The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Malone, C. S.
Right arrow Articles by Wall, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Malone, C. S.
Right arrow Articles by Wall, R.
The Journal of Immunology, 2000, 164: 2550-2556.
Copyright © 2000 by The American Association of Immunologists

An Upstream Oct-1- and Oct-2-Binding Silencer Governs B29 (Igß) Gene Expression1

Cindy Sue Malone*, Lisa Patrone*, Kent L. Buchanan2,{dagger}, Carol F. Webb{dagger} and Randolph Wall3,*

* Department of Microbiology and Immunology, and Molecular Biology Institute, University of California, School of Medicine, Los Angeles, CA 90095; and {dagger} Immunobiology and Cancer Program, Oklahoma Medical Research Foundation, Oklahoma City, OK 73104


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The B cell-specific B29 (Igß) gene is activated in the earliest B cell precursors and is expressed throughout B cell development. Tissue-specific expression of the murine B29 gene is controlled by a B cell-specific promoter whose activity is governed by a cassette of upstream transcriptional silencers. This study describes a potent new silencer that is located 5' of the previously identified B29 silencer elements, FROG and TOAD. Like these known elements, the new B29 silencer is not restricted to the B29 promoter. Nuclear proteins from all cell lines tested interacted with this A+T-rich sequence, which closely resembled a noncanonical octamer binding motif and also conformed to the consensus sequence for nuclear matrix attachment regions. Interaction of Oct-1 and Oct-2 with the B29 A+T-rich sequence was confirmed using octamer-specific Abs. Oct-1/Oct-2 binding was required for the inhibitory activity of this sequence because mutations that blocked Oct-1/Oct-2 binding also eliminated inhibition of the B29 promoter. This B29 A+T-rich sequence specifically interacted with isolated nuclear matrix proteins in vitro, suggesting that it may also function as a matrix attachment region element. Maintenance of the level of B29 gene expression through the interaction of the minimal promoter and the upstream silencer elements FROG, TOAD, and the A+T-rich Oct-1/Oct-2 binding motif may be essential for normal B cell development and/or function.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The product of the B29 (Igß) gene is an essential component of the B cell receptor (BCR)4 that plays an indispensable role in B cell development. The B29 gene product is disulfide-linked to the mb-1 (Ig{alpha}) gene product, and this heterodimer is associated with Ig to form functional BCR complexes on B cells. B29-mb-1 heterodimers control VDJH recombination, allelic exclusion, surface translocation of Ig, and signal transduction events that occur through the BCR (reviewed in Refs. 1, 2, 3).

Due to the critical role the B29 gene plays in B cell maturation and function, we have characterized the features regulating its transcription and B cell specificity. Previously, we demonstrated that the B cell specificity of B29 is determined by a minimal promoter that contains multiple transcription factor motifs that collectively determine its tissue specificity and transcriptional activity. These motifs include early B cell factor, Ikaros, ETS, SP1, and octamer (4, 5). The B29 octamer motif was shown to interact with both Oct-1 and Oct-2 transcription factors (6). This octamer motif is a major determinant of B29 promoter activity in that mutations that eliminated Oct-1 and Oct-2 binding also abolished B29 promoter function (5).

Expression of the B29 minimal promoter is also regulated by upstream transcription control elements with inhibitory activities. We previously identified two silencer elements, FROG and TOAD, upstream of the B29 minimal promoter that coordinately govern its level of expression (7). To date, the FROG- and TOAD-interacting proteins have not been identified. These B29 silencer elements are equally active in both orientations, are position-independent, can affect heterologous promoters, and are not tissue restricted (7). These features of the B29 silencers resemble other functionally defined cis-acting negative regulatory DNA sequences that down-regulate gene transcription and belong to the class of silencer elements that restrict levels of gene expression rather than impart tissue specificity. Other examples of silencers reported to govern gene expression like the B29 silencer are present in the bcl-2 (8), ETS-1 (9), and {lambda}5 (10) genes. It has been postulated that this class of inhibitory transcription control elements functions in maintaining the level of specific gene expression, thereby preventing deleterious consequences of overexpression (7). For example, moderate overexpression of bcl-2 is linked to the prolonged survival of neoplastic B cells in follicular lymphoma and chronic lymphocytic leukemia (11, 12). bcl-2 is governed by silencer elements similar in nature to the silencers of the B29 gene in that they affect bcl-2 expression levels but do not impart tissue specificity (8). Elevated CD3{epsilon} expression in T cells blocked early T cell development (13) and in prothymocytes functioned as an oncogene (14). These consequences of CD3{epsilon} gene overexpression are particularly relevant in that CD3{epsilon} fulfills the same role in the TCR as B29 does in the BCR.

Further functional analysis of the region upstream of the B29 minimal promoter has identified a new region of potent silencer activity 5' of the previously identified FROG and TOAD silencer elements. Like these previously characterized B29 silencer elements, this new 5' B29 silencer is not B29 promoter-restricted. DNase I protection assays over this region delineated a well-defined protected area with an extended central A+T-rich sequence. This central A+T-rich sequence is homologous to the degenerate A+T-rich motifs recognized by octamer transcription factor family members (15). Both Oct-1 and Oct-2 factors bound the B29 A+T-rich sequence in EMSA. Site-directed mutations incorporated into this A+T-rich predicted octamer motif eliminated Oct-1 and Oct-2 binding, which in turn abolished the silencer activity of this region.

The B29 A+T-rich sequence also conforms to all the consensus sequence criteria for nuclear matrix attachment regions (MARs). MARs mediate chromatin association with the nuclear matrix (16, 17), are usually located within or near transcriptional regulatory elements (18, 19, 20, 21, 22), and are postulated to function in regulating gene expression by acting as boundary elements for transcription (20), by creating altered nucleosome environments (23, 24), and by affecting enhancer and silencer functions by impacting chromatin structure (25, 26, 27). The B29 A+T-rich sequence selectively interacted with nuclear matrix proteins, suggesting that this segment may also function as a MAR in B29 gene control.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmid construction and mutagenesis

The chloramphenicol acetyltransferase (CAT) reporter constructs were made using the pCAT Basic vector (Promega, Madison, WI) backbone. B29 promoter 5' deletions -565, -354, and -164 were generated by restriction digest and were blunt ligated into the SalI site of pCAT Basic. B29 5' deletion -411 was generated by PCR using the pCR-Script vector (Stratagene, La Jolla, CA) and was subsequently subcloned into the HindIII site of the pCAT Basic vector (Promega) with a deleted SphI site (GenBank accession number AF002279). In all constructs, the B29 endogenous ATG was destroyed and the first methionine codon was that of the CAT gene. The 5' -565/-355 region silencer construct was generated using PCR and the pCR-Script vector (Stratagene), and was subsequently ligated in both orientations immediately upstream of the B29 (-164) promoter into SacI/ClaI sites of pCAT Basic. These sites were carried over from the pSP73 cloning vector from the original subcloning of the -164 and -354 B29 promoter deletion fragments into the pCAT Basic construct. Mutagenized constructs were created using the Quik-Change mutagenesis kit (Stratagene) and the following complimentary oligonucleotides: 5'-GAAGTAGCAACAAAAgTTAAcTTATGGTTGGGCG-3' (mutant (m)A+T-rich1).

DNA transfections and CAT assays

The B cell line M12 was transfected by the DEAE-dextran method (28). Cells were cotransfected with 5 µg of CAT reporter plasmid and 1 µg of pRSV-luciferase. Extracts were prepared and assayed as described (5) and were quantitated by Phosphorimager analysis (Molecular Dynamics, Sunnyvale, CA). Results were normalized to luciferase activity and are the averages of at least three independent transfections using at least two preparations of DNA.

Nuclear extracts and DNA-binding assays

Preparation of crude nuclear extracts from M12 cells was previously described (29). DNase I footprinting was performed as described (29). The DNase I footprinting probe was generated by 5' end-labeling with [{gamma}-32P]ATP at the ClaI site of pCR-Script containing the -565/-355 B29 upstream promoter PCR fragment and then digestion with SacI. DNase I footprint probes were purified by polyacrylamide gel electrophoresis. EMSA was performed as described (5) with modifications of 2 µg poly(dI.dC) and analysis in 4.5% of 60:1 polyacrylamide:bis-acrylamide using 0.5x TBE gels (44.5 mM Tris base, 44.5 mM boric acid, 1 mM EDTA, pH8) at 125 V for 2.5 h at room temperature. Oct-1 in vitro translate was prepared using the TNT coupled reticulocyte lysate system (Promega). Oct-1, Oct-2, and Bob1 Abs and Oct-1 and Oct-2 blocking peptides (Santa Cruz Biotechnology, Santa Cruz, CA) used in EMSA were incubated in the binding reaction at 4°C overnight. EMSA probes were double-stranded oligonucleotides 5' end-labeled with [{gamma}-32P]ATP. EMSA probes were purified by G25 Sephadex spin column chromatography (Sigma, St. Louis, MO). EMSA oligonucleotide probes were as follows: 5'-GAAGTAGCAACAAAAATTAATTTATGGTTGGGCG-3' (A+T-rich motif), 5'-GAAGTAGCAACAAAAGTTAACTTATGGTTGGGCG-3' (mA+T-rich motif), 5'-TGTCGAATGCAAATCACTAGAA-3' (octamer; Santa Cruz Biotechnology), 5'-TGTCGAATGCAAGCCACTAGAA-3' (mOctamer; Santa Cruz Biotechnology), and 5'-TCTTCCAGAGCAAGGCAACCACAGGAGACC-3' (nonspecific TOAD motif).

Nuclear matrices and in vitro nuclear matrix attachment assays

Isolation of nuclei and nuclear matrices was performed according to Cockerill and Garrard (30), as previously described (31). Briefly, nuclei were isolated by dounce homogenization and purified by centifugation through a 2-M sucrose cushion. Endogenous DNA was degraded with DNase I for 1–2 h, and histones were extracted by sequential washes with 2 M NaCl. The resulting nuclear matrices were stored for up to 6 mo at -20°C after combination with an equal volume of glycerol. Before use, matrices from ~1.6 x 107 cells were washed three times in 50 mM NaCl, 10 mM Tris-HCl (pH 7.4), 1 mM MgCl2, 0.25 M sucrose, and 0.25 mg/ml BSA by centifugation for 30 sec at 10,000 x g at 4°C and were resuspended in 10–90 ml of assay solution. The final reaction mixture consisted of 50 mM NaCl, 10 mM Tris-HCl (pH 7.4), 2 mM EDTA, 0.25 M sucrose, 0.25 mg/ml BSA, 20 ng/ml [{gamma}-32P]ATP end-labeled DNA fragments, and 50–200 mg/ml sonicated Escherichia coli DNA unlabeled competitor. The reaction mixture was shaken for 1–3 h at 23°C; washed three times; solubilized in 0.5% SDS and 0.4 mg/ml proteinase K with 10 µg of unlabeled carrier DNA; and incubated overnight at 37°C. Material was phenol-extracted and ethanol-precipitated, and the resulting purified matrix-bound DNA fragments were electrophoretically resolved on 5% polyacrylamide-0.1% SDS gels. The gels were dried and visualized by autoradiography.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A new silencer element 5' of the B29 minimal promoter

Previous studies defined two B29 closely linked 5' silencer elements, FROG (-381) and TOAD (-349), which function cooperatively to govern the expression of the B29 minimal promoter (7). Further deletion analysis of the region 5' of the FROG element revealed a new upstream negative control region (-565 to -411) with greater activity than FROG and TOAD combined. Fig. 1Go shows that the -565 B29 deletion construct exhibited significantly reduced (p < 0.02) transcriptional activity compared with the -411 deletion construct that contained both the FROG and TOAD silencer elements. DNase I footprinting was used to detect DNA-protein binding sites in the -565 to -411 B29 gene segment. A single, strongly protected DNA segment (i.e., -480 to -443) was obtained with nuclear protein extracts from M12 B cells (Fig. 2Go). This protected segment contained a central A+T-rich DNA sequence (-475 to -457) that closely conformed to noncanonical octamer factor binding motifs and to the consensus MAR motif (16, 17, 19, 25, 32).



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 1. B29 A+T-rich motif contributes to the negative regulation of the B29 minimal (-164) promoter. Transient transfection to detect transcriptional expression of B29 promoter deletion constructs were conducted in the M12 B cell line. The activity of each construct is expressed as a percentage of the CAT activity obtained with the B29 (-164) minimal promoter construct (100%). Deletion construct -411 was created to separate the activities of the A+T-rich motif from the FROG motif silencer element to determine transcriptional activity of the A+T-rich motif region. Deletion construct -411 excludes the A+T-rich motif but contains both the FROG and TOAD silencer elements. Deletion constructs -164 (minimal promoter), -354 (TOAD motif), and -565 (TOAD, FROG, and A+T-rich motif) are identified by nucleotide numbers with respect to the major start site of transcription (+1) and are shown for comparison. CAT activities are RSV-luciferase normalized and are the average ± SD of six independent transfections using at least three preparations of DNA. Absolute fold induction for the B29 (-164) minimal promoter construct ranged from 8- to 60-fold (average, 27-fold) over vector alone (pCAT basic). The p values for B29 constructs are as follows: -164, p < 0.001; -354, p < 0.001; -411, p < 0.5; and -565, p < 0.02.

 


View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 2. DNase I footprinting analysis reveals a region of protection corresponding to the A+T-rich motif in the B29 promoter. The endpoints of the DNase I footprint are identified by nucleotide numbers with respect to the start site of transcription (+1). DNase I footprints using M12 B cell crude nuclear extracts are indicated by either "10 µg extract" or "20 µg extract" (lanes 3 and 4, respectively). Lanes containing reactions incubated without extract are indicated by "no extract" (lanes 2 and 5). Reactions were run alongside a G+A ladder of the probe (lanes 1 and 6). Results are representative of three independent experiments.

 
The B29 A+T-rich motif interacts with Oct-1 and Oct-2 transcription factors

A double-stranded oligonucleotide probe (A+T-rich motif) corresponding to the -480 to -443 DNase I protected B29 segment (GAAGTAGCAACAAAAATTAATTTATGGTTGGGCG) formed protein complexes with M12 B cell nuclear extracts when analyzed in EMSA (Fig. 3GoA, lane 2). These complexes were specifically competed by cold A+T-rich motif oligonucleotides but were not disrupted by cold nonspecific competitor oligonucleotides (Fig. 3GoA, lanes 5 and 7). Identical complexes were formed in EMSA with all nuclear extracts tested from pre-B, T, myeloid, and fibroblast cell lines, suggesting that the DNA-binding protein(s) in these complexes may be ubiquitously expressed (data not shown). Octamer family members recognize degenerate A+T-rich sequences like those in this B29 segment and are expressed in different cell lineages (15). They have also been implicated as silencers in addition to their well known role as stimulatory factors (33, 34, 35, 36, 37, 38, 39). Accordingly, we tested the effect of octamer motif competitors in EMSA with the B29 A+T-rich containing sequence. Formation of the -480 to -443 protein complex was blocked by octamer consensus binding site oligonucleotide cold competitors, suggesting that this DNA-protein interaction was likely to be mediated by an octamer family member (Fig. 3GoA, lane 3). The DNA-protein complex was not disrupted by a mutated octamer binding site oligonucleotide competitor (Fig. 3GoA, lane 4) or by a mutated A+T-rich sequence (mA+T-rich motif) competitor oligonucleotide (Fig. 3GoA, lane 6), further confirming a specific octamer factor interaction. This mutant B29 A+T-rich motif also failed to form protein complexes when used as a probe in EMSA (data not shown).



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 3. The B29 A+T-rich motif specifically interacts with transcription factors Oct-1 and Oct-2. Double-stranded oligonucleotides corresponding to B29 -482/-448 were end-labeled and used in EMSA. A, Lane 1 contains A+T-rich motif probe alone. The A+T-rich motif probe was incubated with 5 µg M12 B cell nuclear extract (lanes 2–7). Reactions were incubated in the presence of 1000-fold excess of cold octamer consensus competitor (lane 3); mutated octamer competitor (lane 4); A+T-rich motif competitor (lane 5); mutated A+T-rich motif competitor (lane 6); or nonspecific B29 promoter motif competitor (lane 7). EMSA in the presence of 100-fold and 500-fold cold competitors showed identical results. B, The A+T-rich motif probe was incubated with 5 µg M12 B cell nuclear extract (lanes 1–7). Reactions were incubated in the presence of 2 µg anti-Oct-1 Ab (lane 2); 2 µg anti-Oct-1 Ab and 2 µg Oct-1 blocking peptide (lane 3); 2 µg anti-Oct-1 Ab and 2 µg Oct-2 blocking peptide (lane 4); 2 µg anti-Oct-2 Ab (lane 5); 2 µg anti-Oct-2 Ab and 2 µg Oct-2 blocking peptide (lane 6); or 2 µg anti-Oct-2 Ab and 2 µg Oct-1 blocking peptide (lane 7). The specifically formed complexes are indicated by arrows. Results are representative of at least three independent experiments.

 
Octamer-specific Abs were used in EMSA to identify the octamer factor(s) interacting with this B29 segment. EMSA including Oct-1 Ab resulted in a super shift with the B29 A+T-rich motif probe (Fig. 3GoB, lane 2). The addition of Oct-1 blocking peptide eliminated the super-shifted complex (Fig. 3GoB, lane 3), whereas addition of the Oct-2 blocking peptide had no effect (Fig. 3GoB, lane 4). In vitro-translated Oct-1 specifically formed a complex with the B29 A+T-rich motif probe, whereas the negative control (in vitro-translated luciferase) showed no complex formation (data not shown). Oct-2-specific Ab competed the faster migrating protein complex with the B29 A+T-rich motif probe, which resulted in a modest super-shifted complex (Fig. 3GoB, lane 5). The addition of Oct-2 blocking peptide eliminated the super-shifted complex (Fig. 3GoB, lane 6), whereas addition of the Oct-1 blocking peptide had no effect (Fig. 3GoB, lane 7). These combined data show that the 5' B29 segment containing the A+T-rich motif interacts specifically with both Oct-1 and Oct-2 and suggest that this DNA-protein interaction may be involved in the transcriptional regulatory activity of this segment.

Site-directed mutations in the 5' B29 A+T-rich motif that disrupt DNA-Oct-1/Oct-2 binding also eliminate silencer activity

The two engineered point mutations in the B29 A+T-rich motif that prevented Oct-1 and Oct-2 binding in EMSA were tested for silencer activity in the context of the B29 promoter construct containing the complete upstream sequence to -565. These introduced mutations in the A+T-rich Oct-1/Oct-2 binding site abolished the transcriptional silencer activity of this extended 5' segment and restored transcriptional activity to a level slightly greater than that of the -354 B29 segment (Fig. 4Go). This result strongly suggests that the Oct-1/Oct-2 binding motif is responsible for the silencing activity of the A+T-rich sequence in the -565 construct. The previously identified TOAD and FROG silencer elements (7) are presumed to account for the residual negative transcriptional activity of the -565 B29 promoter construct containing the mutated A+T-rich motif (Fig. 4Go).



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 4. Site-directed mutagenesis of the B29 A+T-rich motif alleviates negative regulation of the B29 promoter. Transient transfections to detect transcriptional expression of B29 promoter deletion construct -565 with introduced point mutations in the A+T-rich motif were conducted in the M12 B cell line. Mutagenized nucleotides are indicated by lowercase script. Wild-type sequence of the A+T-rich motif is 5'-GAAGTAGCAACAAAAATTAATTTATGGTTGGGCG-3' (A+T-rich). Mutated sequence of the A+T-rich motif is 5'-GGAGTAGCAACAAAAgTTAAcTTATGGTTGGGCG-3' (mA+T-rich). The activity of each construct is expressed as a percentage of the CAT activity obtained with the B29 (-164) minimal promoter construct (100%). Deletion constructs -164, -354, and -565 are identified by nucleotide numbers with respect to the major start site of transcription (+1) and are shown for comparison. CAT activities are RSV-luciferase normalized and are the average ± SD of seven independent transfections using at least three preparations of DNA. Absolute fold inductions for the B29 (-164) minimal promoter construct in repeated experiments ranged from 8- to 60-fold (average, 27-fold) over vector alone (pCAT basic). The p values for B29 constructs are as follows: -164, p < 0.001; -354, p < 0.001; -565, p < 0.001; and -565 mA+T-rich, p < 0.001.

 
The FROG and TOAD silencer elements functioned as silencer elements when associated with heterologous promoters (e.g., mb-1, c-fos) in addition to their silencer activity in the B29 minimal promoter (7). Next we tested whether the wild-type and mutant octamer binding sites in the B29 A+T-rich sequence exhibited similar broad activity. Isolated 5' B29 fragments (-565 to -355) containing either the wild-type or the mutated B29 A+T-rich octamer motif were placed directly upstream of the minimal B29 promoter (-164) or the heterologous c-fos promoter (Ref. 7 and Fig. 5Go). The segment containing the wild-type B29 A+T-rich octamer motif inhibited the c-fos promoter comparably to the way it inhibited the B29 minimal promoter (p < 0.001), indicating that this 5' silencer element is active on heterologous promoters. Silencing activity of the -565 to -355 segment on both the B29 and c-fos promoters was completely eliminated in constructs containing the mutated Oct-1/Oct-2 binding site (p < 0.001). This reaffirms that the A+T-rich octamer motif is the primary silencer element in this upstream B29 gene segment. The -565 to -355 B29 segment tested in these experiments included the wild-type FROG (-381) motif but not the TOAD (-349) motif. The complete elimination of silencer activity in the -565 to -355 segment with the mutated B29 A+T-rich octamer motif suggests that the retained wild-type FROG motif without the TOAD motif was unable to exert silencer activity on either B29 or c-fos promoters. When both the FROG and TOAD motifs are present and the A+T-rich octamer motif is mutated (as in Fig. 4Go), residual silencing activity remains. These data suggest a cooperative and interdependent function for the two closely linked B29 silencer elements TOAD and FROG that is independently augmented by the Oct-1/Oct-2 binding site in the upstream A+T-rich sequence.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 5. Targeted disruption of the B29 A+T-rich motif alleviates its silencing activity on B29 promoter and c-fos promoter constructs. Transient transfections to detect transcriptional expression of site-directed mutations within B29 and c-fos promoter-silencer constructs were conducted in the M12 B cell line. The A+T-rich fragment position and orientation relative to the promoters are as indicated. The activity of each construct is expressed as a percentage of the CAT activity obtained with each minimal promoter construct (100%). Promoter sequences are identified by nucleotide numbers with respect to their start sites of transcription (+1). CAT activities are RSV-luciferase normalized and are the average ± SD of three independent transfections using two preparations of DNA. Absolute fold inductions for the each promoter construct in repeated experiments ranged from 8- to 60-fold (B29) and from 40- to 400-fold (c-fos) over vector alone (pCAT basic). Average fold induction for the B29 (-164) minimal promoter and c-fos (-71) promoter are 27-fold and 117-fold, respectively, over pCAT basic. The p values for B29 constructs are as follows: -164, p < 0.001; -565/-355 construct, p < 0.001; -565/-355 mA+T-rich construct, p < 0.001. The p values for c-fos constructs are as follows: -71, p < 0.001; -565/-355 construct, p < 0.001; -565/-355 mA+T-rich construct, p < 0.001.

 
The B29 A+T-rich sequence preferentially binds to the nuclear matrix

The B29 A+T-rich octamer motif sequence matches the sequence criteria for MAR binding protein interactions. In fact, this sequence exactly conforms to the consensus motif for a known B cell-specific MAR binding transcription activator protein known as B cell regulator of IgH transcription (Bright) (40). The Bright consensus sequence consists of an A+T-rich hexamer core sequence flanked by at least two AT dimer repeats <=6 bp from the core hexamer that are all contained within an ATC-restricted sequence of at least 13 bp (40). The B29 A+T-rich octamer motif sequence consists of an AATTAA hexamer core with two AT dimers found 1 and 5 bp away from the hexamer core, and the ATC-restricted sequence stretches over 18 bp (i.e., -475CAACAAAAATTAATTTAT-457). However, B29 5' DNA segments containing the A+T-rich octamer sequence and Bright consensus sequence (-507 to -422 and -565 to -355) did not interact with Bright protein from BCg3R-1d B cell transfectants, which express Bright protein (40, 41), and did not bind in vitro translated Bright protein (Ref. 41 and data not shown). Anti-Bright Ab also had no effect on the protein complexes seen with the B29 A+T-rich octamer motif in EMSA (data not shown). Thus, the Bright transcription activator does not appear to bind to the B29 A+T-rich octamer motif or to be a component of the protein complexes detected in EMSA with this sequence.

Even though the B29 A+T-rich octamer motif did not interact with the MAR binding protein Bright, this sequence still conforms to all of the sequence criteria of a MAR (16, 17, 19, 30, 32). Next we tested nuclear matrix protein binding of the -565 to -355 B29 A+T-rich octamer motif segment. Specifically, two overlapping B29 promoter fragments encompassing the B29 A+T-rich octamer motif (-475 bp), -565 to -355 and -507 to -422, were used in standard in vitro nuclear matrix protein binding assays (31) along with the positive control IgH V1 promoter (S107) MAR-containing DNA fragment known to interact with the nuclear matrix (31, 41, 42). Restriction-digested plasmids containing these DNA fragments from the B29 and IgH (S107) genes were labeled and mixed with isolated nuclear matrices. After multiple washes to remove non-matrix-bound DNA, the resulting nuclear matrix-DNA pellets were subjected to proteinase K digestion and were separated by electrophoresis. Fig. 6Go shows that both B29 DNA fragments were bound by nuclear matrix preparations at levels comparable to that of the IgH positive control DNA fragment. Control non-MAR vector DNA fragments were not retained by the nuclear matrix preparations. These data indicate that the B29 A+T-rich octamer motif segment exhibits specific binding to nuclear matrix proteins.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 6. The 5' A+T-rich region of the B29 promoter preferentially binds to the nuclear matrix in vitro. The B29 A+T-rich region was analyzed for its ability to bind the nuclear matrix. Nuclear matrix preparations were incubated with whole 5' end-labeled PvuII-digested plasmids containing the -565/-355 B29 promoter fragment and the -574/-425 (bf150) IgH V1 promoter fragment (lanes 1 and 2) and the -507/-422 B29 promoter fragment and the -574/-425 (bf150) IgH V1 promoter fragment (lanes 3 and 4). The matrix-retained fragments obtained after washing away the unbound DNA and digesting away matrix proteins with proteinase K are shown in lanes 2 and 4. Lanes 1 and 3 contain 25% of the free-input DNA originally incubated with the matrix. B29 and IgH matrix-bound DNA is indicated by arrows.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
These studies functionally define a new B29 silencer (-475) located upstream of the B29 promoter in a 5' regulatory region that includes the previously identified silencer elements FROG (-381) and TOAD (-349) (7). The B29 A+T-rich octamer motif appears to be a more potent silencer than the combined activities of the B29 FROG and TOAD silencer elements. We previously attributed residual silencer activity seen with the B29 -565 to -355 DNA fragment to the FROG silencer element present in this fragment (7). However, results from the present study now conclusively indicate that the A+T-rich segment (-475 to -457) is the primary determinant of the silencer activity of this region. Site-directed mutagenesis of the B29 A+T-rich octamer motif, both in its natural context upstream of the B29 promoter (Fig. 4Go) and in truncated test constructs with the B29 promoter and the c-fos promoter, completely eliminated the silencer activity of this upstream segment (Fig. 5Go).

The binding of Oct-1 and/or Oct-2 with the degenerate B29 A+T-rich octamer motif is essential for the silencer activity of this 5' B29 gene segment. Direct evidence for this negative regulatory role of Oct-1 and/or Oct-2 in B29 gene expression was demonstrated by site-directed mutations in the B29 A+T-rich octamer motif, which destroyed silencer activity on both the B29 and the heterologous c-fos promoter (Fig. 4Go and 5Go) and also eliminated Oct-1 and Oct-2 binding (Fig. 3Go). Octamer factor binding is now implicated in the activity of silencers in a number of other genes. Oct-1 was recently reported to act as a silencer protein in the hTSHß promoter (33), the CYPA1 gene promoter (34), and the PIT-1/GHF1 gene promoter (36). Oct-2 functions as a silencer factor in the IL-2 enhancer (35), the tryrosine hydroxylase promoter (43), and several viral promoters including the herpes simplex virus immediate-early gene 3 promoter (44). Additionally, both Oct-1 and Oct-2 have been shown to repress the HIV long terminal repeat promoter (45). These examples and the results presented here indicate that Oct-1 and Oct-2 function as transcriptional silencers in addition to their better known roles as transcriptional activators (37, 38, 39).

It is now evident that B29 transcriptional control is determined by Oct-1 and/or Oct-2 functioning in opposing fashions. In one context, Oct-1 and/or Oct-2 function as transcriptional inhibitors when bound to the 5' A+T-rich octamer motif silencer, and in the other they act as activators when bound to the canonical octamer motif in the B29 minimal promoter (5, 6). These opposing Oct-1- and/or Oct-2-mediated functions in B29 gene control could be regulated by the differential interaction of bound Oct-1/Oct-2 with the B cell octamer transactivator or cofactor Bob1 (OCA-B, OBF-1) (46, 47, 48). Based on the specific octamer binding site sequence requirements for Bob1 binding (46, 49, 50, 51) and on the fact that no ternary complexes (reflective of Bob1 interactions) were identified in our EMSA with the B29 A+T-rich motif (Fig. 3Go), we predict that Bob1 would not effect B29 A+T-rich octamer motif silencer activity. In contrast, we have found that Bob1 is a potent transactivator in conjunction with Oct-1/Oct-2 binding to the canonical octamer motif in the minimal B29 promoter (Malone et al., manuscript in preparation). These findings provide a plausible explanation for the dual and opposing activities of Oct-1 and/or Oct-2 in the regulation of the B29 promoter.

The B29 A+T-rich octamer motif not only interacts with the Oct-1 and Oct-2 factors but also binds to nuclear matrix proteins as well (Fig. 6Go). B29 promoter fragments encompassing the B29 A+T-rich octamer motif showed binding to isolated nuclear matrices equivalent to that of the IgH V1 promoter MAR element used as the positive control in these experiments. Preliminary results from in vivo nuclear matrix association assays conducted according to Refs. 52 and 53 indicate that the B29 A+T-rich octamer motif is preferentially associated with nuclear matrices in isolated chromatin (results not shown). These findings suggest that this region is likely to function as a MAR. However, the present studies are not able to resolve whether the B29 A+T-rich octamer motif also functions as a MAR because transient transfections do not reflect nuclear matrix interactions (54). These studies do establish that the silencer activity of the B29 A+T-rich octamer motif can function independent of any MAR involvement. Additional studies using either stably transformed cells and/or transgenic mice will be necessary to determine whether the B29 A+T-rich Oct-1/Oct-2 motif functions both as a silencer and as a MAR.

Recent results with the hTSHß promoter (33) provide a compelling case in which an Oct-1 binding motif was shown to have the dual functions of a silencer and a MAR. The hTSHß promoter contains an A+T-rich Oct-1 binding motif with MAR homology (33), like the B29 A+T-rich octamer motif. Additionally, the B29 A+T-rich octamer motif conferred negative regulation on the B29 minimal promoter as has been shown for the A+T-rich Oct-1 binding motif and the hSTHß promoter (33). Furthermore, the hSTHß promoter Oct-1 binding site was tethered to the nuclear matrix in vivo (33). Oct-1 recently has been shown to be a component of the insoluble nuclear matrix in addition to its well known role as a soluble nuclear transcription factor (33, 55), along with several other transcription factors including SP-1, AP-1, and C/EBP (55). By analogy to these findings with the hTSHß promoter, the B29 A+T-rich octamer motif similarly may serve a dual function in B29 gene regulation by mediating silencer activity on the B29 promoter and by facilitating B29 gene association with the nuclear matrix (33, 55). Confirmation of such a duality would open a new dimension in B29 gene expression in B cell development.


    Acknowledgments
 
We thank Denise Gangadharan, Neil Ayers, and Michael Lee for technical assistance and Michael A. Teitell for critical reading of the manuscript.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants CA12800 and GM40185 and University of California Amgen STAR Biotechnology Project S96-02 (to R.W.); and by National Institutes of Health Grants GM46462 and AI44215 (to C.F.W.). C.S.M. was supported by Public Health Service National Service Award AI07126, the Dr. Ursula Mandel Scholarship, and the University of California Dissertation Year Fellowship. L.P. was supported by Public Health Service National Research Service Award 2T32 CA 09120. Back

2 Current address: Department of Microbiology and Immunology, Tulane University Medical Center, New Orleans, LA 70112 Back

3 Address correspondence and reprint requests to Dr. Randolph Wall, University of California, 611 Charles E. Young Drive East, 529 Molecular Biology Institute, Los Angeles, CA 90095. E-mail address: Back

4 Abbreviations used in this paper: BCR, B cell receptor; MAR, matrix attachment region; CAT, chloramphenicol acetyltransferase; RSV, Rous sarcoma virus; Bright, B cell regulator of IgH transcription. Back

Received for publication October 18, 1999. Accepted for publication December 16, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Cambier, J. C., W. Bedzyk, K. Campbell, N. Chien, J. Friedrich, A. Harwood, W. Jensen, C. Pleiman, M. R. Clark. 1993. The B-cell antigen receptor: structure and function of primary, secondary, tertiary and quaternary components. Immunol. Rev. 132:85.[Medline]
  2. Gong, S., M. C. Nussenzweig. 1996. Regulation of an early developmental checkpoint in the B cell pathway by Igß. Science 272:411.[Abstract]
  3. Roth, P. E., A. L. DeFranco. 1996. Receptor tails unlock developmental checkpoints for B lymphocytes. Science 272:1752.[Medline]
  4. Akerblad, P., M. Rosberg, T. Leanderson, M. Sigvardsson. 1999. The B29 (immunoglobulin ß-chain) gene is a genetic target for early B-cell factor. Mol. Cell. Biol. 19:392.[Abstract/Free Full Text]
  5. Omori, S. A., R. Wall. 1993. Multiple motifs regulate the B-cell-specific promoter of the B29 gene. Proc. Natl. Acad. Sci. USA 90:11723.[Abstract/Free Full Text]
  6. Hermanson, G. G., M. Briskin, D. Sigman, R. Wall. 1989. Immunoglobulin enhancer and promoter motifs 5' of the B29 B-cell-specific gene. Proc. Natl. Acad. Sci. USA 86:7341.[Abstract/Free Full Text]
  7. Malone, C., S. A. Omori, R. Wall. 1997. Silencer elements controlling the murine B29 (Ig-b) promoter are neither promoter nor cell-type specific. Proc. Natl. Acad. Sci. USA 94:12314.[Abstract/Free Full Text]
  8. Young, R. L., S. J. Korsmeyer. 1993. A negative regulatory element in the bcl-2 5'-untranslated region inhibits expression from an upstream promoter. Mol. Cell. Biol. 13:3686.[Abstract/Free Full Text]
  9. Chen, J. H., S. Jeha, T. Oka. 1993. Negative regulatory elements in the human ETS1 gene promoter. Oncogene 8:133.[Medline]
  10. Yang, J., M. A. Glozak, B. B. Blomberg. 1995. Identification and localization of a developmental stage-specific promoter activity from the murine {lambda}5 gene. J. Immunol. 155:2498.[Abstract]
  11. Hanada, M., D. Delia, A. Aiello, E. Stadtmauer, J. C. Reed. 1993. bcl-2 gene hypomethylation and high-level expression in B-cell chronic lymphocytic leukemia. Blood 82:1820.[Abstract/Free Full Text]
  12. Korsmeyer, S. J.. 1992. Bcl-2 initiates a new category of oncogenes: regulators of cell death. Blood 80:879.[Free Full Text]
  13. Wang, B., C. Levelt, M. Salio, D. Zheng, J. Sancho, C. P. Liu, J. She, M. Huang, K. Higgins, M. J. Sunshine, et al 1995. Over-expression of CD3{epsilon} transgenes blocks T lymphocyte development. Int. Immunol. 7:435.[Abstract/Free Full Text]
  14. Wang, B., J. She, M. Salio, D. Allen, E. Lacy, N. Lonberg, C. Terhorst. 1997. CD3{epsilon} overexpressed in prothymocytes acts as an oncogene. Mol. Med. 3:72.[Medline]
  15. Baumruker, T., R. Sturm, W. Herr. 1988. OBP100 binds remarkably degenerate octamer motifs through specific interactions with flanking sequences. Genes Dev. 2:1400.[Abstract/Free Full Text]
  16. Gasser, S. M., B. B. Amati, M. E. Cardenas, J. F. Hofmann. 1989. Studies on scaffold attachment sites and their relation to genome function. Int. Rev. Cytol. 119:57.[Medline]
  17. Verheijen, R., W. van Venrooij, F. Ramaekers. 1988. The nuclear matrix: structure and composition. J. Cell Sci. 90:11.[Free Full Text]
  18. Bode, J., K. Maass. 1988. Chromatin domain surrounding the human interferon-ß gene as defined by scaffold-attached regions. Biochemistry 27:4706.[Medline]
  19. Cockerill, P. N., M. H. Yuen, W. T. Garrard. 1987. The enhancer of the immunoglobulin heavy chain locus is flanked by presumptive chromosomal loop anchorage elements. J. Biol. Chem. 262:5394.[Abstract/Free Full Text]
  20. Gasser, S. M., U. K. Laemmli. 1986. Cohabitation of scaffold binding regions with upstream/enhancer elements of three developmentally regulated genes of D. melanogaster. Cell 46:521.[Medline]
  21. Jarman, A. P., D. R. Higgs. 1988. Nuclear scaffold attachment sites in the human globin gene complexes. EMBO J. 7:3337.[Medline]
  22. Loc, P. V., W. H. Stratling. 1988. The matrix attachment regions of the chicken lysozyme gene co-map with the boundaries of the chromatin domain. EMBO J. 7:655.[Medline]
  23. Garrard, W. T.. 1991. Histone H1 and the conformation of transcriptionally active chromatin. BioEssays 13:87.[Medline]
  24. Grosveld, F., G. B. van Assendelft, D. R. Greaves, G. Kollias. 1987. Position-independent, high-level expression of the human beta-globin gene in transgenic mice. Cell 51:975.[Medline]
  25. Cockerill, P. N., W. T. Garrard. 1986. Chromosomal loop anchorage sites appear to be evolutionarily conserved. FEBS Lett. 204:5.[Medline]
  26. Forrester, W. C., C. van Genderen, T. Jenuwein, R. Grosschedl. 1994. Dependence of enhancer-mediated transcription of the immunoglobulin µ gene on nuclear matrix attachment regions. Science 265:1221.[Abstract/Free Full Text]
  27. McKnight, R. A., A. Shamay, L. Sankaran, R. J. Wall, L. Hennighausen. 1992. Matrix-attachment regions can impart position-independent regulation of a tissue-specific gene in transgenic mice. Proc. Natl. Acad. Sci. USA 89:6943.[Abstract/Free Full Text]
  28. Grosschedl, R., D. Baltimore. 1985. Cell-type specificity of immunoglobulin gene expression is regulated by at least three DNA sequence elements. Cell 41:885.[Medline]
  29. Lo, K., N. R. Landau, S. T. Smale. 1991. LyF-1, a transcriptional regulator that interacts with a novel class of promoters for lymphocyte-specific genes. Mol. Cell. Biol. 11:5229.[Abstract/Free Full Text]
  30. Cockerill, P. N., W. T. Garrard. 1986. Chromosomal loop anchorage of the kappa immunoglobulin gene occurs next to the enhancer in a region containing topoisomerase II sites. Cell 44:273.[Medline]
  31. Webb, C. F., C. Das, K. L. Eneff, P. W. Tucker. 1991. Identification of a matrix-associated region 5' of an immunoglobulin heavy chain variable region gene. Mol. Cell. Biol. 11:5206.[Abstract/Free Full Text]
  32. Dickinson, L. A., T. Joh, Y. Kohwi, T. Kohwi-Shigematsu. 1992. A tissue-specific MAR/SAR DNA-binding protein with unusual binding site recognition. Cell 70:631.[Medline]
  33. Kim, M. K., L. A. Lesoon-Wood, B. D. Weintraub, J. H. Chung. 1996. A soluble transcription factor, Oct-1, is also found in the insoluble nuclear matrix and possesses silencing activity in its alanine-rich domain. Mol. Cell. Biol. 16:4366.[Abstract]
  34. Bhat, R., J. A. Weaver, K. M. Sterling, E. Bresnick. 1996. Nuclear transcription factor Oct-1 binds to the 5'-upstream region of CYP1A1 and negatively regulates its expression. Int. J. Biochem. Cell Biol. 28:217.[Medline]
  35. de Grazia, U., M. P. Felli, A. Vacca, A. R. Farina, M. Maroder, L. Cappabianca, D. Meco, M. Farina, I. Screpanti, L. Frati, et al 1994. Positive and negative regulation of the composite octamer motif of the interleukin 2 enhancer by AP-1, Oct-2, and retinoic acid receptor. J. Exp. Med. 180:1485.[Abstract/Free Full Text]
  36. Delhase, M., J. L. Castrillo, M. de la Hoya, F. Rajas, E. L. Hooghe-Peters. 1996. AP-1 and Oct-1 transcription factors down-regulate the expression of the human PIT1/GHF1 gene. J. Biol. Chem. 271:32349.[Abstract/Free Full Text]
  37. Banerji, J., L. Olson, W. Schaffner. 1983. A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes. Cell 33:729.[Medline]
  38. Gillies, S. D., S. L. Morrison, V. T. Oi, S. Tonegawa. 1983. A tissue-specific transcription enhancer element is located in the major intron of a rearranged immunoglobulin heavy chain gene. Cell 33:717.[Medline]
  39. Queen, C., D. Baltimore. 1983. Immunoglobulin gene transcription is activated by downstream sequence elements. Cell 33:741.[Medline]
  40. Herrscher, R. F., M. H. Kaplan, D. L. Lelsz, C. Das, R. Scheuermann, P. W. Tucker. 1995. The immunoglobulin heavy-chain matrix-associating regions are bound by Bright: a B cell-specific trans-activator that describes a new DNA-binding protein family. Genes Dev. 9:3067.[Abstract/Free Full Text]
  41. Webb, C. F., C. Das, S. Eaton, K. Calame, P. W. Tucker. 1991. Novel protein-DNA interactions associated with increased immunoglobulin transcription in response to antigen plus interleukin-5. Mol. Cell. Biol. 11:5197.[Abstract/Free Full Text]
  42. Webb, C. F., K. L. Eneff, F. H. Drake. 1993. A topoisomerase II-like protein is part of an inducible DNA-binding protein complex that binds 5' of an immunoglobulin promoter. Nucleic Acids Res. 21:4363.[Abstract/Free Full Text]
  43. Dawson, S. J., S. O. Yoon, D. M. Chikaraishi, K. A. Lillycrop, D. S. Latchman. 1994. The Oct-2 transcription factor represses tyrosine hydroxylase expression via a heptamer TAATGARAT-like motif in the gene promoter. Nucleic Acids Res. 22:1023.[Abstract/Free Full Text]
  44. Lillycrop, K. A., S. J. Dawson, J. K. Estridge, T. Gerster, P. Matthias, D. S. Latchman. 1994. Repression of a herpes simplex virus immediate-early promoter by the Oct-2 transcription factor is dependent on an inhibitory region at the N terminus of the protein. Mol. Cell. Biol. 14:7633.[Abstract/Free Full Text]
  45. Liu, Y. Z., D. S. Latchman. 1997. The octamer-binding proteins Oct-1 and Oct-2 repress the HIV long terminal repeat promoter and its transactivation by Tat. Biochem. J. 322:155.
  46. Luo, Y., H. Fujii, T. Gerster, R. G. Roeder. 1992. A novel B cell-derived coactivator potentiates the activation of immunoglobulin promoters by octamer-binding transcription factors. Cell 71:231.[Medline]
  47. Strubin, M., J. W. Newell, P. Matthias. 1995. OBF-1, a novel B cell-specific coactivator that stimulates immunoglobulin promoter activity through association with octamer-binding proteins. Cell 80:497.[Medline]
  48. Gstaiger, M., L. Knoepfel, O. Georgiev, W. Schaffner, C. M. Hovens. 1995. A B-cell coactivator of octamer-binding transcription factors. Nature 373:360.[Medline]
  49. Kim, J. S., J. Kim, K. L. Cepek, P. A. Sharp, C. O. Pabo. 1997. Design of TATA box-binding protein/zinc finger fusions for targeted regulation of gene expression. Proc. Natl. Acad. Sci. USA 94:3616.[Abstract/Free Full Text]
  50. Cepek, K. L., D. I. Chasman, P. A. Sharp. 1996. Sequence-specific DNA binding of the B-cell-specific coactivator OCA-B. Genes Dev. 10:2079.[Abstract/Free Full Text]
  51. Gstaiger, M., O. Georgiev, H. van Leeuwen, P. van der Vliet, W. Schaffner. 1996. The B cell coactivator Bob1 shows DNA sequence-dependent complex formation with Oct-1/Oct-2 factors, leading to differential promoter activation. EMBO J. 15:2781.[Medline]
  52. Kramer, J. A., S. A. Krawetz. 1997. PCR-based assay to determine nuclear matrix association. BioTechniques 22:826.[Medline]
  53. Kramer, J. A., M. D. Adams, G. B. Singh, N. A. Doggett, S. A. Krawetz. 1998. A matrix associated region localizes the human SOCS-1 gene to chromosome 16p13. 13. Somatic Cell Mol. Genet. 24:131.[Medline]
  54. Ortiz, B. D., D. Cado, V. Chen, P. W. Diaz, A. Winoto. 1997. Adjacent DNA elements dominantly restrict the ubiquitous activity of a novel chromatin-opening region to specific tissues. EMBO J. 16:5037.[Medline]
  55. van Wijnen, A. J., J. P. Bidwell, E. G. Fey, S. Penman, J. B. Lian, J. L. Stein, G. S. Stein. 1993. Nuclear matrix association of multiple sequence-specific DNA binding activities related to SP-1, ATF, CCAAT, C/EBP, OCT-1, and AP-1. Biochemistry 32:8397.[Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
B. P. Hermann and L. L. Heckert
Silencing of Fshr Occurs through a Conserved, Hypersensitive Site in the First Intron
Mol. Endocrinol., August 1, 2005; 19(8): 2112 - 2131.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L.-R. Liu, Z.-W. Du, H.-L. Zhao, X.-L. Liu, X.-D. Huang, J. Shen, L.-M. Ju, F.-D. Fang, and J.-W. Zhang
T to C Substitution at -175 or -173 of the {gamma}-Globin Promoter Affects GATA-1 and Oct-1 Binding in Vitro Differently but Can Independently Reproduce the Hereditary Persistence of Fetal Hemoglobin Phenotype in Transgenic Mice
J. Biol. Chem., March 4, 2005; 280(9): 7452 - 7459.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. K. Cheng, C. M. Yeung, R. L. C. Hoo, B. K. C. Chow, and P. C. K. Leung
Oct-1 Is Involved in the Transcriptional Repression of the Gonadotropin-Releasing Hormone Receptor Gene
Endocrinology, December 1, 2002; 143(12): 4693 - 4701.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Torigoe, H. Izumi, H. Ishiguchi, H. Uramoto, T. Murakami, T. Ise, Y. Yoshida, M. Tanabe, M. Nomoto, H. Itoh, et al.
Enhanced Expression of the Human Vacuolar H+-ATPase c subunit Gene (ATP6L) in Response to Anticancer Agents
J. Biol. Chem., September 20, 2002; 277(39): 36534 - 36543.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. S. Malone and R. Wall
Bob1 (OCA-B/OBF-1) Differential Transactivation of the B Cell-Specific B29 (Ig{beta}) and mb-1 (Ig{alpha}) Promoters
J. Immunol., April 1, 2002; 168(7): 3369 - 3375.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
B. Andersen and M. G. Rosenfeld
POU Domain Factors in the Neuroendocrine System: Lessons from Developmental Biology Provide Insights into Human Disease
Endocr. Rev., February 1, 2001; 22(1): 2 - 35.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Malone, C. S.
Right arrow Articles by Wall, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Malone, C. S.
Right arrow Articles by Wall, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS