| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*
Department of Microbiology and Immunology, and Molecular Biology Institute, University of California, School of Medicine, Los Angeles, CA 90095; and
Immunobiology and Cancer Program, Oklahoma Medical Research Foundation, Oklahoma City, OK 73104
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) gene
product, and this heterodimer is associated with Ig to form functional
BCR complexes on B cells. B29-mb-1 heterodimers control
VDJH recombination, allelic exclusion, surface
translocation of Ig, and signal transduction events that occur through
the BCR (reviewed in Refs. 1, 2, 3). Due to the critical role the B29 gene plays in B cell maturation and function, we have characterized the features regulating its transcription and B cell specificity. Previously, we demonstrated that the B cell specificity of B29 is determined by a minimal promoter that contains multiple transcription factor motifs that collectively determine its tissue specificity and transcriptional activity. These motifs include early B cell factor, Ikaros, ETS, SP1, and octamer (4, 5). The B29 octamer motif was shown to interact with both Oct-1 and Oct-2 transcription factors (6). This octamer motif is a major determinant of B29 promoter activity in that mutations that eliminated Oct-1 and Oct-2 binding also abolished B29 promoter function (5).
Expression of the B29 minimal promoter is also regulated by
upstream transcription control elements with inhibitory activities. We
previously identified two silencer elements, FROG and TOAD, upstream of
the B29 minimal promoter that coordinately govern its level
of expression (7). To date, the FROG- and TOAD-interacting
proteins have not been identified. These B29 silencer
elements are equally active in both orientations, are
position-independent, can affect heterologous promoters, and are not
tissue restricted (7). These features of the
B29 silencers resemble other functionally defined
cis-acting negative regulatory DNA sequences that
down-regulate gene transcription and belong to the class of silencer
elements that restrict levels of gene expression rather than impart
tissue specificity. Other examples of silencers reported to govern gene
expression like the B29 silencer are present in the
bcl-2 (8), ETS-1 (9), and 
5
(10) genes. It has been postulated that this class of
inhibitory transcription control elements functions in maintaining the
level of specific gene expression, thereby preventing deleterious
consequences of overexpression (7). For example, moderate
overexpression of bcl-2 is linked to the prolonged survival
of neoplastic B cells in follicular lymphoma and chronic lymphocytic
leukemia (11, 12). bcl-2 is governed by
silencer elements similar in nature to the silencers of the
B29 gene in that they affect bcl-2 expression
levels but do not impart tissue specificity (8). Elevated
CD3
expression in T cells blocked early T cell development
(13) and in prothymocytes functioned as an oncogene
(14). These consequences of CD3 gene overexpression are
particularly relevant in that CD3 fulfills the same role in the TCR
as B29 does in the BCR.
Further functional analysis of the region upstream of the B29 minimal promoter has identified a new region of potent silencer activity 5' of the previously identified FROG and TOAD silencer elements. Like these previously characterized B29 silencer elements, this new 5' B29 silencer is not B29 promoter-restricted. DNase I protection assays over this region delineated a well-defined protected area with an extended central A+T-rich sequence. This central A+T-rich sequence is homologous to the degenerate A+T-rich motifs recognized by octamer transcription factor family members (15). Both Oct-1 and Oct-2 factors bound the B29 A+T-rich sequence in EMSA. Site-directed mutations incorporated into this A+T-rich predicted octamer motif eliminated Oct-1 and Oct-2 binding, which in turn abolished the silencer activity of this region.
