|
|
||||||||

*
Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine and Kingss College School of Medicine and Dentistry, University of London, London, United Kingdom; and
Division of Virology, Department of Pathology, University of Cambridge, Cambridge, United Kingdom
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The HHV-6 genome contains two genes, U12 and U51, which are predicted to encode proteins related to the family of G protein-coupled receptors (GCR) and most closely to the chemokine receptors (2). Chemokines are classified into four groups, CC, CXC, CX3C, and C, according to the distribution of conserved cysteine residues in the N-terminal region and their activities. They are proinflammatory cytokines that act to chemoattract specific subpopulations of circulating cells, for example monocytes or T lymphocytes, which are recruited during an inflammatory response (3). Receptors for chemokines comprise a distinct subgroup of the GCR superfamily. The receptors are multiply hydrophobic, with seven transmembrane domains, have numerous conserved sequence characteristics, and are classified according to the chemokine group specificity (4, 5).
Some chemokine receptors are also significant as coreceptors to CD4 for
HIV infection (reviewed in Ref. 6). Expression of the CC
chemokines RANTES, macrophage inflammatory protein-1
(MIP-1
) and
MIP-1ß contribute to the resistance of CD4+ T
cells from HIV-exposed-uninfected individuals to HIV infection, and
mutations in both chemokine receptor and chemokine genes have been
shown to confer resistance to HIV infection.
One family of betaherpesvirus-specific chemokine receptor homologues has been identified as the HCMV UL33-like family, whereas in our genomic studies of HHV-6, a distinct gene family encoding betaherpesvirus-specific chemokine receptor-like proteins was identified (2). HHV-6 U51 was the first member of the U51 family to be identified as a chemokine receptor-like protein by sequence analyses (2), but demonstration of function has yet to be shown. Here we show that together with its homologues in human CMV (HCMV), murine CMV (MCMV), and HHV-7, HHV-6 U51 comprises a betaherpesvirus-specific family of receptors. HCMV UL33 and UL78, MCMV M33 and M78, and HHV-7 U12 and U51 are homologues of the HHV-6 receptors U12 and U51, respectively (2, 7, 8, 9). HCMV contains two additional receptors, US27 and US28; the latter has been shown in vitro to bind the chemokines MCP-1, MIP-1a, MIP-1b, and RANTES (10, 11) and to act as a coreceptor for HIV-1 infection (12). Recently, HHV-6 U12 has also been shown to act as a ß chemokine receptor (13). The importance of the herpesviral chemokine receptor-like genes for virus persistence has been demonstrated by gene deletions. Deletion of the MCMV receptor-like gene M33 and its rat CMV homologue R33 from the respective viral genomes generated viruses that were viable, but impaired for growth in vivo (14, 15).
Although other herpesviral chemokine receptors have been investigated, no functional studies have been reported for the U51 receptor family. The U51 gene is highly conserved between HHV-6 strains. Variant A and B strains, U1102 and Z29 (GenBank accession no. 116947), show 94% identity. Using FASTA analyses, comparisons with homologues in the other sequenced betaherpesviruses show that HHV-6 U51 is most similar to HHV-7 (38% identity over 290 aa). It is also a positional homologue with HCMV UL78 and MCMV M78, averaging 20% identity over 200 aa. This betaherpesvirus GCR family are all encoded in the middle of the long unique regions of the respective genomes and are distinct from the HCMV US28 GCR family encoded at the ends of the genomes. U51 is also related to the herpesvirus saimiri ORF 74-encoded receptor, which has been shown to bind CXC chemokines (16). There is 24% identity, across 258 aa, between U51 and ORF 74. However, this gene and its homologues in the other gammaherpesviruses, HHV-8 (17), murine herpesvirus 68 (18), and equine herpesvirus 2 (19), are in a divergent genomic location at the right-hand end of the genome analogous to the location of U12 at one end (left) of the HHV-6 genome.
The specificity of the U51 family to the betaherpesviruses makes them useful in investigations of the unique aspects of the biology of this virus subfamily. In this work we sought to express and characterize HHV-6 U51 and to investigate its effect on a host cell. We show that U51 has some of the characteristics expected of a seven transmembrane-spanning protein and that stable expression leads to morphological alteration as well as specific binding and down-regulation of the chemokine RANTES, which is a potent chemoattractant for T lymphocytes, NK cells, monocytes, and eosinophils (3, 5). We suggest that the specific down-regulation of RANTES expression by a chemokine receptor-like protein represents a novel herpesviral immunomodulatory mechanism.
| Materials and Methods |
|---|
|
|
|---|
HHV-6A strain U1102 (2) was cultured in the CD4+ T cell leukemic cell line JJhan in RPMI 1640 medium, supplemented with 10% (v/v) FCS and 2 mM glutamine, 50 IU/ml penicillin, and 50 µg/ml streptomycin. The human immortalized epithelial cell line, HaCaT (20), was maintained in the same medium. Vero cells were maintained in DMEM supplemented as described for RPMI. The human erythroleukemia (K562) and premonocytic (U937) cells were cultured in RPMI 1640 supplemented as described above. Transfected cell lines were maintained in 500 or 750 µg/ml of G418 for HaCaT or K562 lines, respectively.
