuIGIF) was generously provided by the Fujisaki Institute, Hayashibara Biochemical Labs (Okayama, Japan). The 18.1-kDa cytokine was expressed in Escherichia coli, and the purity was determined to be >99% by SDS-PAGE. The cytokine preparation was sterilized by filtration, and the endotoxin content was 1 ng/ml, as determined by Limulus amebocyte lysate assay.

Experimental protocols

IL-18 was diluted in PBS containing 1% autologous BALB/c mouse serum as a carrier protein. All PBS injections for the control groups also contained 1% autologous serum. Several protocols were used to administer IL-18 to mice (Fig. 1Go). We have previously shown that seven 1 µg IL-12 i.p. injections on days 0, 4, 5, 6 (to interfere with allergic sensitization) and days 11 and 12 (to interfere with the late phase inflammation induced by RW challenge) inhibited RW-specific IgE and eosinophil recruitment in a mouse model of asthma (14). We wished to determine whether an identical dosage and schedule of IL-18 administration would interfere with IgE production and eosinophil recruitment. To accomplish this, in the first experiment, BALB/c mice were sensitized and challenged with RW, and the treatment group was injected with seven 1 µg doses of i.p. IL-18 (RW + IL-18/RW+IL-18), whereas the control group was injected with PBS (RW/RW) (Fig. 1Go, protocol I,II).



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 1. Experimental protocols for allergic sensitization and challenge and IL-18 administration. The roman numerals correspond to the numbered experiments described in detail in Materials and Methods. Following termination, BAL was performed and serum and other samples were collected.

 
Because IL-18 is a potent inducer of IFN-{gamma}, in the second experiment we sought to define IFN-{gamma}-dependent and independent effects by repeating the same protocol of IL-18 administration in WT and IFN-{gamma}-/- mice (Fig. 1Go, protocol I,II).

In the third experiment, IL-18 or PBS was administered to mice sensitized and challenged with RW in conjunction with allergen sensitization or allergen challenge. IL-18 was administered i.p. in 1 µg doses in conjunction with allergic sensitization on days 0, 4, 5, and 6 in the RW+IL-18/RW group (Fig. 1Go, protocol IIIa), or in conjunction with allergen challenge on days 11 and 12 in the RW/RW+IL-18 group (Fig. 1Go, protocol IIIb). Mice in the control group (RW/RW) were injected with seven i.p. injections of PBS on days 0, 4, 5, 6, 11 (two injections), and 12, and mice in all groups were sacrificed on day 14.

The fourth experiment was designed to examine the effects of IL-18 administered without RW (Fig. 1Go, protocol IV). One group of naive mice was injected with seven 1 µg doses of IL-18 administered i.p. on days 0, 4, 5, 6, 11 (two injections), and 12 (IL-18 naive group). The corresponding control group of naive mice (PBS naive group) received seven i.p. administrations of PBS, and mice in both groups were sacrificed on day 14.

The fifth experiment was designed to examine the early and late effects of IL-18. Mice were sensitized with RW and treated with seven injections of i.p. PBS or 1 µg IL-18, as was done for the RW/RW and RW+IL-18/RW+IL-18 groups. However, in this experiment, the RW challenge and animal sacrifice were staggered to occur at early and later intervals. One set of PBS control- and IL-18-treated mice was challenged with RW on day 11 and sacrificed on day 14 (RW/RW, Day 14, and RW+IL-18/RW+IL-18, Day 14, respectively; Fig. 1Go, protocol Va). Another set of control and treatment mice was challenged with RW on day 18 and sacrificed on day 21 (RW/RW, day 21, and RW+IL-18/RW+IL-18, day 21; Fig. 1Go, protocol Vb). A final set of control and treatment animals was challenged with RW on day 32, and sacrificed on day 35 (RW/RW, day 35, and RW+IL-18/RW+IL-18, day 35; Fig. 1Go, protocol Vc).

The sixth experiment was designed to examine the ability of IL-18 to augment allergic sensitization. Mice were administered three i.n. doses of RW (200 µg) on days 0, 2, and 4, with concomitant administration of 500 ng IL-18 or PBS. Mice were then challenged with i.n. RW or PBS on day 11 and sacrificed on day 14 (Fig. 1Go, protocol VI).

Sample preparation

Mice were euthanized with an i.p. injection of ketamine and xylazine to perform BAL, as previously described (14). Briefly, the BAL fluids were obtained by cannulating the trachea, and lavaging the lungs with two 0.7-ml aliquots of ice-cold Dulbecco’s PBS (Sigma, St. Louis, MO). The BAL cells were pelleted, washed, and Wright Giemsa stained. The number of eosinophils, neutrophils, lymphocytes, and macrophages was determined by performing a differential count on at least 200 cells/slide of a cytocentrifuge preparation. Whole mouse lungs from different treatment groups were stored at -80°C for later mRNA extraction. Animals were bled by cardiac puncture and serum was stored at -80°C until use.

Th1 and Th2 cytokine production by splenocytes cultured with RW

Spleens were removed aseptically from experimental mice, minced, and passed through a wire mesh to generate single cell suspensions. Erythrocytes were lysed and splenocytes were incubated at 5 x 106 cells/ml with either diluent or 100 µg/ml RW for 4 days. The cells were incubated in complete medium (RPMI 1640 supplemented with 10% FCS) at 37°C in a humidified incubator with 5% CO2 atmosphere. The cell supernatants were examined for IL-4, IL-5, and IFN-{gamma} levels by ELISA.

Lung histology

Treatment and control mouse lungs were perfusion fixed with 1 ml of i.t. instilled Formalin solution (10% neutral buffered formaldehyde; Sigma). Subsequently, the lungs were embedded in paraffin, sectioned at a thickness of 4 um, and stained with hemoxylin and eosin or hemoxylin and periodic acid-Schiff for mucus staining. Lung inflammation was assessed by a pathologist blinded to the treatment groups. The degree of peribronchial and perivascular inflammation was evaluated on a subjective scale of 0, 1, 2, 3, and 4 corresponding to none, mild, moderate, marked, or severe inflammation, respectively, with an increment of 0.5 if the inflammation fell between two integers, as described previously (14, 23, 24). The total lung inflammation was defined as the sum of peribronchial and perivascular inflammation scores.

IL-4, IL-5, IFN-{gamma}, and total IgE ELISA

Two-site immunoenzymetric assays were used for measuring IL-4, IL-5, IFN-{gamma}, and total IgE, as previously described (14). Briefly, 96-well Immulon 4 microtiter plates (Dynex Technologies, Chantilly, VA) were coated and incubated overnight at 4°C with rat anti-mouse IL-4 mAb (clone 24G2; Endogen, Woburn, MA), rat anti-mouse/human IL-5 mAb (clone TRFK5; PharMingen, San Diego, CA), rat anti-mouse IFN-{gamma} mAb (clone R4-6A2; PharMingen), or rat anti-mouse IgE (clone R35-72; PharMingen). After washing, the plates were blocked with 10% Seablock (Pierce, Rockford, IL), then washed and incubated for 2 h at room temperature with the appropriate detection Abs: biotinylated rat anti-mouse IL-4 (clone 24G2; Endogen), biotinylated rat anti-mouse IL-5 (clone TRFK4; PharMingen), biotinylated rat anti-mouse IFN-{gamma} (clone XMG1.2; PharMingen), or biotinylated rat anti-mouse IgE (clone R35-118; PharMingen). Following washing, the plates were incubated with avidin-conjugated alkaline phosphatase (Sigma) for 1 h, then washed and developed with p-nitrophenol phosphate (Sigma). The lower limits of the assay systems were 1 pg/ml for IL-4, 5 pg/ml for IL-5, 9 pg/ml for IFN-{gamma}, and 96 pg/ml for total IgE.

RW-specific serum IgE, IgG1, and IgG2a ELISA

Ninety-six-well Immulon 4 microtiter plates were coated with 10 µg/ml of RW protein overnight at 4°C, washed, and blocked. After washing, plates were overlaid with diluted sera from control and treatment animals, incubated for 12 h at 4°C, washed, then incubated with biotin-conjugated rat anti-mouse IgG1 (clone G1-6.5; PharMingen), IgG2a (clone R19-5; PharMingen), or IgE (clone R35-72; PharMingen). After 2 h of incubation, the plates were washed and incubated with avidin-conjugated alkaline phosphatase, followed by washing and development with p-nitrophenol phosphate. Serum Ab concentrations were determined by comparison with a serially diluted high-titered positive control serum.

Semiquantitative RT-PCR of lung IL-5 and IFN-{gamma} mRNA

Total RNA was extracted from lungs using Triazol (Life Technologies, Grand Island, NY), according to the manufacturer’s specifications. The mRNA was reverse transcribed to first strand cDNA using oligo(dT12–15) primer (Life Technologies). Amplification of ß2-microglobulin (ß2m), IL-5, and IFN-{gamma} was performed by PCR. The primers for ß2m (forward, ATGGCTCGCTCGGTGACCCTAG, and reverse, TCATGATGCTTGATCACATGTCTCG), IL-5 (forward, GACAAGCAATGAGACGATG, and reverse, GTCACCATGGAGCAGCTCAGCC), and IFN-{gamma} (forward, TACTGCCACGGCACAGTCATTGAA, and reverse, TGGACCTGTGGGTTGTTGACCTCAAACTTGGC) were synthesized by Biosynthesis (Lewisville, TX). A 20-µl PCR was performed using PCR buffer, deoxynucleotide triphosphates, MgCl2, and Taq polymerase (Amplitaq Gold; Perkin-Elmer, Foster City, CA) in a DNA thermal cycler (Perkin-Elmer 9700). The PCR included a hot start modification at an initial denaturing step of 94°C for 10 min, followed by cycles of annealing at 55°C for 30 s, extension at 72°C for 60 s, and denaturation at 94°C for 30 s. Cycle numbers corresponding to the exponential phase were individually determined for each primer set. The cycle numbers were 19, 27, and 29 for ß2m, IFN-{gamma}, and IL-5, respectively. The PCR products were electrophoresed in a 3% agarose gel (Seakem LE Agarose; FMC Bioproducts, Rockland, ME), stained with ethidium bromide, and photographed using type 57 polaroid film (Sigma) and a UV camera. The intensity of the bands on photographs of the agarose gels was quantified by scanning the photographs with a contrast scanner (Sharp JX-330; Sharp Electronics, Mahwah, NJ) using optical software (ImageQuant, version 3.3; Molecular Dynamics, Sunnyvale, CA). The values obtained from individual cytokines were expressed as a ratio of cytokine band intensity to the intensity of the housekeeping gene, ß2m.

Data analysis

The difference in BAL cell counts, serum Ig levels, cytokine levels, and cytokine/ß2m expression levels between treatment groups was analyzed by Student’s t test for two groups and ANOVA for more than two groups. Significant ANOVAs were further analyzed by the Bonferroni posthoc test. The comparison of histology scores between the two treatment groups was analyzed using the Mann-Whitney U test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
IL-18 administered in conjunction with allergic sensitization and challenge inhibits BAL eosinophilia via production of IFN-{gamma}

Compared with the RW/RW group, IL-18 administered in conjunction with RW sensitization and challenge (RW+IL-18/RW+IL-18) reduced BAL eosinophils by 71% (p <= 0.0001; Fig. 2GoA). The same protocol also decreased BAL total cells, lymphocytes, and macrophages, indicating a global anti-inflammatory effect of this cytokine (data not shown). In addition, the same protocol of IL-18 administration reduced the degree of peribronchial (p <= 0.05), perivascular (p <= 0.01) and total lung inflammation (p <= 0.01), indicating that the anti-inflammatory effects of IL-18 were not limited to the BAL compartment (Fig. 2GoB).



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 2. Effect of IL-18 administered in conjunction with allergic sensitization and challenge on BAL eosinophilia and peribronchial and perivascular inflammation. A, BAL eosinophil cell numbers. BALB/c mice (Harlan Laboratories) were sensitized with 150 µg of RW and alum administered i.p. on days 0 and 4, followed by allergen challenge with 200 µg of RW administered i.t. on day 11 and sacrifice on day 14. The RW+IL-18/RW+IL-18 group received 1 µg of i.p. IL-18 on days 0, 4, 5, 6, 11 (twice), and 12. The RW/RW group received i.p. PBS by the same dosage schedule. B, Effect of the same IL-18 dosage schedule on peribronchial and perivascular lung inflammation. A pathologist blinded to the treatment groups evaluated the degree of peribronchial and perivascular inflammation on a scale of 0–4, with an increment of 0.5 if the inflammation fell between two integers. The total lung inflammation was defined as the sum of peribronchial and perivascular inflammation scores. Values are expressed as mean ± SEM for 10 (RW/RW), or 13 (RW+IL-18/RW+IL-18) mice. *, p <= 0.05; **, p <= 0.01; ****, p <= 0.0001 compared with the corresponding RW/RW group.

 
Because IL-18 is a potent inducer of IFN-{gamma} from NK and T cells, we sought to define the role of IFN-{gamma} in mediating the anti-eosinophilic effects of IL-18 in allergic lung inflammation. Consistent with our previous observations, administration of IL-18 to IFN-{gamma}+/+ mice in conjunction with allergic sensitization and challenge (RW+IL-18/RW+IL-18) reduced BAL eosinophil numbers by 67% (p <= 0.01) compared with the RW/RW group. In contrast, IL-18 did not inhibit eosinophil recruitment in IFN-{gamma}-/- mice. These results indicate that IFN-{gamma} is required to mediate the anti-eosinophilic effects of IL-18 (Fig. 3GoA).



View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 3. Role of IFN-{gamma} in mediating the effects of seven doses of IL-18. IFN- {gamma}+/+ (WT) or IFN-{gamma}-/- (KO) BALB/c mice (The Jackson Laboratory) were sensitized and challenged, as described in Fig. 1Go. For both WT and IFN-{gamma} KO mice, the RW+IL-18/RW+IL-18 and RW/RW groups received IL-18 or PBS by the same dosage schedule as in Fig. 1Go. A, BAL eosinophil cell numbers. Values are expressed as mean ± SEM for 8 to 10 mice per group. B– D, Splenocyte production of IFN-{gamma} (B), IL-4 (C), and IL-5 (D) after stimulation with RW. Each bar represents the concentration of cytokine produced by cells incubated with RW minus the concentration of cytokine produced by cells incubated with vehicle (PBS). Values are expressed as mean ± SEM for three to five mice. *, p <= 0.05; **, p <= 0.01 compared with the RW/RW group.

 
IL-18 treatment stimulates Th1 and Th2 cytokines from splenocytes cultured with RW

IL-18 has been reported to be a weak stimulator of Th1 differentiation in the presence of IL-12 (25, 26). To test the Th1-promoting effects of IL-18 administered during allergic sensitization and challenge in our allergic model, splenocytes from these animals were cultured with RW, and the cell supernatants were examined for Th1 and Th2 cytokines. Treatment with IL-18 (RW+IL-18/RW+IL-18) increased the production of IFN-{gamma} from WT splenocytes cultured with RW compared with the RW/RW group (p <= 0.05; Fig. 3GoB). Unexpectedly, treatment with IL-18 greatly increased production of IL-4 and IL-5 from splenocytes cultured with RW, suggesting a Th2-promoting effect of IL-18 (p <= 0.01; Fig. 3Go, C and D). A similar augmentation of IL-5 production was also demonstrated in IFN-{gamma} KO mice, indicating that this effect was independent of IFN-{gamma}.

We have previously shown that RW-specific serum levels of IgE increase 100-fold in the mouse model of allergic asthma employed in this study (14). We hypothesized that because IL-18 stimulates IFN-{gamma} production that mediates its inhibitory effects on eosinophil recruitment, IL-18 should increase serum IgG2a and reduce IgE and IgG1. As predicted, administration of IL-18 (RW+IL-18/RW+IL-18) significantly increased serum levels of RW-specific IgG2a in IFN-{gamma}+/+ mice, but not in IFN-{gamma}-/- mice. These results indicate that IL-18 treatment stimulates Ig class switching to IgG2a and that the effect is mediated by IFN-{gamma} (Table IGo). Unexpectedly, IL-18 administration increased production of RW-specific IgE and IgG1 in serum, effects that are consistent with augmentation of a Th2 phenotype (Table IGo).


View this table:
[in this window]
[in a new window]
  		Table I. RW-specific serum IgG2a, IgE, and IgG11

 
To assess the ability of IL-18 to promote IgE production independent of allergic sensitization and challenge, naive mice were administered seven 1 µg doses of IL-18 by the same dosage schedule used in allergic animals. IL-18 treatment of naive mice (IL-18 naive) increased total serum IgE concentration to 287.7 ± 71.4 ng/ml, a significant 5-fold increase (p <= 0.01) compared with the 54.4 ± 6 ng/ml total serum IgE concentration of the PBS-treated naive mice (PBS naive). These results indicate that IL-18 increases IgE independent of the effects of allergen or alum. However, IL-18 treatment of naive mice did not alter BAL eosinophils, total cells, neutrophils, lymphocytes, and macrophages (data not shown).

Differential effects of IL-18 administered during sensitization and challenge

We wished to test whether the anti-eosinophilic effects of IL-18 were dependent on timing of IL-18 administration with respect to allergic sensitization or allergen challenge. Administration of IL-18 at the time of allergen challenge (RW/RW+IL-18) decreased BAL eosinophil numbers by 89% (p <= 0.01) compared with the corresponding RW/RW group (Fig. 4GoA). In contrast, administration of IL-18 in conjunction with allergic sensitization (RW+IL-18/RW) increased BAL eosinophil numbers by 137% (p <= 0.05) compared with the RW/RW group. These results indicate that the time of IL-18 administration in relation to allergic sensitization and challenge influences the anti-eosinophilic effects of IL-18, and that IL-18 administered in conjunction with allergic sensitization can exacerbate allergic lung eosinophilia. The administration of IL-18 in conjunction with allergic sensitization (RW+IL-18/RW) significantly augmented RW-specific serum IgG1 levels relative to the corresponding RW/RW group (Table IIGo). Serum IgE and IgG2a levels were not altered in the RW+IL-18/RW or RW/RW+IL-18 groups. IL-18 administered in conjunction with allergic sensitization, but not allergen challenge, also increased IL-4 production from splenocytes cultured with RW (Fig. 4GoC). These results are consistent with a Th2-promoting effect of IL-18 administered at the time of allergic sensitization.



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 4. Differential effects of IL-18 administered in conjunction with allergic sensitization or challenge. BALB/c mice (Harlan Laboratories) were sensitized and challenged, as described in Fig. 1Go. Mice in the RW+IL-18/RW group received 1 µg of IL-18 administered i.p. on days 0, 4, 5, and 6 in conjunction with allergic sensitization. The RW/RW+IL-18 group received the same dose of IL-18 on day 11 (twice) and day 12 in conjunction with allergic challenge. The RW/RW group received i.p. PBS on days 0, 4, 5, 6, 11 (twice), and 12. A, BAL eosinophil numbers for the three treatment groups. Values are expressed as mean ± SEM for five to seven animals per group. B–D, RW-stimulated production of IFN-{gamma} (B), IL-4 (C), and IL-5 (D), from splenocytes derived from individual mice. Each bar represents the concentration of cytokine produced by cells incubated with RW minus the concentration of cytokine produced by cells incubated with vehicle (PBS). Values are expressed as mean ± SEM for five or six mice. *, p <= 0.05; **, p <= 0.01 compared with the RW/RW group; +, p <= 0.05 compared with the RW+IL-18/RW group.

 

View this table:
[in this window]
[in a new window]
  		Table II. The effects of IL-18 dosage timing on RW-specific serum Iga

 
Administration of IL-18 in conjunction with allergic sensitization or allergen challenge induced differential patterns of cytokine mRNA expression in the lung determined by semiquantitative RT-PCR. IL-18 administered with allergen challenge (RW/RW+IL-18) increased lung expression of IFN-{gamma} compared with the RW/RW control group without altering IL-5 mRNA expression (Fig. 5Go). In contrast, IL-18 administered with allergic sensitization (RW+IL-18/RW) up-regulated lung IL-5 and IFN-{gamma} mRNA expression. These mRNA expression patterns suggest that increased lung IL-5 production may have stimulated the allergen-induced BAL eosinophilia demonstrated by the RW+IL-18/RW group, whereas increased lung IFN-{gamma} production without alteration of IL-5 production may have reduced BAL eosinophilia in the RW/RW+IL-18 group.



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 5. Lung expression of IL-5 and IFN-{gamma}, as measured by semiquantitative RT-PCR. Total RNA was isolated from the lungs of mice in the RW+IL-18/RW, RW/RW+IL-18, and RW/RW groups. RT-PCR was performed using primers specific for murine IL-5, IFN-{gamma}, and ß2m. A, The ratio of lung IL-5 expression to lung ß2m expression. B, The ratio of lung IFN-{gamma} expression to lung ß2m expression. Values are expressed as the mean ± SEM for three to seven mice per group. **, p <= 0.01; ***, p <= 0.001 compared with the RW/RW group.

 
Augmentation of eosinophil recruitment with maturation of IL-18 effects

Because our findings indicated that IL-18 administration in conjunction with allergic sensitization and challenge inhibited eosinophilic lung inflammation while simultaneously promoting the production of IgE and Th2 cytokines, we sought to determine whether the latter effects would eventually override the IFN-{gamma}-mediated suppression of eosinophil recruitment. Experiments were conducted in which sensitized mice received seven injections of PBS or IL-18, as described previously, followed by allergen challenge and animal sacrifice at three different time points. As demonstrated before, when mice were challenged with RW on day 11, IL-18 administration inhibited BAL eosinophil numbers on day 14 (p <= 0.05; Fig. 6Go). In contrast, the allergen-induced BAL eosinophil recruitment increased with the time elapsed after IL-18 administration, and by day 35, 23 days following the last administration of IL-18, BAL eosinophil numbers were increased by 111% in the IL-18-treated group compared with the RW/RW control group (p <= 0.05). These results indicate that IL-18 has biphasic effects in the mouse model of asthma. Initially, IL-18 treatment inhibits allergen-induced BAL eosinophil recruitment via IFN-{gamma} production. Subsequently, as its effect on the animal matures and the initially dominant IFN-{gamma}-dependent effects dissipate, IL-18 augments eosinophil recruitment.



View larger version (10K):
[in this window]
[in a new window]
  		FIGURE 6. The early and late occurring effects of IL-18 administration on allergen-induced BAL eosinophilia. Mice were sensitized with i.p. RW and alum on days 0 and 4, and administered PBS or IL-18 on days 0, 4, 5, 6, 11 (twice), and 12. One set of control (RW/RW)- and IL-18-treated (RW+IL-18/RW+IL-18) mice were challenged with i.n. RW (200 µg) on day 11 and sacrificed on day 14. Another set of control and treatment mice was challenged with i.n. RW on day 18 and sacrificed on day 21, and the final set of control and treatment animals was challenged with RW on day 32, and sacrificed on day 35. The sacrifice/BAL day for each set of control and IL-18 treatment animals is shown on the abscissa. Values are expressed as the mean ± SEM for three to six mice per group. *, p <= 0.05 compared with the respective RW/RW group.

 
IL-18 treatment augments allergic sensitization

To determine whether IL-18 could promote allergic sensitization in conjunction with airway exposure to RW, mice were administered three i.n. doses of RW mixed with either PBS or IL-18, then challenged 1 wk later with PBS or RW. As expected, PBS challenge of mice 7 days after the last dose of i.n. RW+PBS in the control group (i.n. RW/PBS) did not induce BAL eosinophilia. Unexpectedly, PBS challenge of mice 7 days after the last dose of i.n. RW+IL-18 (i.n. RW+IL-18/PBS) induced 900% greater BAL eosinophil numbers (p <= 0.0001; Fig. 7GoA) compared with the control group. These results suggest that the substitution of PBS with IL-18 during the three initial i.n. doses of RW rapidly increased recruitment of eosinophils to the lung, and some of the recruited eosinophils were retained in the lung 10 days later. Similarly, the i.n. RW/PBS group did not demonstrate appreciable mucus secretion by airway epithelium, but mucus-containing goblet cells were substantially increased in the i.n. RW+IL-18/PBS group (Fig. 8Go). To examine the mechanism of these unexpected findings, we quantified RW-specific serum IgE and RW-induced Th2 cytokine production by splenocytes from the mice challenged with PBS. The i.n. RW+IL-18/PBS group demonstrated 66-fold greater RW-specific serum IgE (p <= 0.01) than the control group, and 63-fold (p <= 0.01) and 44-fold (p <= 0.001) greater IL-4 and IL-5 production, respectively, from splenocytes cultured with RW (Fig. 7Go, B, C, and D). These results strongly suggest that IL-18 administered i.n. with RW increased allergic sensitization to RW. Further evidence of an induction of allergic sensitization by i.n. administration of IL-18 with RW comes from the observed effects of RW challenge performed in the two groups of mice 7 days after the three i.n. doses of RW+PBS or RW+IL-18. Administration of IL-18 in conjunction with RW in the i.n. RW+IL-18/RW group increased BAL eosinophil recruitment 456% (p <= 0.0001) compared with the control group (i.n. RW/RW) (Fig. 7GoA). Peribronchial and perivascular inflammation was also increased in the i.n. RW+IL-18/RW group, indicating that the proinflammatory effects of IL-18 were not confined to the BAL compartment (Fig. 9Go). Taken together, these results provide compelling evidence that IL-18 administered i.n. with RW dramatically increased allergic sensitization to RW.



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 7. Administration of IL-18 plus RW i.n. augments allergic sensitization to RW. Mice were administered 200 µg of i.n. RW on days 0, 2, and 4, then challenged i.n. with PBS or 200 µg RW on day 11, followed by sacrifice on day 14. In the IL-18 treatment groups (i.n. RW+IL-18/RW and i.n. RW+IL-18/PBS), mice received 500 ng of i.n. IL-18 in conjunction with the RW doses on days 0, 2, and 4. In the control groups (i.n. RW/RW and RW/PBS), mice received i.n. PBS in the place of IL-18. A, BAL eosinophils/ml for control- and IL-18-treated mice following i.n. challenge with PBS or RW. Values are expressed as mean ± SEM for 4–5 animals (PBS challenge), or 10–11 mice (RW challenge). B, Serum levels of RW-specific IgE for PBS-challenged mice. Values are expressed as mean ± SEM for four to five mice. C and D, RW-stimulated production of IL-4 and IL-5 from splenocytes obtained from PBS-challenged mice. Values are expressed as mean ± SEM for four to five mice. **, p < 0.01; ***, p < .001; ****, p < 0.0001.

 


View larger version (78K):
[in this window]
[in a new window]
  		FIGURE 8. Intranasally administered IL-18 augments the number of mucus-secreting goblet cells in the airway epithelium. The lungs of mice from the i.n. RW/PBS and i.n. RW+IL-18/PBS groups were fixed in Formalin, embedded in paraffin, sectioned, and stained with hematoxylin and periodic acid-Schiff. Representative sections are shown at x100 magnification. A, A lung section from the i.n. RW/PBS group showing few mucus-containing cells. B, A lung section from the i.n. RW+IL-18/PBS group showing hypertrophy and hyperplasia of bronchial goblet cells containing mucus. Epithelial cells, mucus-staining goblet cells, bronchi, and vessels are denoted by e, m, b, and v, respectively.

 


View larger version (66K):
[in this window]
[in a new window]
  		FIGURE 9. Intranasally administered IL-18 augments peribronchial and perivascular inflammation. The photographs are of lung sections from representative animals in each group at x40 magnification. Vessels and bronchi are denoted by v and b, respectively. A, A lung from the i.n. RW/RW group with grade 1.0 peribronchial inflammation, grade 0 perivascular inflammation, and grade 1.0 total lung inflammation. B, A lung from the i.n. RW+IL-18/RW group with grade 4.0 peribronchial inflammation, grade 2.5 perivascular inflammation, and grade 6.5 total lung inflammation. C, The peribronchial, perivascular, and total lung inflammation scores for mice in the i.n. RW/RW and i.n. RW+IL-18/RW groups. Values are expressed as mean ± SEM for five or six mice. *, p <= 0.05; **, p <= 0.01.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The results of this study indicate that administration of IL-18 in conjunction with allergic sensitization and allergen challenge inhibited recruitment of eosinophils to the lung. This effect, like many previously described in vivo effects of IL-18, was critically mediated by IFN-{gamma}. Similarly, IL-18 administered in conjunction with allergen challenge reduced BAL eosinophilia. Paradoxically, administration of IL-18 in conjunction with allergic sensitization and allergen challenge increased serum IgE and IgG1 levels, and increased IL-4 and IL-5 production from splenocytes cultured with RW. When the effects of the same IL-18 treatment schedule were allowed to mature for 3 wk, the inhibition of eosinophil recruitment was replaced by augmentation of eosinophil recruitment. Also, IL-18 administered in naive mice induced IgE production. Finally, intrapulmonary administration of IL-18 with RW dramatically increased BAL eosinophilia, airway mucus, RW-specific serum IgE production, and RW-stimulated Th2 cytokine production from splenocytes, indicating that IL-18 augments allergic sensitization.

The effects of IL-18 have been previously assessed in murine models of allergic asthma by Hofstra et al. (27), and Kumano et al. (28), with differing outcomes. In the study by Hofsta et al., even though the combination of IL-18 and IL-12 inhibited Ag-induced airway hyperresponsiveness, lung eosinophilia, and serum IgE, administration of either IL-12 or IL-18 alone failed to modulate any of the allergic responses. Although the present study and the study by Hofstra et al. employed similar IL-18 dosages, the two studies differ strikingly in the allergic models that were used. The present study employed a 2-wk model involving two sensitizing doses of RW plus alum, and a single i.t. or i.n. RW challenge, and the study by Hofstra et al. utilized an immunization protocol involving seven i.p. OVA injections without adjuvant for sensitization, and eight aerosolized OVA challenges. In a recent study by Kumano et al., two 10 or 20 µg doses of IL-18 administered i.p. before OVA challenge enhanced eosinophil recruitment into the lungs of sensitized mice 48 h after challenge (28). These results are consistent with some of the findings in the present study, but elevated Th2 cytokines were not demonstrated in the Kumano et al. study. Although it is difficult to pinpoint the reasons IL-18 stimulated variable effects in the three studies, it is possible that the differences in the models may explain differences in the findings. As increasing knowledge of the effects of IL-18 in allergy emerge, elucidation of the specific immunological environments presented by different study models may prove valuable in understanding the scope of IL-18 activity.

Although IFN-{gamma} was a critical mediator of the anti-eosinophilic effects of IL-18 administered with allergic sensitization and challenge in this study, the cellular source of IFN-{gamma} was not determined. Because IL-18 treatment increased IFN-{gamma} from splenocytes cultured with RW, it is possible that IL-18 stimulated the development of Th1 cells. IL-18 has been reported to induce Th1 differentiation independent of IL-12, although the effect was more pronounced in the presence of IL-12 (25, 26). However, in another study, Robinson et al. (29) suggested that IL-18 was unable to independently drive Th1 development in BALB/c mice, the experimental animals that were used in the present study. Indeed, the amount of IFN-{gamma} produced by RW-stimulated splenocytes in this study is much smaller than what we have demonstrated in a previous study following the same protocol of administration of IL-12 in the same murine model of asthma (14). Also, in the mice that received IL-18 only in conjunction with allergic challenge (RW/RW+IL-18 group), BAL eosinophilia was significantly reduced and lung IFN-{gamma} expression was significantly augmented, but production of IFN-{gamma} from spleen cells cultured with RW was not increased. These findings suggest that IL-18 administration in this study may have stimulated IFN-{gamma} production from a variety of cells, such as B cells and/or NK cells, rather than primarily inducing development of Ag-specific Th1 cells.

In our study, IL-18 dramatically stimulated allergic sensitization. The administration of i.n. IL-18 with RW increased production of BAL eosinophilia, RW-specific IgE, airway mucus, and Th2 cytokines from splenocytes cultured with RW. In this experiment, IL-18 acted as mucosal sensitization adjuvant when administered with a protein immunogen such as RW. However, IL-18 administration to naive animals increased production of total serum IgE, suggesting that IL-18 can stimulate IgE class switching in the absence of a protein immunogen. These effects could involve a variety of cellular interactions, including direct or indirect stimulation of B cell IgE class switching or Th2 cell differentiation and/or Th2 cell proliferation, and elucidation of the precise mechanisms will require further study.

Hypothetically, the IL-18-induced production of IgE and IgG1 may have resulted from direct effects of IL-18 on B cell class switching, or secondary to increased Th2 cytokines resulting from IL-18 administration. IL-18 administration in conjunction with allergic sensitization and allergen challenge stimulated IL-4 production from splenocytes cultured with RW. A similar increase in Ag-induced IL-4 production in vivo may account for the increased serum IgE, as IL-4 is a known inducer of IgE class switching (30). IL-18 in combination with IL-12 has been shown to suppress the production of IgE in activated B cells (31), and IL-18 alone was reported to have no effect on IgE production in purified splenic B cells (32). Thus, in the present study, it seems probable that the increased serum IgE was mediated by increased IL-4 production from Th2 cells, and not direct B cell activation by IL-18.

A plausible scenario is that IL-18 induces the production of other cytokines that promote Th2 differentiation or proliferation. IL-4 strongly promotes Th2 differentiation and IgE class switching; however, it has been reported that IL-18 did not induce IL-4 production from splenocytes derived from animals pretreated with IL-2 (21) or from a Th2 cell clone (33). Given IL-18 induction of IL-4 has only been examined in these specifically conditioned cell populations, more study in this area seems warranted, particularly in cell populations known to express the IL-18R. Although Th2 cells readily synthesize IL-4, Th2 cells reportedly do not express the IL-18R (34). IL-13 is also an important regulator of Th2 differentiation and contributes to IgE class switching in mice (35, 36). Recently, Hoshino et al. (21) reported that in vitro treatment with IL-18 plus IL-2 was able to stimulate production of IL-13 from NK and T cells obtained from C57BL/6 mice. IL-13 was only induced, however, in splenocyte populations with expanded T cell and NK cell components produced by pretreating the mice with IL-2, and was not induced in splenocytes from untreated mice. Although it is not known what role IL-13 may have played in the present study, the mice were not pretreated with IL-2, and thus IL-18 may not have stimulated IL-13. IL-18 has also been reported to stimulate IL-10 production in mouse spleen cell cultures (37). IL-10 is not a strong candidate for mediating the effects of IL-18, however, because it has not been reported to stimulate Th2 differentiation, and prior studies disagree as to whether IL-10 stimulates IgE production (38) or inhibits IgE production (39, 40). Finally, the induction of IL-1ß by IL-18 could represent a proinflammatory pathway contributing to Th2 cell proliferation. IL-1{alpha} and IL-1ß have been reported to stimulate Th2 cell proliferation via the IL-1R after TCR costimulation (41). Also, in a manner similar to the effects of IL-18 in the present study, IL-1{alpha} and IL-1ß were recently reported to be effective adjuvants for mucosal and systemic immune responses when coadministered with protein immunogens (42).

As indicated above, the Th2-promoting effects of IL-18 can be narrowed down to the most plausible sites of action (Fig. 10Go). IL-4 and IL-13 stimulate Th2 differentiation, and IL-1ß promotes Th2 cell proliferation, so it seems plausible that IL-18 may produce an expanded Th2 cell population via the actions of one or more of these cytokines. It is unlikely that IL-18 directly stimulates Th2 cell differentiation, because IL-18 reportedly does not directly stimulate Th2 cells (29, 33), and Th2 cells reportedly do not express the IL-18R (34). Mixed T cell populations, when cultured with IL-12, but before Th1 differentiation, have been shown to express IL-18R, however, indicating that non-Th1 T cells at specific stages of differentiation may be directly responsive to IL-18 (43). Similarly, CD4+, CD8+, and CD4-CD8- T cells have been shown to express the IL-18R, but only upon stimulation in the presence of IL-12 (44). Although it is uncertain what effects IL-18 could produce in these cell populations in variable in vivo environments, because of the obligatory preexposure to IL-12, IFN-{gamma} synthesis would be the expected result. Still, IL-18 has been shown to stimulate IL-13 protein synthesis from purified T cells (21), suggesting that under some conditions, IL-18 can stimulate T cells expressing the IL-18R to produce a Th2 cytokine. NK cells may also play a role in mediating the effects of IL-18 as they express the IL-18R (45), and produce IL-13 and IL-5 (21, 46). Consistent with this premise, NK cells have been reported to contribute to the development of Ag-specific IgE, increased BAL levels of IL-4 and IL-5, and eosinophilic airway inflammation in a murine model of allergic asthma (47). Similarly, NK1 T cells have been reported to rapidly produce large quantities of IL-4 upon ligation of surface CD1 (48). IL-18 has been shown to stimulate the lytic activity of isolated NK1 T cells (49), suggesting the IL-18R is present in this cell population, and that IL-18 potentially stimulates other NK1 T cell activities, including the rapid production of IL-4.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 10. Possible IL-18-induced pathways for Th2 differentiation and proliferation. Immune cells that may contribute to the production of IL-4 and IL-13 may include NK or NK1 T cells. Alternately, IL-18 may directly stimulate undifferented T cells that express the IL-18R in some conditions. The immune cells that produce IL-18 are predominantly mononuclear cells.

 
In view of reports that bacterial sinusitis can exacerbate asthma in children and adults (50, 51), it is tempting to speculate that IL-18 may mediate these effects particularly in view of its ability to augment allergic sensitization. Microbial products such as LPS (52, 53), and specific bacterial DNA sequences (22) have been reported to stimulate macrophage production of IL-18, suggesting that bacterial infections can stimulate the production of IL-18. In conformity with human asthma, in the present study, IL-18 stimulated prolonged airway eosinophilia and increased mucus production by airway epithelium. Recently, IL-18 was reported to be constitutively expressed in normal human lung, and down-regulated in the lungs of six mild asthmatics (54). Although it is premature to draw major conclusions from a study with a small sample size, this evidence may suggest that endogenous IL-18 does not augment airway eosinophilia in ongoing mild asthma, but it does not exclude the possibility that IL-18 is up-regulated in asthma exacerbations initiated by bacterial sinusitis. Also, in the present study, intrapulmonary administration of IL-18 with RW potently induced allergic sensitization to RW, suggesting that IL-18 may be a critical factor initiating allergic sensitization in asthmatic patients. Indeed, large scale epidemiological studies strongly suggest that allergic sensitization manifested by atopy and allergic rhinitis precedes the onset of asthma symptoms by a period of years (55, 56, 57).

In summary, this is the first report demonstrating that IL-18 differentially modulates allergen-induced eosinophilic inflammation, promotes a Th2 phenotype, and potently induces allergic sensitization. These results suggest that IL-18 may contribute to the pathogenesis of allergic asthma.


   Footnotes
 
1 This work was supported in part by National Institutes of Health Grants K08 AI01539 and P01 AI46004, and the James W. McLaughlin Fellowship Fund. Back

2 Address correspondence and reprint requests to Dr. Sanjiv Sur, Department of Internal Medicine, Division of Allergy and Immunology, University of Texas Medical Branch, Galveston, TX 77555-0762. E-mail address: Back

3 Abbreviations used in this paper: KO, knockout; ß2m, ß2-microglobulin; BAL, bronchoalveolar lavage; i.n., intranasal; i.t., intratracheal; RW, ragweed allergen; WT, wild-type. Back

Received for publication September 22, 1999. Accepted for publication December 22, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Robinson, D., Q. Hamid, A. Bentley, S. Ying, A. B. Kay, S. R. Durham. 1993. Activation of CD4+ T cells, increased TH2-type cytokine mRNA expression, and eosinophil recruitment in bronchoalveolar lavage after allergen inhalation challenge in patients with atopic asthma. J. Allergy Clin. Immunol. 92:313.[Medline]
  2. Robinson, D. S., Q. Hamid, S. Ying, A. Tsicopoulos, J. Barkans, A. M. Bentley, C. Corrigan, S. R. Durham, A. B. Kay. 1992. Predominant TH2-like bronchoalveolar T-lymphocyte population in atopic asthma. N. Engl. J. Med. 326:298.[Abstract]
  3. Coyle, A. J., G. Le Gros, C. Bertrand, S. Tsuyuki, C. H. Heusser, M. Kopf, G. P. Anderson. 1995. Interleukin-4 is required for the induction of lung Th2 mucosal immunity. Am. J. Respir. Cell Mol. Biol. 13:54.[Abstract]
  4. Brusselle, G., J. Kips, G. Joos, H. Bluethmann, R. Pauwels. 1995. Allergen-induced airway inflammation and bronchial responsiveness in wild-type and interleukin-4-deficient mice. Am. J. Respir. Cell Mol. Biol. 12:254.[Abstract]
  5. Nakajima, H., I. Iwamoto, S. Tomoe, R. Matsumura, H. Tomioka, K. Takatsu, S. Yoshida. 1992. CD4+ T-lymphocytes and interleukin-5 mediate antigen-induced eosinophil infiltration into the mouse trachea. Am. Rev. Respir. Dis. 146:374.[Medline]
  6. Mauser, P. J., A. M. Pitman, X. Fernandez, S. K. Foran, G. K. Adams, W. Kreutner, R. W. Egan, R.W. Chapman. 1995. Effects of an antibody to interleukin-5 in a monkey model of asthma. Am. J. Respir. Crit. Care Med. 152:467.[Abstract]
  7. Nakajima, H., I. Iwamoto, S. Yoshida. 1993. Aerosolized recombinant interferon-{gamma} prevents antigen-induced eosinophil recruitment in mouse trachea. Am. Rev. Respir. Dis. 148:1102.[Medline]
  8. Iwamoto, I., H. Nakajima, H. Endo, S. Yoshida. 1993. Interferon {gamma} regulates antigen-induced eosinophil recruitment into the mouse airways by inhibiting the infiltration of CD4+ T cells. J. Exp. Med. 177:573.[Abstract/Free Full Text]
  9. Afonso, L. C., T. M. Scharton, L. Q. Vieira, M. Wysocka, Trinchieri, and P. Scott. 1994. The adjuvant effect of interleukin-12 in a vaccine against Leishmania major. Science 263:235.
  10. Hsieh, C. S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, K. M. Murphy. 1993. Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science 260:547.[Abstract/Free Full Text]
  11. Seder, R. A., R. Gazzinelli, A. Sher, W. E. Paul. 1993. Interleukin 12 acts directly on CD4+ T cells to enhance priming for interferon {gamma} production and diminishes interleukin 4 inhibition of such priming. Proc. Natl. Acad. Sci. USA 90:10188.[Abstract/Free Full Text]
  12. Gavett, S. H., D. J. O’Hearn, X. Li, S. K. Huang, F. D. Finkelman, M. Wills-Karp. 1995. Interleukin 12 inhibits antigen-induced airway hyperresponsiveness, inflammation, and Th2 cytokine expression in mice. J. Exp. Med. 182:1527.[Abstract/Free Full Text]
  13. Kips, J. C., G. J. Brusselle, G. F. Joos, R. A. Peleman, J. H. Tavernier, R. R. Devos, R. A. Pauwels. 1996. Interleukin-12 inhibits antigen-induced airway hyperresponsiveness in mice. Am. J. Respir. Crit. Care Med. 153:535.[Abstract]
  14. Sur, S., J. Lam, P. Bouchard, A. Sigounas, D. Holbert, W. J. Metzger. 1996. Immunomodulatory effects of IL-12 on allergic lung inflammation depend on timing of doses. J. Immunol. 157:4173.[Abstract]
  15. Yoshimoto, T., H. Okamura, Y. I. Tagawa, Y. Iwakura, K. Nakanishi. 1997. Interleukin 18 together with interleukin 12 inhibits IgE production by induction of interferon-{gamma} production from activated B cells. Proc. Natl. Acad. Sci. USA 94:3948.[Abstract/Free Full Text]
  16. Munder, M., M. Mallo, K. Eichmann, M. Modolell. 1998. Murine macrophages secrete interferon {gamma} upon combined stimulation with interleukin (IL)-12 and IL-18: a novel pathway of autocrine macrophage activation. J. Exp. Med. 187:2103.[Abstract/Free Full Text]
  17. Osaki, T., J. M. Peron, Q. Cai, H. Okamura, P. D. Robbins, M. Kurimoto, M. T. Lotze, H. Tahara. 1998. IFN-{gamma}-inducing factor/IL-18 administration mediates IFN-{gamma}- and IL-12-independent antitumor effects. J. Immunol. 160:1742.[Abstract/Free Full Text]
  18. Ohtsuki, T., M. J. Micallef, K. Kohno, T. Tanimoto, M. Ikeda, M. Kurimoto. 1997. Interleukin 18 enhances Fas ligand expression and induces apoptosis in Fas-expressing human myelomonocytic KG-1 cells. Anticancer Res. 17:3253.[Medline]
  19. Tsutsui, H., K. Matsui, N. Kawada, Y. Hyodo, N. Hayashi, H. Okamura, K. Higashino, K. Nakanishi. 1997. IL-18 accounts for both TNF-{alpha}- and Fas ligand-mediated hepatotoxic pathways in endotoxin-induced liver injury in mice. J. Immunol. 159:3961.[Abstract]
  20. Puren, A. J., G. Fantuzzi, Y. Gu, M. S. Su, C. A. Dinarello. 1998. Interleukin-18 (IFN{gamma}-inducing factor) induces IL-8 and IL-1ß via TNF{alpha} production from non-CD14+ human blood mononuclear cells. J. Clin. Invest. 101:711.[Medline]
  21. Hoshino, T. W. R.. 1999. IL-18 is a potent coinducer of IL-13 in NK and T cells: a new potential role for IL-18 in modulating the immune response. J. Immunol. 162:5070.[Abstract/Free Full Text]
  22. Roman, M., E. Martin-Orozco, J. S. Goodman, M. D. Nguyen, Y. Sato, A. Ronaghy, R. S. Kornbluth, D. D. Richman, D. A. Carson, E. Raz. 1997. Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat. Med. 3:849.[Medline]
  23. Sur, S., J. S. Wild, B. K. Choudhury, N. Sur, R. Alam, D. M. Klinman. 1999. Long term prevention of allergic lung inflammation in a mouse model of asthma by CpG oligodeoxynucleotides. J. Immunol. 162:6284.[Abstract/Free Full Text]
  24. Ashcroft, T., J. M. Simpson, V. Timbrell. 1988. Simple method of estimating severity of pulmonary fibrosis on a numerical scale. J. Clin. Pathol. 41:467.[Abstract/Free Full Text]
  25. Micallef, M. J., T. Ohtsuki, K. Kohno, F. Tanabe, S. Ushio, M. Namba, T. Tanimoto, K. Torigoe, M. Fujii, M. Ikeda, et al 1996. Interferon-{gamma}-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon-{gamma} production. Eur. J. Immunol. 26:1647.[Medline]
  26. Takeda, K., H. Tsutsui, T. Yoshimoto, O. Adachi, N. Yoshida, T. Kishimoto, H. Okamura, K. Nakanishi, S. Akira. 1998. Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity 8:383.[Medline]
  27. Hofstra, C. L., I. Van Ark, G. Hofman, M. Kool, F. P. Nijkamp, A. J. Van Oosterhout. 1998. Prevention of Th2-like cell responses by coadministration of IL-12 and IL-18 is associated with inhibition of antigen-induced airway hyperresponsiveness, eosinophilia, and serum IgE levels. J. Immunol. 161:5054.[Abstract/Free Full Text]
  28. Kumano, K., A. Nakao, H. Nakajima, F. Hayashi, M. Kurimoto, H. Okamura, Y. Saito, I. Iwamoto. 1999. Interleukin-18 enhances antigen-induced eosinophil recruitment into the mouse airways. Am. J. Respir. Crit. Care Med. 160:873.[Abstract/Free Full Text]
  29. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, S. B. Sana, S. Hartley, R. Menon, F. Bazan Kastelein, A. O’Garra. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-{gamma} production and activates IRAK and NF{kappa}B. Immunity 7:571.[Medline]
  30. Coffman, R. L., J. Ohara, M. W. Bond, J. Carty, A. Zlotnik, W. E. Paul. 1986. B cell stimulatory factor-1 enhances the IgE response of lipopolysaccharide-activated B cells. J. Immunol. 136:4538.[Abstract]
  31. Yoshimoto, T., N. Nagai, K. Ohkusu, H. Ueda, H. Okamura, K. Nakanishi. 1998. LPS-stimulated SJL macrophages produce IL-12 and IL-18 that inhibit IgE production in vitro by induction of IFN-{gamma} production from CD3intIL-2R ß+ T cells. J. Immunol. 161:1483.[Abstract/Free Full Text]
  32. Lauwerys, B. R., J. C. Renauld, F. A. Houssiau. 1998. Inhibition of in vitro immunoglobulin production by IL-12 in murine chronic graft-vs.-host disease: synergism with IL-18. Eur. J. Immunol. 28:2017.[Medline]
  33. Kohno, K., J. Kataoka, T. Ohtsuki, Y. Suemoto, I. Okamoto, M. Usui, M. Ikeda, M. Kurimoto. 1997. IFN-{gamma}-inducing factor (IGIF) is a costimulatory factor on the activation of Th1 but not Th2 cells and exerts its effect independently of IL-12. J. Immunol. 158:1541.[Abstract]
  34. Xu, D., W. L. Chan, B. P. Leung, D. Hunter, K. Schulz, R. W. Carter, I. B. McInnes, J. H. Robinson, F. Y. Liew. 1998. Selective expression and functions of interleukin 18 receptor on T helper (Th) type 1 but not Th2 cells. J. Exp. Med. 188:1485.[Abstract/Free Full Text]
  35. McKenzie, G. J., C. L. Emson, S. E. Bell, S. Anderson, P. Fallon, G. Zurawski, R. Murray, R. Grencis, A. N. McKenzie. 1998. Impaired development of Th2 cells in IL-13-deficient mice. Immunity 9:423.[Medline]
  36. Emson, C. L., S. E. Bell, A. Jones, W. Wisden, A. N. McKenzie. 1998. Interleukin (IL)-4-independent induction of immunoglobulin (Ig)E, and perturbation of T cell development in transgenic mice expressing IL-13. J. Exp. Med. 188:399.[Abstract/Free Full Text]
  37. Micallef, M. J., T. Tanimoto, K. Kohno, M. Ikeda, H. Ikegami, M. Kurimoto. 1998. Augmentation of in vitro interleukin 10 production after in vivo administration of interleukin 18 is activated macrophage-dependent and is probably not involved in the antitumor effects of interleukin 18. Anticancer Res. 18:4267.[Medline]
  38. Ohmori, H., T. Kanda, T. Takai, M. Hikida. 1995. Induction of antigen-specific IgE response in murine lymphocytes by IL-10. Immunol. Lett. 47:127.[Medline]
  39. Punnonen, J., M. de Waal, P. van Vlasselaer, J. F. Gauchat, J. E. de Vries. 1993. IL-10 and viral IL-10 prevent IL-4-induced IgE synthesis by inhibiting the accessory cell function of monocytes. J. Immunol. 151:1280.[Abstract]
  40. Dobber, R., M. Tielemans, L. Nagelkerken. 1995. The in vivo effects of neutralizing antibodies against IFN-{gamma}, IL-4, or IL-10 on the humoral immune response in young and aged mice. Cell. Immunol. 160:185.[Medline]
  41. Huber, M., A. Rutherford, W. Meister, A. Weiss, M. Rollinghoff, M. Lohoff. 1996. TCR- and IL-1-mediated co-stimulation reveals an IL-4-independent way of Th2 cell proliferation. Int. Immunol. 8:1257.[Abstract/Free Full Text]
  42. Staats, H. F., Jr F. A. Ennis. 1999. IL-1 is an effective adjuvant for mucosal and systemic immune responses when coadministered with protein immunogens. J. Immunol. 162:6141.[Abstract/Free Full Text]
  43. Yoshimoto, T., K. Takeda, T. Tanaka, K. Ohkusu, S. Kashiwamura, H. Okamura, S. Akira, K. Nakanishi. 1998. IL-12 up-regulates IL-18 receptor expression on T cells, Th1 cells, and B cells: synergism with IL-18 for IFN-{gamma} production. J. Immunol. 161:3400.[Abstract/Free Full Text]
  44. Tomura, M., S. Maruo, J. Mu, X. Y. Zhou, H. J. Ahn, T. Hamaoka, H. Okamura, K. Nakanishi, S. Clark, M. Kurimoto, H. Fujiwara. 1998. Differential capacities of CD4+, CD8+, and CD4-CD8- T cell subsets to express IL-18 receptor and produce IFN-{gamma} in response to IL-18. J. Immunol. 160:3759.[Abstract/Free Full Text]
  45. Kunikata, T., K. Torigoe, S. Ushio, T. Okura, C. Ushio, H. Yamauchi, M. Ikeda, H. Ikegami, M. Kurimoto. 1998. Constitutive and induced IL-18 receptor expression by various peripheral blood cell subsets as determined by anti-hIL-18R monoclonal antibody. Cell. Immunol. 189:135.[Medline]
  46. Walker, C., J. Checkel, S. Cammisuli, P. J. Leibson, G. J. Gleich. 1998. IL-5 production by NK cells contributes to eosinophil infiltration in a mouse model of allergic inflammation. J. Immunol. 161:1962.[Abstract/Free Full Text]
  47. Korsgren, M., C. G. Persson, F. Sundler, T. Bjerke, T. Hansson, B. J. Chambers, S. Hong, L. Van Kaer, H. G. Ljunggren, O. Korsgren. 1999. Natural killer cells determine development of allergen-induced eosinophilic airway inflammation in mice. J. Exp. Med. 189:553.[Abstract/Free Full Text]
  48. Bendelac, A., R. D. Hunziker, O. Lantz. 1996. Increased interleukin 4 and immunoglobulin E production in transgenic mice overexpressing NK1 T cells. J. Exp. Med. 184:1285.[Abstract/Free Full Text]
  49. Dao, T., W. Z. Mehal, I. N. Crispe. 1998. IL-18 augments perforin-dependent cytotoxicity of liver NK-T cells. J. Immunol. 161:2217.[Abstract/Free Full Text]
  50. Rachelefsky, G. S., R. M. Katz, S. C. Siegel. 1984. Chronic sinus disease with associated reactive airway disease in children. Pediatrics 73:526.[Abstract/Free Full Text]
  51. Nishioka, G. J., P. R. Cook, W. E. Davis, J. P. McKinsey. 1994. Functional endoscopic sinus surgery in patients with chronic sinusitis and asthma. Otolaryngol. Head Neck Surg. 110:494.[Medline]
  52. Nakamura, K., H. Okamura, M. Wada, K. Nagata, T. Tamura. 1989. Endotoxin-induced serum factor that stimulates {gamma} interferon production. Infect. Immun. 57:590.[Abstract/Free Full Text]
  53. Okamura, H., K. Nagata, T. Komatsu, T. Tanimoto, Y. Nukata, F. Tanabe, K. Akita, K. Torigoe, T. Okura, S. Fukuda. 1995. A novel costimulatory factor for {gamma} interferon induction found in the livers of mice causes endotoxic shock. Infect. Immun. 63:3966.[Abstract]
  54. Cameron, L. A.. 1999. Airway epithelium expresses interleukin-18. Eur. Respir. J. 14:553.[Abstract]
  55. Sporik, R., S. T. Holgate, J. J. Cogswell. 1991. Natural history of asthma in childhood: a birth