The B29 A+T-rich sequence also conforms to all the consensus sequence criteria for nuclear matrix attachment regions (MARs). MARs mediate chromatin association with the nuclear matrix (16, 17), are usually located within or near transcriptional regulatory elements (18, 19, 20, 21, 22), and are postulated to function in regulating gene expression by acting as boundary elements for transcription (20), by creating altered nucleosome environments (23, 24), and by affecting enhancer and silencer functions by impacting chromatin structure (25, 26, 27). The B29 A+T-rich sequence selectively interacted with nuclear matrix proteins, suggesting that this segment may also function as a MAR in B29 gene control.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The chloramphenicol acetyltransferase (CAT) reporter constructs were made using the pCAT Basic vector (Promega, Madison, WI) backbone. B29 promoter 5' deletions -565, -354, and -164 were generated by restriction digest and were blunt ligated into the SalI site of pCAT Basic. B29 5' deletion -411 was generated by PCR using the pCR-Script vector (Stratagene, La Jolla, CA) and was subsequently subcloned into the HindIII site of the pCAT Basic vector (Promega) with a deleted SphI site (GenBank accession number AF002279). In all constructs, the B29 endogenous ATG was destroyed and the first methionine codon was that of the CAT gene. The 5' -565/-355 region silencer construct was generated using PCR and the pCR-Script vector (Stratagene), and was subsequently ligated in both orientations immediately upstream of the B29 (-164) promoter into SacI/ClaI sites of pCAT Basic. These sites were carried over from the pSP73 cloning vector from the original subcloning of the -164 and -354 B29 promoter deletion fragments into the pCAT Basic construct. Mutagenized constructs were created using the Quik-Change mutagenesis kit (Stratagene) and the following complimentary oligonucleotides: 5'-GAAGTAGCAACAAAAgTTAAcTTATGGTTGGGCG-3' (mutant (m)A+T-rich1).
DNA transfections and CAT assays
The B cell line M12 was transfected by the DEAE-dextran method (28). Cells were cotransfected with 5 µg of CAT reporter plasmid and 1 µg of pRSV-luciferase. Extracts were prepared and assayed as described (5) and were quantitated by Phosphorimager analysis (Molecular Dynamics, Sunnyvale, CA). Results were normalized to luciferase activity and are the averages of at least three independent transfections using at least two preparations of DNA.
Nuclear extracts and DNA-binding assays
Preparation of crude nuclear extracts from M12 cells was
previously described (29). DNase I footprinting was
performed as described (29). The DNase I footprinting
probe was generated by 5' end-labeling with
[
-32P]ATP at the ClaI site of
pCR-Script containing the -565/-355 B29 upstream promoter
PCR fragment and then digestion with SacI. DNase I footprint
probes were purified by polyacrylamide gel electrophoresis. EMSA was
performed as described (5) with modifications of 2 µg
poly(dI.dC) and analysis in 4.5% of 60:1
polyacrylamide:bis-acrylamide using 0.5x TBE gels (44.5 mM Tris base,
44.5 mM boric acid, 1 mM EDTA, pH8) at 125 V for 2.5 h at room
temperature. Oct-1 in vitro translate was prepared using the TNT
coupled reticulocyte lysate system (Promega). Oct-1, Oct-2, and Bob1
Abs and Oct-1 and Oct-2 blocking peptides (Santa Cruz Biotechnology,
Santa Cruz, CA) used in EMSA were incubated in the binding reaction at
4°C overnight. EMSA probes were double-stranded oligonucleotides 5'
end-labeled with [-32P]ATP. EMSA probes were
purified by G25 Sephadex spin column chromatography (Sigma, St. Louis,
MO). EMSA oligonucleotide probes were as follows:
5'-GAAGTAGCAACAAAAATTAATTTATGGTTGGGCG-3' (A+T-rich motif),
5'-GAAGTAGCAACAAAAGTTAACTTATGGTTGGGCG-3' (mA+T-rich motif),
5'-TGTCGAATGCAAATCACTAGAA-3' (octamer; Santa Cruz Biotechnology),
5'-TGTCGAATGCAAGCCACTAGAA-3' (mOctamer; Santa Cruz Biotechnology), and
5'-TCTTCCAGAGCAAGGCAACCACAGGAGACC-3' (nonspecific TOAD motif).
Nuclear matrices and in vitro nuclear matrix attachment assays
Isolation of nuclei and nuclear matrices was performed according
to Cockerill and Garrard (30), as previously described
(31). Briefly, nuclei were isolated by dounce
homogenization and purified by centifugation through a 2-M sucrose
cushion. Endogenous DNA was degraded with DNase I for 1–2 h, and
histones were extracted by sequential washes with 2 M NaCl. The
resulting nuclear matrices were stored for up to 6 mo at -20°C after
combination with an equal volume of glycerol. Before use, matrices from
1.6 x 107 cells were washed three times
in 50 mM NaCl, 10 mM Tris-HCl (pH 7.4), 1 mM
MgCl2, 0.25 M sucrose, and 0.25 mg/ml BSA by
centifugation for 30 sec at 10,000 x g at 4°C and
were resuspended in 10–90 ml of assay solution. The final reaction
mixture consisted of 50 mM NaCl, 10 mM Tris-HCl (pH 7.4), 2 mM EDTA,
0.25 M sucrose, 0.25 mg/ml BSA, 20 ng/ml
[-32P]ATP end-labeled DNA fragments, and
50–200 mg/ml sonicated Escherichia coli DNA unlabeled
competitor. The reaction mixture was shaken for 1–3 h at 23°C;
washed three times; solubilized in 0.5% SDS and 0.4 mg/ml proteinase K
with 10 µg of unlabeled carrier DNA; and incubated overnight at
37°C. Material was phenol-extracted and ethanol-precipitated, and the
resulting purified matrix-bound DNA fragments were electrophoretically
resolved on 5% polyacrylamide-0.1% SDS gels. The gels were dried and
visualized by autoradiography.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Previous studies defined two B29 closely linked 5'
silencer elements, FROG (-381) and TOAD (-349), which function
cooperatively to govern the expression of the B29 minimal
promoter (7). Further deletion analysis of the region 5'
of the FROG element revealed a new upstream negative control region
(-565 to -411) with greater activity than FROG and TOAD combined.
Fig. 1
shows that the -565
B29 deletion construct exhibited significantly reduced
(p < 0.02) transcriptional activity compared
with the -411 deletion construct that contained both the FROG and TOAD
silencer elements. DNase I footprinting was used to detect DNA-protein
binding sites in the -565 to -411 B29 gene segment. A
single, strongly protected DNA segment (i.e., -480 to -443) was
obtained with nuclear protein extracts from M12 B cells (Fig. 2). This protected segment contained a
central A+T-rich DNA sequence (-475 to -457) that closely conformed
to noncanonical octamer factor binding motifs and to the consensus MAR
motif (16, 17, 19, 25, 32).
|
|
A double-stranded oligonucleotide probe (A+T-rich
motif) corresponding to the -480 to -443 DNase I protected
B29 segment (GAAGTAGCAACAAAAATTAATTTATGGTTGGGCG) formed
protein complexes with M12 B cell nuclear extracts when analyzed in
EMSA (Fig. 3A, lane
2). These complexes were specifically competed by cold
A+T-rich motif oligonucleotides but were not disrupted by cold
nonspecific competitor oligonucleotides (Fig. 3A,
lanes 5 and 7). Identical complexes were formed in EMSA with
all nuclear extracts tested from pre-B, T, myeloid, and fibroblast cell
lines, suggesting that the DNA-binding protein(s) in these complexes
may be ubiquitously expressed (data not shown). Octamer family members
recognize degenerate A+T-rich sequences like those in this
B29 segment and are expressed in different cell lineages
(15). They have also been implicated as silencers in
addition to their well known role as stimulatory factors
(33, 34, 35, 36, 37, 38, 39). Accordingly, we tested the effect of octamer
motif competitors in EMSA with the B29 A+T-rich containing
sequence. Formation of the -480 to -443 protein complex was blocked
by octamer consensus binding site oligonucleotide cold competitors,
suggesting that this DNA-protein interaction was likely to be mediated
by an octamer family member (Fig. 3A, lane 3).
The DNA-protein complex was not disrupted by a mutated octamer binding
site oligonucleotide competitor (Fig. 3A, lane 4)
or by a mutated A+T-rich sequence (mA+T-rich motif) competitor
oligonucleotide (Fig. 3A, lane 6), further
confirming a specific octamer factor interaction. This mutant
B29 A+T-rich motif also failed to form protein complexes
when used as a probe in EMSA (data not shown).
|
B, lane 2). The addition of
Oct-1 blocking peptide eliminated the super-shifted complex (Fig. 3B, lane 3), whereas addition of the Oct-2
blocking peptide had no effect (Fig. 3B, lane 4).
In vitro-translated Oct-1 specifically formed a complex with the
B29 A+T-rich motif probe, whereas the negative control (in
vitro-translated luciferase) showed no complex formation (data not
shown). Oct-2-specific Ab competed the faster migrating protein complex
with the B29 A+T-rich motif probe, which resulted in a
modest super-shifted complex (Fig. 3B, lane 5).
The addition of Oct-2 blocking peptide eliminated the super-shifted
complex (Fig. 3B, lane 6), whereas addition of
the Oct-1 blocking peptide had no effect (Fig. 3B,
lane 7). These combined data show that the 5' B29
segment containing the A+T-rich motif interacts specifically with both
Oct-1 and Oct-2 and suggest that this DNA-protein interaction may be
involved in the transcriptional regulatory activity of this
segment. Site-directed mutations in the 5' B29 A+T-rich motif that disrupt DNA-Oct-1/Oct-2 binding also eliminate silencer activity
The two engineered point mutations in the B29 A+T-rich
motif that prevented Oct-1 and Oct-2 binding in EMSA were tested for
silencer activity in the context of the B29 promoter
construct containing the complete upstream sequence to -565. These
introduced mutations in the A+T-rich Oct-1/Oct-2 binding site abolished
the transcriptional silencer activity of this extended 5' segment and
restored transcriptional activity to a level slightly greater than that
of the -354 B29 segment (Fig. 4). This result strongly suggests that
the Oct-1/Oct-2 binding motif is responsible for the silencing activity
of the A+T-rich sequence in the -565 construct. The previously
identified TOAD and FROG silencer elements (7) are
presumed to account for the residual negative transcriptional activity
of the -565 B29 promoter construct containing the mutated
A+T-rich motif (Fig. 4).
|
). The segment containing the
wild-type B29 A+T-rich octamer motif inhibited the
c-fos promoter comparably to the way it inhibited the
B29 minimal promoter (p < 0.001),
indicating that this 5' silencer element is active on heterologous
promoters. Silencing activity of the -565 to -355 segment on both the
B29 and c-fos promoters was completely eliminated
in constructs containing the mutated Oct-1/Oct-2 binding site
(p < 0.001). This reaffirms that the A+T-rich
octamer motif is the primary silencer element in this upstream
B29 gene segment. The -565 to -355 B29 segment
tested in these experiments included the wild-type FROG (-381) motif
but not the TOAD (-349) motif. The complete elimination of silencer
activity in the -565 to -355 segment with the mutated B29
A+T-rich octamer motif suggests that the retained wild-type FROG motif
without the TOAD motif was unable to exert silencer activity on either
B29 or c-fos promoters. When both the FROG and
TOAD motifs are present and the A+T-rich octamer motif is mutated (as
in Fig. 4), residual silencing activity remains. These data suggest a
cooperative and interdependent function for the two closely linked
B29 silencer elements TOAD and FROG that is independently
augmented by the Oct-1/Oct-2 binding site in the upstream A+T-rich
sequence.
|
The B29 A+T-rich octamer motif sequence matches the
sequence criteria for MAR binding protein interactions. In fact, this
sequence exactly conforms to the consensus motif for a known B
cell-specific MAR binding transcription activator protein known as B
cell regulator of IgH transcription (Bright) (40). The
Bright consensus sequence consists of an A+T-rich hexamer core sequence
flanked by at least two AT dimer repeats 
6 bp from the core hexamer
that are all contained within an ATC-restricted sequence of at least 13
bp (40). The B29 A+T-rich octamer motif
sequence consists of an AATTAA hexamer core with two AT dimers found 1
and 5 bp away from the hexamer core, and the ATC-restricted sequence
stretches over 18 bp (i.e.,
-475CAACAAAAATTAATTTAT-457).
However, B29 5' DNA segments containing the A+T-rich octamer
sequence and Bright consensus sequence (-507 to -422 and -565 to
-355) did not interact with Bright protein from BCg3R-1d B cell
transfectants, which express Bright protein (40, 41), and
did not bind in vitro translated Bright protein (Ref. 41
and data not shown). Anti-Bright Ab also had no effect on the protein
complexes seen with the B29 A+T-rich octamer motif in EMSA
(data not shown). Thus, the Bright transcription activator does not
appear to bind to the B29 A+T-rich octamer motif or to be a
component of the protein complexes detected in EMSA with this
sequence.
Even though the B29 A+T-rich octamer motif did not interact
with the MAR binding protein Bright, this sequence still conforms to
all of the sequence criteria of a MAR (16, 17, 19, 30, 32). Next we tested nuclear matrix protein binding of the -565
to -355 B29 A+T-rich octamer motif segment. Specifically,
two overlapping B29 promoter fragments encompassing the
B29 A+T-rich octamer motif (-475 bp), -565 to -355 and
-507 to -422, were used in standard in vitro nuclear matrix protein
binding assays (31) along with the positive control IgH V1
promoter (S107) MAR-containing DNA fragment known to interact with the
nuclear matrix (31, 41, 42). Restriction-digested plasmids
containing these DNA fragments from the B29 and IgH (S107)
genes were labeled and mixed with isolated nuclear matrices. After
multiple washes to remove non-matrix-bound DNA, the resulting nuclear
matrix-DNA pellets were subjected to proteinase K digestion and were
separated by electrophoresis. Fig. 6
shows that both B29 DNA fragments were bound by nuclear
matrix preparations at levels comparable to that of the IgH positive
control DNA fragment. Control non-MAR vector DNA fragments were not
retained by the nuclear matrix preparations. These data indicate that
the B29 A+T-rich octamer motif segment exhibits specific
binding to nuclear matrix proteins.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) and in truncated test
constructs with the B29 promoter and the c-fos
promoter, completely eliminated the silencer activity of this upstream
segment (Fig. 5).
The binding of Oct-1 and/or Oct-2 with the degenerate B29
A+T-rich octamer motif is essential for the silencer activity of this
5' B29 gene segment. Direct evidence for this negative
regulatory role of Oct-1 and/or Oct-2 in B29 gene expression
was demonstrated by site-directed mutations in the B29
A+T-rich octamer motif, which destroyed silencer activity on both the
B29 and the heterologous c-fos promoter (Fig. 4 and 5) and also eliminated Oct-1 and Oct-2 binding (Fig. 3). Octamer
factor binding is now implicated in the activity of silencers in a
number of other genes. Oct-1 was recently reported to act as a silencer
protein in the hTSHß promoter (33), the CYPA1
gene promoter (34), and the PIT-1/GHF1 gene
promoter (36). Oct-2 functions as a silencer factor in the
IL-2 enhancer (35), the tryrosine hydroxylase
promoter (43), and several viral promoters including the
herpes simplex virus immediate-early gene 3 promoter (44).
Additionally, both Oct-1 and Oct-2 have been shown to repress the HIV
long terminal repeat promoter (45). These examples and the
results presented here indicate that Oct-1 and Oct-2 function as
transcriptional silencers in addition to their better known roles as
transcriptional activators (37, 38, 39).
It is now evident that B29 transcriptional control is
determined by Oct-1 and/or Oct-2 functioning in opposing fashions. In
one context, Oct-1 and/or Oct-2 function as transcriptional inhibitors
when bound to the 5' A+T-rich octamer motif silencer, and in the other
they act as activators when bound to the canonical octamer motif in the
B29 minimal promoter (5, 6). These opposing
Oct-1- and/or Oct-2-mediated functions in B29 gene control
could be regulated by the differential interaction of bound Oct-1/Oct-2
with the B cell octamer transactivator or cofactor Bob1 (OCA-B, OBF-1)
(46, 47, 48). Based on the specific octamer binding site
sequence requirements for Bob1 binding (46, 49, 50, 51) and on
the fact that no ternary complexes (reflective of Bob1 interactions)
were identified in our EMSA with the B29 A+T-rich motif
(Fig. 3), we predict that Bob1 would not effect B29 A+T-rich
octamer motif silencer activity. In contrast, we have found that Bob1
is a potent transactivator in conjunction with Oct-1/Oct-2 binding to
the canonical octamer motif in the minimal B29 promoter
(Malone et al., manuscript in preparation). These findings provide a
plausible explanation for the dual and opposing activities of Oct-1
and/or Oct-2 in the regulation of the B29 promoter.
The B29 A+T-rich octamer motif not only interacts with the
Oct-1 and Oct-2 factors but also binds to nuclear matrix proteins as
well (Fig. 6). B29 promoter fragments encompassing the
B29 A+T-rich octamer motif showed binding to isolated
nuclear matrices equivalent to that of the IgH V1 promoter MAR element
used as the positive control in these experiments. Preliminary results
from in vivo nuclear matrix association assays conducted according to
Refs. 52 and 53 indicate that the
B29 A+T-rich octamer motif is preferentially associated with
nuclear matrices in isolated chromatin (results not shown). These
findings suggest that this region is likely to function as a MAR.
However, the present studies are not able to resolve whether the
B29 A+T-rich octamer motif also functions as a MAR because
transient transfections do not reflect nuclear matrix interactions
(54). These studies do establish that the silencer
activity of the B29 A+T-rich octamer motif can function
independent of any MAR involvement. Additional studies using either
stably transformed cells and/or transgenic mice will be necessary to
determine whether the B29 A+T-rich Oct-1/Oct-2 motif
functions both as a silencer and as a MAR.
Recent results with the hTSHß promoter (33) provide a compelling case in which an Oct-1 binding motif was shown to have the dual functions of a silencer and a MAR. The hTSHß promoter contains an A+T-rich Oct-1 binding motif with MAR homology (33), like the B29 A+T-rich octamer motif. Additionally, the B29 A+T-rich octamer motif conferred negative regulation on the B29 minimal promoter as has been shown for the A+T-rich Oct-1 binding motif and the hSTHß promoter (33). Furthermore, the hSTHß promoter Oct-1 binding site was tethered to the nuclear matrix in vivo (33). Oct-1 recently has been shown to be a component of the insoluble nuclear matrix in addition to its well known role as a soluble nuclear transcription factor (33, 55), along with several other transcription factors including SP-1, AP-1, and C/EBP (55). By analogy to these findings with the hTSHß promoter, the B29 A+T-rich octamer motif similarly may serve a dual function in B29 gene regulation by mediating silencer activity on the B29 promoter and by facilitating B29 gene association with the nuclear matrix (33, 55). Confirmation of such a duality would open a new dimension in B29 gene expression in B cell development.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Current address: Department of Microbiology and Immunology, Tulane University Medical Center, New Orleans, LA 70112
3 Address correspondence and reprint requests to Dr. Randolph Wall, University of California, 611 Charles E. Young Drive East, 529 Molecular Biology Institute, Los Angeles, CA 90095. E-mail address:
4 Abbreviations used in this paper: BCR, B cell receptor; MAR, matrix attachment region; CAT, chloramphenicol acetyltransferase; RSV, Rous sarcoma virus; Bright, B cell regulator of IgH transcription.
Received for publication October 18, 1999. Accepted for publication December 16, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
5 gene. J. Immunol. 155:2498.[Abstract]
transgenes blocks T lymphocyte development. Int. Immunol. 7:435. overexpressed in prothymocytes acts as an oncogene. Mol. Med. 3:72.[Medline]
This article has been cited by other articles:
|
|
 |
|
  B. P. Hermann and L. L. Heckert Silencing of Fshr Occurs through a Conserved, Hypersensitive Site in the First Intron Mol. Endocrinol., August 1, 2005; 19(8): 2112 - 2131. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L.-R. Liu, Z.-W. Du, H.-L. Zhao, X.-L. Liu, X.-D. Huang, J. Shen, L.-M. Ju, F.-D. Fang, and J.-W. Zhang T to C Substitution at -175 or -173 of the {gamma}-Globin Promoter Affects GATA-1 and Oct-1 Binding in Vitro Differently but Can Independently Reproduce the Hereditary Persistence of Fetal Hemoglobin Phenotype in Transgenic Mice J. Biol. Chem., March 4, 2005; 280(9): 7452 - 7459. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. K. Cheng, C. M. Yeung, R. L. C. Hoo, B. K. C. Chow, and P. C. K. Leung Oct-1 Is Involved in the Transcriptional Repression of the Gonadotropin-Releasing Hormone Receptor Gene Endocrinology, December 1, 2002; 143(12): 4693 - 4701. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Torigoe, H. Izumi, H. Ishiguchi, H. Uramoto, T. Murakami, T. Ise, Y. Yoshida, M. Tanabe, M. Nomoto, H. Itoh, et al. Enhanced Expression of the Human Vacuolar H+-ATPase c subunit Gene (ATP6L) in Response to Anticancer Agents J. Biol. Chem., September 20, 2002; 277(39): 36534 - 36543. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. S. Malone and R. Wall Bob1 (OCA-B/OBF-1) Differential Transactivation of the B Cell-Specific B29 (Ig{beta}) and mb-1 (Ig{alpha}) Promoters J. Immunol., April 1, 2002; 168(7): 3369 - 3375. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Andersen and M. G. Rosenfeld POU Domain Factors in the Neuroendocrine System: Lessons from Developmental Biology Provide Insights into Human Disease Endocr. Rev., February 1, 2001; 22(1): 2 - 35. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