HHV-6-infected JJhan DNA was prepared 5 days postinfection. Infected cells and uninfected controls were washed with PBS (Dulbeccos A), taken into lysis buffer (10 mM Tris-HCl (pH 8.0), 10 mM EDTA, and 0.5% SDS), digested with proteinase K (0.25 mg/ml), extracted with phenol/chloroform/isoamyl alcohol (25:24:1), and then DNA precipitated from the aqueous phase with isopropanol.
Cloning of U51 gene into pCDNA3 and epitope tagging
The U51 gene was amplified using PCR with standard thermocycling procedures and Taq polymerase. The following primer set was used to amplify the coding region and to introduce BamHI restriction enzyme recognition sequences: 5'-AAAGGATCCTTACTTCGTTTATTC-3' and 5'-TATGGATCCAAAGGATCCACTCCT-3'. The amplified product was digested with BamHI restriction enzyme, separated by agarose gel electrophoresis, and purified by phenol extraction followed by ethanol precipitation. The purified DNA fragment was ligated with BamHI-digested, phosphatased plasmid pCDNA3 (Invitrogen) and transformed into Escherichia coli strain JM109. The selected clone was checked by sequence analyses and designated pcDNA3-U51. This plasmid was then epitope tagged with the sequence encoding the 9-aa epitope from influenza hemagglutinin recognized by mAb 12CA5 (Babco, Richmond, CA; Boehringer Mannheim, Indianapolis, IN) as described previously (21). The following primer was used to introduce this sequence into the N-terminal end of the U51 gene, such that the epitope-encoding sequences were inserted after the initiating methionine and glutamic acid codons: 5'-CTTCGTTTCTTTAGCATAATCCGGCACATCGTATGGATACTCCATCCTG-3'. Site-directed mutagenesis was performed following the Kunkel method (22), as described previously (21). This plasmid was designated pcDNA3-U51D.
In vitro transcription/translation and transient expression
In vitro transcription and translation (IVTT) was conducted using the transcription and translation-coupled rabbit reticulocyte lysate system (Promega, Madison, WI) according to the manufacturers instructions. Briefly, 0.5 µg of plasmid was used in an IVTT mix containing 12.5 µl of rabbit reticulocyte lysate, 20 U of RNasin, 15 µCi of [35S]methionine (SJ1515, Amersham, Arlington Heights, IL), and 7.5 U of T7 RNA polymerase. Reactions were conducted at 30°C for 90 min, then analyzed directly by SDS-PAGE or immunoprecipitated.
For transient expression, the T7 RNA polymerase-vaccinia system (23) was used as described previously (21). Vero cells (3 x 105) were infected (input multiplicity 1 PFU/cell) with recombinant vaccinia virus vTF-3, expressing the T7 RNA polymerase (23). After 2.5-h incubation at 37°C, infected cells were transfected, using Lipofectin and OPTIMEM (Life Technologies, Gaithersburg, MD), with 7.5 µg of plasmid. After a further 4-h incubation, cells were washed with DMEM deficient in methionine and labeled at 37°C for 13 h with 2 µl (15 mCi/ml) of [35S]methionine in methionine-deficient medium. Lysates were then prepared and immunoprecipitated.
Cell lysis, immunoprecipitation, and gel electrophoresis
Labeled cells from transient expression experiments were washed three times with ice-cold PBS, then lysed for 30 min into 0.5 ml of ice-cold RIPA buffer (21). Lysates were sonicated (1 min on setting 6; Heat Systems (Farmingdale, NY) XL2020 sonicator with cup horn), cleared by microcentrifugation (13,000 rpm, 30 min, 4°C), and stored at -20°C. After preclearing with 50 µl of protein A-Sepharose (50% swollen volume in RIPA buffer), equal amounts of lysate (quantitated by scintillation counting of TCA precipitates) were incubated at 4°C overnight with Abs (1 µl of anti-influenza hemagglutinin (HA) type 1 mAb 12CA5 (Boehringer Mannheim)) recognizing the epitope tag. Immune complexes were precipitated with protein A-Sepharose, washed three times with RIPA buffer, and eluted in sample buffer.
For direct analysis, IVTT reaction products were diluted with an equal volume of 2x SDS sample buffer (without DTT) and resolved by SDS-PAGE. For immunoprecipitation, IVTT reactions were diluted to 0.5 ml with RIPA buffer.
Except where noted in the text, to avoid aggregation of the hydrophobic U51 protein, all samples were sonicated, rather than heated, before separation by electrophoresis. SDS-PAGE was performed in 12% precast gels (Novex, San Diego, CA) as described previously (21).
Generation of cell lines expressing U51
The plasmids pcDNA3-U51 (wild-type U51), pcDNA3-U51D (epitope tagged), and (pcDNA3) vector-only control were transfected into either HaCaT epithelial cells using Lipofectin (Life Technologies) according to the manufacturers protocol or K562 cells using electroporation (electroporator with capacitance extender, Bio-Rad, Hercules, CA). HaCaT-expressing colonies were selected and grown using RPMI culture medium (10% FCS) supplemented with 500 µg/ml geneticin (G418, Life Technologies). Epithelial cell colonies were Perspex ring cloned and analyzed by DNA PCR using the SP6 and T7 primers to amplify across the multiple cloning site in pcDNA3. The U51 clones were screened for expression by reaction with HHV-6 human sera in immunofluorescence assays as well as by RT-PCR as described below. Two each of independently derived vector (V)-only, U51 wild-type (U51), and U51tag (U51D) cell lines were used for further study and were labeled V-2, V-5, U51-3, U51-6, U51D-3, and U51D-5. The K562 cells were similarly selected using G418 at 750 µg/ml followed by cloning from the resistant population using limiting dilution. Four clonal lines of U51-expressing cells were selected. Cells were stored in liquid nitrogen before use, and only low passage clones (less then passage 5) were used in these studies.
RT-PCR
Confluent HaCaT or dense K562 cell lines cultured in 25-cm2 flasks were washed twice with PBS, then lysed in 1 ml of cold RNA Isolator reagent (Genosys, The Woodlands, TX) and incubated at room temperature for 5 min. Chloroform (0.2 ml) was added, and the mixture was shaken until emulsified, then incubated for 15 min. After microcentrifugation (13,000 rpm for 30 min at 4°C), RNA was isopropanol precipitated from the aqueous phase, then pelleted by microcentrifugation. The RNA pellet was washed with 75% (v/v) ethanol (in water) and air-dried. Contaminating DNA was removed using DNase (Promega; 0.08 U/ml, 2 h at 37°C). DNase-treated RNA was extracted with phenol/chloroform/isoamyl alcohol (25:24:1), precipitated with ethanol, washed with 70% (v/v) ethanol (in water), and resuspended in water to 150 ng/ml.
Complementary DNA was synthesized from 2 µg of template RNA using 8 U/ml Moloney murine leukemia virus reverse transcriptase (Promega) in a 60-µl reaction containing 0.5 mM dNTP, 100 U of RNasin, 10 ng/ml random hexamers, 1x RT buffer (50 mM Tris-Cl (pH 8.3), 75 mM KCl, 3 mM MgCl2, and 10 mM DTT). RNA was heated to 65°C for 10 min before cDNA synthesis, chilled on ice for 5 min, then added to the prepared reaction mix. Parallel reactions, excluding RT, were prepared for each RNA template to confirm the absence of contaminating DNA. Reactions were incubated at 37°C for 2 h, then diluted with an equal volume of water and stored at -20°C.
PCR was conducted in 30-µl reactions containing, as standard, 200
µM of each dNTP, 250 ng of each primer, and 1.5 U of Taq polymerase
(Promega; storage buffer B) in 1x Taq reaction buffer. RANTES
reactions contained 0.7 mM MgCl2; all others
contained 1.5 mM. Primer sequences were as follows (expected product
sizes in base pairs are given in parentheses): ß-actin: actin-F,
GATGGAGTTGAAGGTAGTTT; actin-B, TGCTATCCAGGCTGTGCTAT (445 bp); HHV-6
U51: U51-F, TCGGTCGAGAATACGCTGTG; U51-B, AGATACGTAGTCACGGTCGA (493
bp); IL-8: IL-8-1, CTTCCTGATTTCTGCAGCTCTGTG; IL-8-2,
CAAAAACTTCTCCACAACCCTCTG (245 bp);
2
integrin: AL2-1, CCCTCTGGACAGCTTCTAGAG; AL2-2,
GAAATCCCCGCTTACCTTGAC (189 bp); and RANTES: RAN-1,
TCGCTGTCATCCTCATTGCTACTG; RAN-2, CATCTCCAAAGAGTTGATGTACTC (248 bp).
Thermal cycling parameters for ß-actin and U51 reactions were
94°C for 1 min, 58°C for 1 min, and 72°C for 2 min, for 40
cycles; for IL-8 reactions the parameters were 94°C for 30 s,
55°C for 30 s, and 72°C for 2 min, for 40 cycles; for RANTES
and
2 integrin reactions the parameters were
95°C for 30 s, 49°C for 30 s, and 72°C for 2 min for 40
cycles. PCR product identities were confirmed by sequencing using the
ABI Prism 377 automated sequencer (Applied Biosystems, Foster City, CA)
according to the manufacturers instructions.
Chemokine binding assay
Binding assays were conducted as described previously
(24). Log phase cells (K562-U51 or K562-vector) were
washed twice in unsupplemented RPMI, then resuspended at 2.5 x
107 cells/ml in binding medium (RPMI, 0.1% BSA,
and 20 mM HEPES, pH 7.4) on ice. Where appropriate, U937 cells were
used as positive controls. Assays, in duplicate or triplicate,
contained 2.5 x 106 cells, 166 pM
radiolabeled chemokine, and varying concentrations of unlabeled
competitor chemokine. After 2-h incubation on ice with regular mixing,
the cells were separated from the unbound chemokine by
microcentrifugation through a pthlalate oil cushion (1.5 parts dibutyl
phthalate to 1 part bis-(2-ethylhexyl)phthalate). Bound radioactivity
was then counted using a gamma counter. Data analysis was conducted
using the EBDA and LIGAND programs (version 2, 1985) (25).
125I-labeled RANTES (sp. act., 2000 Ci/mmol),
IL-8, and MIP-1
were obtained from Amersham, unlabeled
chemokines were obtained from PeproTech (Rocky Hill, NJ), and RANTES
was obtained from R&D Systems (Minneapolis, MN).
Quantification of RANTES secretion
A RANTES enzyme immunoassay was used according to the manufacturers instructions (R&D Systems, DRN00). Each sample of culture supernatant was tested, in duplicate, undiluted as well as diluted 1/10 and 1/100. A series of standards was also tested in each assay, and the results were used to plot a standard curve from which the test results were determined. The range of sensitivity for the assay was 31.252000 pg/ml, with usually two of the three sample dilutions giving concentrations within this range. Unused culture medium without G418, processed in parallel to exclude any effect of the drug on results, gave readings equivalent to background. All within-assay range results for a sample were used to calculate a weighted mean concentration.
| Results |
|---|
|
|
|---|
U51 defines a new herpesvirus GCR family with only limited similarity to chemokine receptors. Although the degree of overall sequence identity between members of the U51 family is low, they have numerous common features and a conserved genomic location. The U51 family genes are located within block IV of the seven conserved herpesvirus gene blocks (2). Although the flanking genes within this block, notably those for glycoprotein H (HHV-6 U48) and the viral protease/assemblin (HHV-6 U53), are present in herpesviruses of all three subfamilies, the U51 homologues are found only in the betaherpesviruses. Using FASTA together with multiple alignment analyses, U51 was found to be a member of the class A family of GCRs that includes rhodopsin, adrenergic receptors, and chemokine receptors (26).
Unlike other herpesvirus GCRs characterized, U51 shares only limited
similarity to the chemokine receptors. The closest homologues show only
borderline overall similarity, with 2024% identity to the functional
CXC receptor from herpesvirus saimiri, ORF 74, as well as the cellular
receptor, CCR7 (EBI1), inducible by both HHV-6 and EBV (16, 27, 28). However, although only distantly related, U51 does have a
similar length and overall structure as the chemokine receptors. Other
similar features to chemokine receptors are shown by amino acid
sequence alignment using CXCR2 (IL-8ß receptor) and CCR1 (MIP-1
and RANTES receptors) as prototypes for CXC and CC receptors,
respectively (Fig. 1
). U51 shares some
features with the human chemokine receptors and GCRs (4, 29). It has the characteristic seven-transmembrane predicted
structure (Fig. 1
) together with basic residues in the first
intracellular loop as well as conserved tyrosines in the first and
fifth transmembrane domains; prolines in the second, fifth, and sixth
transmembrane domains; tryptophan in the first extracellular loop; and
cysteine in the second extracellular domain. It also has conserved
cysteine, proline, and histidines in the seventh transmembrane domain,
although these cannot be exactly aligned. It has potential sites for
chemokine ligand binding at the acidic residues in the extracellular
N-terminal domain and charged residues in the third extracellular
domain, whereas regions in the transmembrane and intracellular domains
have potential for mediating intracellular signaling. Here, like other
GCRs, it has conserved prolines in the sixth and seventh transmembrane
domains, and in common with the CXC chemokine receptors, U51 has a
predicted N-glycosylation site in the second extracellular
domain. However, like herpesvirus saimiri ORF 74, it does not have the
conserved aspartate in the second transmembrane domain and has only a
few clusters of serines in the C-terminal intracellular loop.
|
Overall, the U51 family appears to define a new
betaherpesvirus-specific family of G protein-coupled receptor genes,
with only distant similarity to the chemokine receptors. Amino acid
residues specific to this family are marked in Fig. 1
.
Biochemical characterization of U51
For a preliminary investigation of the properties of U51, the HHV-6A strain U1102 U51 gene and a modified version (termed U51D) containing the HA epitope tag at the N-terminus were each inserted into the eukaryotic expression vector pcDNA3, putting them under the control of the T7 promoter and the human CMV major immediate-early promoter.
IVTT of the U51 constructs generated products with properties typical
of a seven-transmembrane-spanning protein. Wild-type U51 showed a
discrete band of 28 kDa, consistent with the U51 monomer, although
smaller than the predicted Mr of 34.7
kDa, and a broad range of higher Mr
species centered around 180 kDa (Fig. 2
A). IVTT of U51D gave rise to
a similar band profile, with the monomer slightly increased in size to
30 kDa, most likely due to a conformational effect of the 9-aa epitope
tag (Fig. 2
A). When samples were heated to 95°C before
electrophoresis, the 28-kDa (U51) or 30-kDa (U51D) band disappeared
(Fig. 2
A), consistent with aggregation of a multiply
hydrophobic protein. The ladder of bands seen with IVTT U51 and U51D
(Fig. 2
A, lanes 1 and 2)
increase in size by
8-kDa increments, consistent with the size of
ubiquitin, which may be added to misfolded hydrophobic proteins
synthesized by IVTT (30). Inclusion of canine pancreatic
microsomal membranes in the IVTT mix caused an increase in the size of
the discrete band, consistent with use of the single predicted
N-glycosylation site in the second extracellular domain of
U51 (Fig. 2
B). As with unglycosylated U51, heating the
glycosylated form caused increased aggregates of high
Mr oligomers at the top of the gel
(Fig. 2
, A and B).
|
|
Stable expression of U51 in epithelial cells
HHV-6 in vivo can infect and be secreted from epithelial cells,
which are important for host-to-host transmission in saliva and also as
a barrier in systemic infections (31, 32, 33). However, the
virus then permissively infects circulating cell types. Virus
chemokines and their receptors may modulate interactions between these
cell types. To investigate the effect of U51 expression on an
epithelial cell, HaCaT cells were used as a model system, because they
can undergo normal differentiation (20), and epithelial in
vitro culture systems that are fully permissive for HHV-6 replication
have not been defined. Furthermore these cell lines provide an
unlimited standardized system for characterization. Transient and
stably transfected cell lines were established with the same plasmid
clones used to demonstrate protein expression in the Vero-vaccinia T7
transient expression assays (pcDNA3-U51, pcDNA3-U51D, or vector alone).
U51D could easily be detected in the transiently transfected, vaccinia
T7-infected HaCaT cells by immunoprecipitation with the tagging mAb,
12CA5, with results similar to those shown above for Vero cells.
However, in the absence of amplification of gene expression by the T7
polymerase, the U51 gene product could not be detected by
immunoprecipitation in transient or stably transfected cell lines,
although the U51 transcript was detected by RT-PCR (Fig. 4
, upper panels). Thus, this
level is lower than that detectable using the tagging mAb, and possibly
higher levels are not consistent with cell survival, as shown for other
multiple membrane proteins. The U51 cell lines were further screened by
immunofluorescence for reactivity with HHV-6-seropositive sera, and
three of seven sera tested showed positive fluorescence with no
reaction to the vector-only cell lines.
|
|
Chemokine expression has been shown to alter cellular morphology
(34), and infection with HHV-6 or HCMV can alter both
chemokine expression (35, 36) as well as cellular
morphology (1). In HCMV infections, RANTES can be
sequestered via HCMV US28 chemokine receptor (36). It was
therefore of interest to investigate the effect of U51 on chemokine
expression and possible autologous feedback mechanisms. To this end,
RT-PCR was used to test for expression of RANTES and IL-8, as
representative CC and CXC chemokines, with ß-actin used as a control.
2 integrin was used as an additional control,
with indistinguishable results from actin (not shown).
Amplification from equal amounts of cDNA template generated from the
HaCaT cell lines U51-3, U51-6, U51D-3, U51D-5, V2, and V7 showed that,
compared with the control cell lines V2 and V7, the level of RANTES
RT-PCR product was reduced in all U51 and U51D lines by at least
10-fold (Fig. 5
).Titrations of cDNA
template in serial dilutions followed by separate PCR amplifications
confirmed that the reduction was
10-fold, whereas ß-actin,
2 integrin, and IL-8 RT-PCR product yields
were similar in all cell lines (Fig. 5
). On the basis of these results,
it seemed that U51 was specifically causing regulation of RANTES
expression.
|
Ligand binding characteristics of HHV-6 U51
Having identified U51 as a chemokine receptor-like protein and
shown that its expression is associated with down-regulation of RANTES,
but not that of IL-8, it was important to determine ligand binding. To
investigate this, U51 was stably expressed in K562 cells, which have
been used previously for similar assays, for example HCMV US28 and
HHV-6 U12, and do not express the MIP-1
/RANTES receptor or show
specific competable binding of chemokines (11, 13).
Binding assays using 125I-labeled chemokines
showed clearly that U51 binds RANTES, but not IL-8 or MIP-1
(Fig. 7
A). The positive control cell
lines used were U937 cells that express functional receptors (Fig. 7
A).
|
To compare the ligand binding profile of U51 with those of other
receptors, we tested a panel of unlabeled chemokines for competition of
RANTES binding to U51. Of those tested, MCP-1, MCP-3, MCP-4, eotaxin,
and vMIPII did compete binding, while, consistent with the direct
binding assays described above (Fig. 8
)
MIP-1
and IL-8 did not. Thus, U51 shows a unique ligand binding
specificity compared with data on known chemokine receptors.
|
| Discussion |
|---|
|
|
|---|
Analysis of epitope-tagged and wild-type U51 expressed in vitro and transiently in cells showed that, as predicted from the hydrophobicity analysis of the predicted amino acid sequence, U51 has the characteristics of a highly hydrophobic multiple membrane protein, aggregating when heated. Interestingly, a prominent 58-kDa form of U51, consistent with a dimer, was observed during cellular expression but not by in vitro transcription-translations. This form may be favored in vivo and require modifications or correct membrane insertion to form. Dimerization is functionally relevant for some of the human chemokine receptors; CCR5 is present in a dimeric form on the cell surface (37), and CCR2 forms dimers in a ligand-dependent manner (38).
U51 binding specificity resembled those of HHV-6 U12 and CCR3. These
results have shown that U51 has a high affinity for the CC chemokine,
RANTES (Kd of 0.8 nM), as well as
specificity for MCP-1, but not for the CXC chemokine, IL-8. These
properties are similar to those of U12, which has an affinity for
RANTES of 1.3 nM (13). Both HHV-6 U12 and U51 differ from
HCMV US28 in that they do not bind MIP-1
efficiently. HCMV US28,
which most closely resembles U12 and some other CC chemokine receptors,
also binds RANTES, MCP-1, as well as the viral chemokine, HHV-8 vMIPII
(10, 11, 40, 39). We also show U51 can bind HHV-8 vMIPII.
This binding is of interest, as HHV-6 has been identified in
HHV-8-associated Kaposi sarcoma lesions, and chemotaxis of
HHV-6-infected cells chemoattracted via U51 specificity for vMIPII
could affect migration of HHV-6-infected cells to an HHV-8-associated
lesion, possibly affecting pathology (41). Additionally,
we have shown that U51 has some specificity for eotaxin, like CCR3, but
also to MCP-3 and MCP-4, thus displaying a binding profile to a subset
of CC chemokines that is distinct from those of receptors described to
date. Interestingly, HHV-6 U12 and U51 appear to have different
regulatory mechanisms, in that U12 is expressed late and U51 is
expressed at early times postinfection (13, 42). Thus,
binding of RANTES or other chemokines at different times in the
replicative pathway may result in different downstream signaling.
Stably expressed U51 had two effects on HaCaT cells: down-regulation of
RANTES expression (with no effect on IL-8) and morphological
alteration, both possible downstream effects of signaling through this
receptor. The ability of U51 to bind RANTES, but not IL-8, was
consistent with the effects of U51 expression on these two chemokines.
Initial investigations of the effect of U51 on chemokine expression
using RT-PCR showed an
10-fold reduction in the level of
RANTES-specific RT-PCR signal in the U51- and U51D-expressing HaCaT
cell lines. The reduced RT-PCR signal for RANTES was reflected in
RANTES levels in culture supernatants of the cell lines; both U51 and
U51D cell lines had lower levels than vector control lines. Similar
results were found for the K562 U51 lines, although at a lower overall
level of RANTES that did not affect binding affinity measurements (not
shown). It is possible that the receptor is acting constitutively or is
using an undefined mechanism, but the cell lines are secreting RANTES,
which could bind the receptor. Both the U51 wild-type and
epitope-tagged lines gave similar results, which suggest that insertion
of the epitope at the N-terminus does not affect the activity on RANTES
expression. In cellular studies, levels of RANTES mRNA and protein
correlate, indicative of transcriptional regulation (43).
The RANTES down-regulation shown in the U51 cell lines was also similar
between RNA and secreted protein levels. This is consistent with a
transcriptional mechanism of RANTES inhibition caused by U51. The
U51-expressing epithelial cells also showed moderately increased
spreading and flattening independent of any effect on growth or
viability. This is of interest, as such changes in cell morphology,
motility, or differentiation may enhance the spread of HHV-6, which is
primarily cell associated and disseminates predominantly via direct
fusogenic cell-cell spread, with cytopathic effects on morphology
causing enlarged cells (1). All the cell lines maintained
their characteristic epithelial spreading responses to collagen-,
laminin-, and fibronectin-coated dishes (not shown). Binding of RANTES
to its receptors can cause morphological alterations and adhesion
molecule redistribution (34). The relationship of U51
expression to such effects and cellular differentiation will be further
investigated.
Interestingly, although it retains chemokine binding activity despite low identity with other chemokine receptors, U51 does not appear to function as an HIV coreceptor, at least with the expression levels obtained with the pcDNA3-U51 construct used in a transient expression system and the strains analyzed (44). However, possible interactions could have an effect on HIV infection with RANTES-sensitive strains via the chemokine regulation as demonstrated here.
HCMV has a biphasic effect on RANTES expression, down-regulating initially but then later, after infection, up-regulating (45). HCMV deleted of the US28 gene are unable to induce this effect; however, the down-regulation was shown to be mediated by chemokine sequestration from the medium and not via a transcriptional mechanism (36). HCMV does inhibit transcription of another CC chemokine, MCP-1, but the US28 receptor is not required for this effect (46). Our data provide evidence for an effect on chemokine expression by a viral chemokine receptor, HHV-6 U51. Altering the levels of chemokines such as RANTES may affect selective recruitment of circulating inflammatory cells such as T lymphocytes and monocytes, which may enhance lytic or latent infections with HHV-6 of these cell types.
In summary, we have shown that stable expression of HHV-6 U51, a member of the GCR superfamily distantly related to chemokine receptors, can specifically bind RANTES and is associated with morphological alteration in epithelial cells and down-regulation of RANTES expression, both transcripts and secreted protein. The U51 homologues comprise a betaherpesvirus-specific gene family that may have a conserved immunomodulatory role. This represents a novel mechanism by which a betaherpesvirus can modulate the host immune response and may subvert it to enhance infection.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Department of Microbiology, University of Pennsylvania School of Dental Medicine, Philadelphia, PA 19104. ![]()
3 Address correspondence and reprint requests to Dr. U. A. Gompels, Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, University of London, Keppel Street, London, United Kingdom WC1E 7HT. E-mail address: ![]()
4 Abbreviations used in this paper: HHV-6, human herpesvirus 6; GCR, G protein-coupled receptor; MIP, macrophage inflammatory protein; MCP, monocyte chemoattractant protein; ORF, open reading frame; IVTT, in vitro transcription and translation; HA, hemagglutinin; HCMV, human CMV; MCMV, murine CMV. ![]()
Received for publication July 15, 1999. Accepted for publication December 20, 1999.
| References |
|---|
|
|
|---|
32. J. Biol. Chem. 272:30603.This article has been cited by other articles:
![]() |
E. L. Sharp, N. J. Davis-Poynter, and H. E. Farrell Analysis of the subcellular trafficking properties of murine cytomegalovirus M78, a 7 transmembrane receptor homologue J. Gen. Virol., January 1, 2009; 90(1): 59 - 68. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tadagaki, K. Yamanishi, and Y. Mori Reciprocal roles of cellular chemokine receptors and human herpesvirus 7-encoded chemokine receptors, U12 and U51 J. Gen. Virol., May 1, 2007; 88(5): 1423 - 1428. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cermelli, V. Cenacchi, F. Beretti, F. Pezzini, D. D. Luca, and E. Blasi Human herpesvirus-6 dysregulates monocyte-mediated anticryptococcal defences J. Med. Microbiol., June 1, 2006; 55(6): 695 - 702. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Fitzsimons, U. A. Gompels, D. Verzijl, H. F. Vischer, C. Mattick, R. Leurs, and M. J. Smit Chemokine-Directed Trafficking of Receptor Stimulus to Different G Proteins: Selective Inducible and Constitutive Signaling by Human Herpesvirus 6-Encoded Chemokine Receptor U51 Mol. Pharmacol., March 1, 2006; 69(3): 888 - 898. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Dewin, J. Catusse, and U. A. Gompels Identification and Characterization of U83A Viral Chemokine, a Broad and Potent {beta}-Chemokine Agonist for Human CCRs with Unique Selectivity and Inhibition by Spliced Isoform J. Immunol., January 1, 2006; 176(1): 544 - 556. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhen, B. Bradel-Tretheway, S. Sumagin, J. M. Bidlack, and S. Dewhurst The Human Herpesvirus 6 G Protein-Coupled Receptor Homolog U51 Positively Regulates Virus Replication and Enhances Cell-Cell Fusion In Vitro J. Virol., September 15, 2005; 79(18): 11914 - 11924. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tadagaki, K. Nakano, and K. Yamanishi Human Herpesvirus 7 Open Reading Frames U12 and U51 Encode Functional {beta}-Chemokine Receptors J. Virol., June 1, 2005; 79(11): 7068 - 7076. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Michel, I. Milotic, M. Wagner, B. Vaida, J. Holl, R. Ansorge, and T. Mertens The human cytomegalovirus UL78 gene is highly conserved among clinical isolates, but is dispensable for replication in fibroblasts and a renal artery organ-culture system J. Gen. Virol., February 1, 2005; 86(2): 297 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. De Bolle, L. Naesens, and E. De Clercq Update on Human Herpesvirus 6 Biology, Clinical Features, and Therapy Clin. Microbiol. Rev., January 1, 2005; 18(1): 217 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. F. Kaptein, P. S. Beisser, Y. K. Gruijthuijsen, K. G. M. Savelkouls, K. W. R. van Cleef, E. Beuken, G. E. L. M. Grauls, C. A. Bruggeman, and C. Vink The rat cytomegalovirus R78 G protein-coupled receptor gene is required for production of infectious virus in the spleen J. Gen. Virol., September 1, 2003; 84(9): 2517 - 2530. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. E. Miller, D. A. Houtz, C. D. Nelson, P. E. Kolattukudy, and R. J. Lefkowitz G-protein-coupled Receptor (GPCR) Kinase Phosphorylation and {beta}-Arrestin Recruitment Regulate the Constitutive Signaling Activity of the Human Cytomegalovirus US28 GPCR J. Biol. Chem., June 6, 2003; 278(24): 21663 - 21671. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Luttichau, I. Clark-Lewis, P. O. Jensen, C. Moser, J. Gerstoft, and T. W. Schwartz A Highly Selective CCR2 Chemokine Agonist Encoded by Human Herpesvirus 6 J. Biol. Chem., March 21, 2003; 278(13): 10928 - 10933. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.H. Dockrell Human herpesvirus 6: molecular biology and clinical features J. Med. Microbiol., January 1, 2003; 52(1): 5 - 18. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Lee, U. H. Koszinowski, S. R. Sarawar, and H. Adler A Gammaherpesvirus G Protein-Coupled Receptor Homologue Is Required for Increased Viral Replication in Response to Chemokines and Efficient Reactivation from Latency J. Immunol., January 1, 2003; 170(1): 243 - 251. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. W. Chensue Molecular Machinations: Chemokine Signals in Host-Pathogen Interactions Clin. Microbiol. Rev., October 1, 2001; 14(4): 821 - 835. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bridgeman, P. G. Stevenson, J. P. Simas, and S. Efstathiou A Secreted Chemokine Binding Protein Encoded by Murine Gammaherpesvirus-68 Is Necessary for the Establishment of a Normal Latent Load J. Exp. Med., August 6, 2001; 194(3): 301 - 312. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Luttichau, J. Gerstoft, and T. W. Schwartz MC148 encoded by human molluscum contagiosum poxvirus is an antagonist for human but not murine CCR8 J. Leukoc. Biol., August 1, 2001; 70(2): 277 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fraile-Ramos, T. N. Kledal, A. Pelchen-Matthews, K. Bowers, T. W. Schwartz, and M. Marsh The Human Cytomegalovirus US28 Protein Is Located in Endocytic Vesicles and Undergoes Constitutive Endocytosis and Recycling Mol. Biol. Cell, June 1, 2001; 12(6): 1737 - 1749. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Bahr and G. Darai Analysis and Characterization of the Complete Genome of Tupaia (Tree Shrew) Herpesvirus J. Virol., May 15, 2001; 75(10): 4854 - 4870. [Abstract] [Full Text] |
||||
![]() |
S. A. Oliveira and T. E. Shenk Murine cytomegalovirus M78 protein, a G protein-coupled receptor homologue, is a constituent of the virion and facilitates accumulation of immediate-early viral mRNA PNAS, March 13, 2001; 98(6): 3237 - 3242. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Vink, E. Beuken, and C. A. Bruggeman Complete DNA Sequence of the Rat Cytomegalovirus Genome J. Virol., August 15, 2000; 74(16): 7656 - 7665. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |