| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Immunology, The Forsyth Institute, Boston, MA 02115;
Mitsubishi-Tokyo Pharmaceuticals, Yokohama Research Center, Yokohama, Japan; and
Department of Oral Biology, Dental Research Center, University of Medicine and Dentistry of New Jersey-New Jersey Dental School, Newark, NJ 07103
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The effects of a variety of cytokines have been investigated in in
vitro models of osteoclast induction from bone marrow precursor cells.
Proinflammatory cytokines such as IL-1
ß and TNF- induce bone
resorption by promoting differentiation of osteoclast precursor cells
and by activating osteoclast cells (8). In contrast,
Th2-type cytokines IL-4 and IL-13 abrogate the bone resorption induced
by IL-1 (9). Given the evidence of production of both
Th1- and Th2-type cytokines in the gingival tissue of PD patients
(10), a subtle imbalance of cytokine profile may affect
the induction of bone resorption in PD. For example, the Th1 cytokine
IFN-
induces the production of IL-1 by macrophages as the result of
a second signal provided by LPS (11). The Th2 cytokines
IL-4 or IL-10 inhibit secretion of IL-1 and TNF- by macrophages
treated with LPS (12, 13). Although there are many in
vitro studies of the effects of Th1- or Th2-type cytokines on
osteoclast differentiation and macrophage stimulation, the
physiological role of Th1- or Th2-type T cells on bone resorption in
vivo is unknown.
Complete T cell activation requires two signals, one from the TCR and the other from costimulatory molecules (14). B7/CD28 seem to provide the major costimulatory signals, which regulate T cell proliferation and production of IL-2 (15). CTLA4Ig, a fusion protein of human CTLA4 and the Fc fragment of human IgG has been demonstrated to be a dramatic inhibitor of Ag-specific T cell response (16). Blocking of B7/CD28 costimulatory signaling with human CTLA4Ig, which cross reacts with many other species including mice and rats, has inhibited the progression of autoimmune diseases in vivo (17) and rejection of allo- or xenografts (18, 19). Because B7/CD28 signaling itself is not functional until MHC/TCR signaling is provided to the T cells (20), the inhibition of an immune response with CTLA4Ig can indicate the involvement of Ag-specific T cells in that response. In the present studies of a rodent model, we found that 1) local stimulation of Th1-type T cells, but not of Th2-type cells, by MHC class II+/B7+ APC could induce bone resorption in rat periodontal tissue; 2) LPS was required for the induction of B7 costimulatory molecules on gingival APC; and 3) blocking of B7 costimulatory molecules with CTLA4Ig abrogated bone resorption induced by Th1-type T cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Rowett strain (Forsyth Institute inbred over 20 generations) female rats, rnu/+ (heterozygous normal) with restricted oral flora, were bred in plastic isolators and maintained under pathogen-free conditions in laminar flow cabinets (21). All T cell clones used in this study were derived from these Rowett strain rats.
Bacteria, bacterial Ags, and LPS
Actinobacillus actinomycetemcomitans, American Type Culture Collection no. 43718 (strain Y4; Manassas, VA) was grown in pleuro-pneumonia-like organisms broth (Difco Laboratories, Detroit, MI) with glucose (3 g/L) and sodium bicarbonate (1 g/L) for 72 h at 37°C under increased CO2 (candle jar). The cultured bacteria in the log-growth phase were killed with formalin (5%) and served as a T cell Ag. The A. actinomycetemcomitans 29-kDa outer membrane protein (Omp29) (5, 22) and A. actinomycetemcomitans LPS (23) were prepared as previously described.
Monoclonal Abs and fusion proteins
Several mouse mAb to rat surface markers were used in this study, including anti-MHC class II (OX6; Serotec, Bicester, U.K.), anti-B7-1 and anti-B7-2 (CD80, 3H5; and CD86, 24F; Ref. 24 ; gifts of Dr. K. Okumura), mAb ED1 (specific for rat monocytes, macrophages, and dendritic cells; Serotec), and anti-rat CD62L and anti-rat CD44 mAb (Serotec). CTLA4Ig, a fusion protein of human CTLA4 and Fc fragment of human IgG, and control fusion protein L6 were gifts of Dr. P. S. Linsley.
T clone cells
Th1-type clone (G23) and Th2-type clone (F13) specific for
A. actinomycetemcomitans Omp29 (21) were
activated by incubation with sterile formalin-killed A.
actinomycetemcomitans and irradiated (3300 rad) syngeneic rat
spleen cells. Rat recombinant IL-2 (1 U/ml; Serotec) or conditioned
medium from Con A-stimulated spleen culture was added to the Th2-type
cell culture. Both G23 and F13 are
CD28+/ßTCR+ and
proliferate in a MHC class II- and B7-dependent
manner.4 Other characteristics of
these T clones, including production of IFN- and IL-2, expression of
CD3, CD4, CD25, LFA-1, VLA-4, ICAM-1, and CCR5 by G23, and production
of IL-4, expression of CD3, CD4, CD25, LFA-1, VLA-4, and ICAM-1 by F13,
have been described previously (21, 25). We considered
these clones as memory cells based on the following criteria:
CCR5+(G23), CD25+,
VLA-4high, CD45RC-,
CD44high, CD62L-.
Microinjection of Ag into gingivae and T cell i.v. transfer
Rowett strain female rats (2–3 mo old) received three palatal gingival injections (1 µl/site) on the mesial of the first molar and in the papillae between first and second and third molars on the right and left sides (total of three sites on each side) of the maxilla. To accomplish microinjection into rat gingivae, which is composed of thin epithelium and connective tissue, the tip of a 28.5-gauge MicroFine needle (Becton Dickinson, Mountain View, CA) was cut into a double bevel and used to inject 1 µl/site into gingivae. Injection consisted of Omp29 alone, Omp29 plus A. actinomycetemcomitans LPS, LPS alone (left, experimental side), and PBS as a control (right, control side) on day 0. T cell clones, G23 or F13, stimulated with APC and killed A. actinomycetemcomitans in culture plates 3 days in advance, were isolated by gradient centrifugation on day 0. Each of the T cell clones was transferred i.v.
Tissue preparation
T cells infiltrating into the gingival tissues, cervical lymph
nodes (CLN) and spleen were isolated as previously described
(21). Briefly gingivae were removed by dissection, then
washed thoroughly to eliminate any blood and diced into
1-mm3 pieces. The segments were incubated at
37°C for 1 h in collagenase (160 U/ml, Worthington type IV) in 1
ml RPMI 1640 containing 1000 U/ml heparin and 10% FBS. The tissues
were gently compressed over a 60-gauge stainless steel screen and
single cells were passed through a nylon wool and glass wool column to
enrich T cells (
90% ßTCR+ cells). To
obtain T cells from CLN or spleen, single-cell suspensions also were
passed through a nylon wool and glass wool column.
For tartrate-resistant acid phosphatase (TRAP) staining, the whole maxilla was dissected and fixed in 5% formaldehyde-saline solution overnight at 4°C. Tissues were decalcified in 10% EDTA/0.1 M Tris, pH 6.9, solution for 1 mo at 4°C. Decalcified samples were embedded in paraffin and 6-µm sections were cut. Tissues for immunohistochemistry were embedded in OCT compound (Miles, Elkhart, IN) and frozen at -70°C immediately after dissection. Cryostat sections were cut at 6 µm. For detection of B7-1 mRNA, each animal’s gingivae was injected with LPS (0.5 µg/site) or Omp29 (0.5 µg/site) at several time periods. Animals were sacrificed and the entire gingivae were dissected and removed. Total RNA was extracted immediately from the tissue by homogenizing in a glass tissue grinder on ice using RNAzolB described in the protocol of the manufacturer (Tel-Test, Friendswood, TX).
TRAP staining
TRAP staining, as modified from the methods of Barka et al. (26) was used to identify osteoclasts in alveolar bone. After deparaffinization, sectioned samples were incubated in acetate buffer, pH 5.5, in the presence of 150 NM sodium tartrate (J. T. Baker Chemicals, Phillipsburg, NJ) for 90 min at room temperature. Samples were then incubated in acid phosphatase substrate to develop red color. Methyl green was used to counterstain cell nuclei. Osteoclasts were identified as multinucleated dark red cells.
Immunohistochemistry
Frozen sections of each tissue were fixed with 2% paraformaldehyde in PBS at 4°C for 10 min. After blocking with 1.5% horse serum in PBS, each section was incubated with mouse mAb (OX6, ED1, 3H5, and 24F) in PBS for 30 min at room temperature. Then, biotin-labeled horse anti-mouse IgG (rat-absorbed; Vector Laboratories, Burlingame, CA) in the presence of 1.5% horse serum and 1.5% rat serum was applied for 30 min at room temperature. Endogenous peroxidase activity was neutralized by incubation of the sections with 3% H2O2 for 10 min. The section was reacted with preformed ABC (Elite ABC; Vector Laboratories) for 30 min at room temperature, followed by extensive washing with PBS. Each Ag was visualized by cellular localization of color development after incubation in diaminobenzidine H2O2 solution for 3 min (OX6, ED1) or 10 min (3H5, 24F) and counterstaining with methyl green.
Quantitation of B7-1-specific mRNA expression by competitive RT-PCR
Total RNA extraction and RT-PCR have been previously described (25). Primers for rat B7-1 were designed from the cDNA sequence from GenBank (PRU05593) as follows: 5' primer, TGAAGCCATGGCTTACAGTTGCCAG (sense, bases 12–36) and 3' primer, CACGTGAGCATCTCCATACTCAATGA (anti-sense, bases 683–708). The specificity of this primer set was searched and confirmed by basic local alignment search tool. To construct a competitive template DNA of rat B7-1, cDNA of rat B7-1 was amplified by RT-PCR from the total RNA of Con A-activated spleen cells and subcloned into a pCR3 vector (Invitrogen, Portland, OR). After digestion at AccI and ClaI sites, both cohesive ends were filled in by T4 DNA polymerase (Invitrogen) and ligated by T4 DNA ligase (Invitrogen). To verify the accuracy of the competitive template, its DNA sequence was analyzed (Automatic Sequencing and Genotyping Facility of Brigham and Women’s Hospital, Boston, MA). The final size of the competitive template DNA was 330 bp as compared with the intact B7-1 DNA products size (697 bp) as amplified by RT-PCR using the primers mentioned above. The competitive template was serially diluted from 10-15 to 10-21 mol/50 µl in the PCR solution in the presence of 1 µg/ml of yeast tRNA. The total RNA isolated from gingivae (1 µg) was transcribed to cDNA and amplified by the B7-1-specific primers described above in the presence of the serially diluted competitive template (35 cycles at 94°C for 30 s, 60°C for 1 min, 72°C for 1 min, and a final elongation time of 10 min at 72°C). Rat ß-actin was used as an internal control (data not shown), and the primer design has been previously described elsewhere (27).
Ag-specific T cell responses in vitro
The T cell fraction recovered from gingivae at various time periods after T cell clone transfer was cultured in 96-well plates (5 x 103/well) supplemented with rat recombinant IL-2 (1 U/ml; Life Technologies, Gaithersburg, MD) in the presence of irradiated splenic APC (3300 rad) alone or also with killed A. actinomycetemcomitans (107/well). T cells recovered from CLN or spleen (105/well) were also cultured in 96-well plates in the presence of splenic APC with or without killed A. actinomycetemcomitans (107/well). [3H]Thymidine (0.5 µCi/well) was applied overnight for the last 18 h of 3 days in culture. Radioactivity, incorporated in the lymphocytes, was determined by liquid scintillation spectrometry.
ELISA
ELISA was used to detect IgG2a Ab to Omp29 in rat serum. Purified Omp29 (1 µg/ml; sodium bicarbonate buffer, pH 9.7) was coated onto 96-well plates (ICN Biomedicals, Aurora, OH). Rat serum (100–1000 times dilution) was applied and followed by HRP-conjugated anti-rat IgG2a (Binding Site, Birmingham, U.K.). Colorimetric reactions were developed with o-Phenylenediamine (Sigma, St. Louis, MO) in the presence of 0.02% H2O2. After 10 min incubation, reactions were stopped with 2 N H2SO4 and measured at 490 nm. Hyperimmune serum to Omp29 was prepared in Rowett rats (3 mo old) by immunization with purified Omp29 (10 µg/time) in CFA (s.c.), in IFA (s.c.), and in saline (i.v.) at intervals of 2 wk. The OD of this serum diluted at 1:8500 was chosen as 100 ELISA units, and all rat serum IgG2a reactions to Omp29 were evaluated based on a reference curve provided by dilution of the hyperimmune serum.
Measurement of bone resorption
At various times (3–20 days) after T clone transfer with gingival challenge with Omp29 and/or LPS or saline, animals were sacrificed, the jaws were defleshed, and periodontal bone resorption was measured on the palatal surface of the maxillary molars (28). The distances from cemento-enamel junction (CEJ) to the alveolar ledge (AL) of injected sites (upper left palatal side) and saline injected control sites (upper right palatal side) were measured using a reticule eyepiece at 25x magnification as previously described (28). A total of five measurements were evaluated, including one point corresponding to the root axis of the second and third roots of the first molar, both roots of the second molar, and the first root of the third molar. The evaluation of bone loss was calculated and expressed as % bone loss = {(total CEJ-AL distance of 5 points of left experiment side) - (total CEJ-AL distance of 5 points of right control side)}/(total CEJ-AL distance of 5 points of right control side) x 100.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Previously, we found Ag-specific retention of T clone cells in
gingivae (21). Because of the absence of A.
actinomycetemcomitans and the lack of immune reaction to this
organism in Rowett rats bred under pathogen-free conditions in laminar
flow cabinets, the localization of transferred Omp29-specific T clone
cells was detected by in vitro Ag-specific T cell proliferation to
whole A. actinomycetemcomitans bacteria in the presence of
irradiated APC. First, the kinetics of the Th1 clone (G23) localization
in the spleen, gingivae, and CLN were examined by Ag-specific
proliferation assay (Fig. 1
).
Proliferation by T cells isolated from the spleens of Ag (Omp29)- and
LPS-injected animals was detected for at least 10 days (Fig. 1A). The control animals, which only received a gingival
challenge of Ag and LPS in the absence of G23 transfer, showed little
or no Ag-specific T cell proliferation in the spleen (Fig. 1B). Ag-specific reaction of T cells isolated from the Ag-
and LPS-injected site was observed in the gingivae of G23-transferred
rats from 1 to 3 days after transfer (Fig. 1C). This was
compared with T cells from the control PBS-injected site that showed
little or no response to Ag plus APC (Fig. 1D). Ag-specific
T cell proliferation was also observed in the CLN 2 days after transfer
of G23 into Ag- and LPS-injected animals (Fig. 1E). No
Ag-specific T cell reaction was observed at 10 days in gingivae (Fig. 1D) or CLN (Fig. 1E).
|
To verify the immunological influence of transferred Th1 clone
cells in recipient animals, the serum IgG2a Ab levels to Omp29 were
determined by ELISA (Fig. 2). The sera
from animals receiving G23 or receiving no T cells were collected on
day 0 and day 10 after Omp29 challenge into gingivae with or without
LPS. When both Omp29 and LPS were used for gingival challenge,
significant serum IgG2a response to Omp29 was observed in the
G23-transferred group when compared with the no T cell-transferred
group (Fig. 2A). Gingival challenge with Omp29 alone, in the
absence of LPS, did not induce significant elevation of IgG2a response
to Omp29 either with or without G23 transfer (Fig. 2B). It
is noteworthy that gingival challenge with Omp29 alone induced IgM
response to Omp29 as compared with the non-Omp29-injected group. For
this induction of IgM response to Omp29, LPS challenge or T cell
transfer was not necessary (our unpublished observations). These
results suggested an active immune regulatory function of transferred
G23 and the significant influence of LPS in production of IgG2a, but
not for IgM.
|
Because Th1 clone cells seemed to be retained in the LPS-
and Ag-injected gingivae and regulated production of IgG2a to
Omp29, we tested if transferred Th1 clone cells can effect gingival
bone resorption in a kinetic experiment (Fig. 3A). Significant bone
resorption in Ag- and LPS-injected gingivae was observed 10 or more
days (up to 20 days) after G23 transfer. Control animals without G23
transfer, which only received gingival challenge with Ag and LPS,
showed no significant bone resorption up to 20 days (Fig. 3B).
|
The effect of Th2 clone transfer on periodontal bone resorption
was also examined (Fig. 4A).
The Th2 clone, F13, which is also Omp29 specific and whose Th2-type
characteristics have been confirmed (21, 25, 29), was
used. Although from 105 to
107 G23 cells per animal could induce bone
resorption after 10 days of transfer into Ag- and LPS-injected
gingivae, Th2 clone cells did not induce bone resorption at the highest
number (107 per animal) of cells (Fig. 2
A). It is noteworthy that like G23 this Th2 clone is also
retained in the gingival tissue after Omp29 and LPS challenge
(21).
|
We have previously reported a requirement of LPS for T clone cell
retention in gingivae (21). In the absence of LPS, after
challenge with specific Ag, T cell retention was not observed in
gingivae (21), and also Ag-specific IgG2a reaction was not
induced (Fig. 2). To evaluate whether LPS is required for bone
resorption, G23 clone cells were transferred into animals that received
gingival Ag with or without LPS (Fig. 4B). No bone
resorption was induced in the absence of LPS even when Th1
clone-transferred animals received gingival challenge with Ag alone. It
is noteworthy that LPS alone (0.5 µg/site) in the absence of Ag also
did not result in bone loss, although the animals received G23 clone
transfer.
TRAP-positive cells on the AL of periodontal bone
To further investigate periodontal bone resorption in this
model, and to determine the localization of osteoclast cells, these
were evaluated by TRAP staining (Fig. 5).
Rats were killed 10 days after transfer of G23 Th1 clone cells and
gingival challenge with or without Ag and/or LPS. The entire maxilla
was decalcified, and histomorphology of the bone was analyzed.
TRAP-positive cells were only observed in the periodontal bone of
G23-transferred rats that were challenged with Ag and LPS (Fig. 5, A and B). Rats whose gingivae were challenged
with LPS and Ag without T cells did not show any TRAP-positive cells on
the AL (Fig. 5, C and D). Also, no TRAP-positive
cells were observed in animals receiving gingival challenge with saline
alone or saline plus G23 transfer (data not shown).
|
Because local Th1 retention in gingivae seemed to be
responsible for alveolar bone resorption, the presence of APC that are
capable of stimulating T cells (MHC class
II+/B7+) was examined by
means of immunohistochemical analysis (Fig. 6). In the LPS-challenged gingivae,
expression of B7-1 (Fig. 6B) and B7-2 (Fig. 6D)
was seen at 48 h after challenge (stained large cells), but little
or no staining was observed in Omp29-challenged gingivae (Fig. 6, A and C, no large stained cells detected) or in
saline-injected control (not shown) at the same time period. The
expression of B7-1 and B7-2 peaked at between 24 and 48 h and
diminished at 72 h after LPS challenge (B7-1 at 24 h,
5.7 ± 1.5; at 72 h, 1.3 ± 1.2; B7-2 at 24 h,
11.7 ± 2.5; at 72 h, 3.0 ± 1.0 mean positive
cells/400x microscopic field ± SD). Macrophages were observed in
the saline-treated gingivae (Fig. 6E) and also in the
gingival challenge with LPS or Omp29 (not shown). MHC class II
expression was also observed in macrophages together with endothelial
cells in LPS-challenged samples (Fig. 6F) to approximately
the same degree as Omp29-challenged gingivae, but less than in
saline-injected gingivae (not shown).
|
When gingivae were challenged with LPS, both B7-1 and B7-2
expression was observed along with MHC class II expression on gingival
macrophages. To further determine if B7 expression was induced by LPS
stimulation, competitive RT-PCR was used to investigate B7-1 mRNA
expression (Fig. 7). B7-1 mRNA expression
was never observed in intact or Omp29-challenged gingivae. Only LPS
challenge induced B7-1 mRNA expression, which was maximal at 24 h
and was detected up to 72 h later.
|
Given the evidence that B7 expression on local APC is related to
gingival challenge with LPS, we tested whether this B7 expression is
functionally related to the bone resorption induced by G23 transfer
with gingival challenge of Ag and LPS. The human fusion protein CTLA4Ig
functionally inhibited in vitro proliferation of G23 Th1 clone cells in
the presence of APC and Ag (Fig. 8A). Th1 clone G23
proliferation in the presence of APC and Ag was significantly inhibited
by anti-MHC class II, anti-B7-1, and/or anti-B7-2 mAbs. The
inhibitory effect of CTLA4Ig was comparable to inhibition by both
anti-B7-1 and anti-B7-2 mAbs. The control human fusion protein
L6 did not effect G23 proliferation. To analyze the influence of
systemic administration of CTLA4Ig, reactivity of G23 cells isolated
from gingivae (Fig. 8B) and spleen (Fig. 8C) of
G23-transferred animals was tested in vitro. Again, LPS was required in
addition to Ag for G23 cell retention in gingivae (Fig. 8B).
After G23 transfer, the Ag-specific response of isolated T cells from
gingivae challenged with Ag and LPS was diminished significantly by
systemic or local administration of CTLA4Ig, but not with control
fusion protein L6, suggesting a role for B7 in Ag-specific T cell
retention in gingivae. The Ag-specific response of T cells isolated
from spleens of animals receiving G23 cell transfer was greatly
diminished by systemic administration of CTLA4Ig (Fig. 8C).
Also, systemic administration of CTLA4Ig abrogated the IgG2a response
to Omp29, which was induced in the animals transferred with G23 and
receiving gingival challenge with Omp29 and LPS as indicated in Fig. 2
(data not shown). The influence of systemic or local administration of
CTLA4Ig on the bone resorption induced by transferred G23 was examined
(Fig. 8D). Bone resorption was measured 10 days after
transfer of G23 into rats with Ag and LPS. CTLA4Ig or control L6 was
administered systemically (100 µg/rat) or locally (1 µg/site) 1 day
before and 1 day after transfer of G23 cells. Both systemic and local
administration of CTLA4Ig showed significant inhibition of Ag-specific
Th1 cell retention in gingivae (Fig. 8B) and bone resorption
related to G23 cells (Fig. 8D).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Previous studies of Th1 or Th2 cytokine mRNA expression by
CD4+ T cells in PD suggested prominent production
of IFN-, IL-6, IL-10, and IL-13 (10). IFN- appeared
to be the predominant cytokine produced by gingival T cells. In
addition, CD4+ and CD8+
subsets in PD have shown a similar pattern of cytokine production with
predominant production of IFN-.5 Both
Th1-type and Th2-type cells appear to be retained in rat gingivae
challenged with Ag and LPS (21). In the present study, we
demonstrated that Th1-type, but not Th2-type, cells could trigger
periodontal bone resorption. The sum of these observations seems to
indicate that a subtle imbalance toward Th1 polarization can play a key
role in the progression of PD. This hypothesis is supported by a report
of Lee et al. (32) that IL-2 levels in gingival crevicular
fluid are significantly higher in active periodontal pockets, which
showed bone loss in 3 mo, than in inactive periodontal pockets, which
did not show bone loss in the same time period.
Gram-negative bacteria are more frequently isolated from the microbial
flora of active/progressing periodontal pockets than from dental plaque
microflora of healthy subjects or healthy sites of the gingival sulcus
in the same patient (33). LPS, which is exclusively
produced by Gram-negative bacteria, has long been suggested to be an
important factor in the pathogenesis of PD (34). Induction
of in vitro osteoclastogenesis by LPS is mediated by TNF- from bone
marrow macrophages (35). However, in animal models in
vivo, an injection of a high dose of LPS (500 µg/site)
(36) or long-term multiple injections of LPS (5 µg/site
up to 10 consecutive injections) (37) is required to
induce bone resorption. Interestingly, in the latter experiment
(37), bone resorption by long-term LPS injection was
associated with the presence of T cells. In the present study, a much
lower dose of LPS (0.5 µg/site) administered with Ag induced bone
resorption by Th1-type cells. It is noteworthy that in the current
experiments a single injection of a lower dose (0.5 µg/site) of LPS
alone did not induce significant bone resorption unless Th1 cells and
Ag were also administered.
Although macrophages in the gingivae expressed MHC class II by either challenge with LPS or Omp29, B7 expression on macrophages in this system was induced by LPS challenge. LPS also can induce rapid production of the Th1 differentiation cytokine, IL-12, by dendritic cells (38). Therefore, we suggest that infusion of LPS into the gingival tissues triggers differentiation and activation of Th1-type T cells under physiological conditions. In general, isolated human monocytes do not express B7-1 or B7-2 costimulatory molecules, unless LPS is added (39). Recent studies of the human Toll-like receptor (TLR) family have demonstrated the importance of LPS to induce B7 costimulatory molecules where innate immunity elicits adaptive immunity (40). TLR-2 is a signaling component of the cellular receptor (CD14) for LPS (41). Defective response to bacterial LPS by the C3H/HeJ mouse strain was linked to a mutation in a TLR family gene (42). This evidence supports our finding that LPS can induce B7 in gingival macrophages. Interestingly, B7-1 and B7-2 are expressed on lymphocytes in PD tissue (43), and there is an absence of B7 expression in the healthy gingival tissue of PD patients (our unpublished observations), suggesting a relationship between B7 expression and progression of PD.
TCR occupancy by Ag presentation without CD28 costimulation induces a
state of Ag-specific unresponsiveness on rechallenge with Ag
presentation by professional APC, so called "anergy"
(44). We have proposed a hypothesis that Th1 cell anergy
initiated upon encounter with MHC class II-expressing APC in the
absence of B7 might be a protective mechanism to interfere with the
progression of PD (29). For example, immune reaction seems
to be down-regulated to the commensal bacteria in intestinal flora
(45). This may explain why B7-1 mRNA message was not
observed in the nonstimulated or Omp29-alone-challenged gingivae (Figs. 6 and 7). The absence of B7 expression might be a mechanism to induce
immunological ignorance to the commensal bacteria. When Th1-type immune
reaction to the commensal bacteria is evoked, the resulting
inflammation seems to become destructive for the host tissue in
inflammatory bowel disease (46).
We have previously reported that Ag-specific T cells can be retained in the Ag- and LPS-challenged gingivae (21). A mechanism for T cell migration into inflammatory lesions involves regulation of chemokines and adhesion molecules (47). However, it is unclear how T cells are retained in the inflammatory lesion after migration.
We suggest that IFN- produced by Ag- and B7-stimulated Th1-type T
cells may counter-stimulate macrophages to secrete bone
resorption-inductive cytokines, such as IL-1 and TNF-. First, the
Th1 clone G23 produces IFN- after Ag-specific stimulation
(25). Second, Assuma et al. (48) have shown
that TNF- and IL-1 seem to be the cytokines responsible for bone
resorption in the primate PD model. IFN- alone does not induce IL-1
production by macrophages (49). Notwithstanding, it is
remarkable that IFN-, in the presence of submaximal doses of LPS,
stimulates macrophages to produce IL-1 and TNF- (11).
In contrast, Th2-type cytokines, IL-4 or IL-10, inhibit the induction
of IL-1 and TNF- production by LPS plus IFN- (50, 51).
The balance between Th1 and Th2 can regulate inflammatory arthritis (52), which is another inflammatory disease resulting in local bone resorption. A type II collagen-specific Th1 response (7) induces the animal model of CIA. CIA induced in rats was abrogated by treatment with CTLA4Ig (53). The pharmaceutical agent cyclosporin A, which down-modulates T cell activity, inhibits the bone loss in rat adjuvant-induced arthritis (54) and is used clinically in RA patients (55). These lines of evidence support Th1-type T cell involvement in inflammatory bone resorption and abrogation of the bone resorption by blocking TCR or B7 signaling. However, the site of T cell activation for these phenomena is unclear. The present study suggested that local activation of Ag-specific Th1-type T cells by B7 costimulation appeared to trigger inflammatory bone resorption, whereas inhibition of B7 expression by CTLA4Ig might be a therapeutic approach for intervention with inflammatory bone resorption. Thus, this rat PD model seems to be of potential to elucidate the mechanism of T cell-mediated progression of human PD.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Martin A. Taubman, Department of Immunology, The Forsyth Institute, 140 Fenway, Boston, MA 02115-3799. E-mail address:
3 Abbreviations used in this paper: PD, periodontal disease; RA, rheumatoid arthritis; CIA, collagen-induced arthritis; Omp, outer membrane protein; CLN, cervical lymph nodes; TRAP, tartrate-resistant acid phosphatase; CEJ, cemento-enamel junction; AL, alveolar ledge; TLR, Toll-like receptor.
4 T. Kawai, M. Seki, H. Watanabe, J. W. Eastcott, D. J. smith, and M. A. Taubman. Th 1 transmigration anergy: a new concept of endothelial cell-T cell regulatory interaction. Submitted for publication.
5 O. Takeichi, J. Haber, T. Kawai, D. J. Smith, I. Moro, and M. A. Taubman. Cytokine profiles of T lymphocytes from gingival tissues with pathological pocketing. Submitted for publication.
Received for publication September 29, 1999. Accepted for publication December 1, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
on the interleukin 1 secretory potential of fresh or aged human monocytes. J. Immunol. 134:2444.[Abstract]
, and IL-6 by human monocytes. Blood 76:1392. and interferon- on interleukin 1 secretion by monocytes. J. Immunol. 138:2535.[Abstract]
and IL-4. J. Immunol. 145:569.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  S.L. Gaffen and G. Hajishengallis A New Inflammatory Cytokine on the Block: Re-thinking Periodontal Disease and the Th1/Th2 Paradigm in the Context of Th17 Cells and IL-17 Journal of Dental Research, September 1, 2008; 87(9): 817 - 828. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Sasaki, N. Suzuki, R. Kent Jr., N. Kawashima, J. Takeda, and P. Stashenko T Cell Response Mediated by Myeloid Cell-Derived IL-12 Is Responsible for Porphyromonas gingivalis-Induced Periodontitis in IL-10-Deficient Mice J. Immunol., May 1, 2008; 180(9): 6193 - 6198. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T.A. Silva, G.P. Garlet, S.Y. Fukada, J.S. Silva, and F.Q. Cunha Chemokines in Oral Inflammatory Diseases: Apical Periodontitis and Periodontal Disease Journal of Dental Research, April 1, 2007; 86(4): 306 - 319. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Stashenko, R. B. Goncalves, B. Lipkin, A. Ficarelli, H. Sasaki, and A. Campos-Neto Th1 Immune Response Promotes Severe Bone Resorption Caused by Porphyromonas gingivalis Am. J. Pathol., January 1, 2007; 170(1): 203 - 213. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kawai, T. Matsuyama, Y. Hosokawa, S. Makihira, M. Seki, N. Y. Karimbux, R. B. Goncalves, P. Valverde, S. Dibart, Y.-P. Li, et al. B and T Lymphocytes Are the Primary Sources of RANKL in the Bone Resorptive Lesion of Periodontal Disease Am. J. Pathol., September 1, 2006; 169(3): 987 - 998. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. B. Goncalves, O. Leshem, K. Bernards, J. R. Webb, P. P. Stashenko, and A. Campos-Neto T-Cell Expression Cloning of Porphyromonas gingivalis Genes Coding for T Helper-Biased Immune Responses during Infection Infect. Immun., July 1, 2006; 74(7): 3958 - 3966. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-T.A. Teng Protective and Destructive Immunity in the Periodontium: Part 1--Innate and Humoral Immunity and the Periodontium Journal of Dental Research, March 1, 2006; 85(3): 198 - 208. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-T.A. Teng Protective and Destructive Immunity in the Periodontium: Part 2--T-cell-mediated Immunity in the Periodontium Journal of Dental Research, March 1, 2006; 85(3): 209 - 219. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Han, T. Kawai, J. W. Eastcott, and M. A. Taubman Bacterial-Responsive B Lymphocytes Induce Periodontal Bone Resorption J. Immunol., January 1, 2006; 176(1): 625 - 631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-T. A. Teng, D. Mahamed, and B. Singh Gamma Interferon Positively Modulates Actinobacillus actinomycetemcomitans-Specific RANKL+ CD4+ Th-Cell-Mediated Alveolar Bone Destruction In Vivo Infect. Immun., June 1, 2005; 73(6): 3453 - 3461. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Valverde, T. Kawai, and M.A. Taubman Potassium Channel-blockers as Therapeutic Agents to Interfere with Bone Resorption of Periodontal Disease Journal of Dental Research, June 1, 2005; 84(6): 488 - 499. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. N. Belibasakis, A. Johansson, Y. Wang, C. Chen, S. Kalfas, and U. H. Lerner The Cytolethal Distending Toxin Induces Receptor Activator of NF-{kappa}B Ligand Expression in Human Gingival Fibroblasts and Periodontal Ligament Cells Infect. Immun., January 1, 2005; 73(1): 342 - 351. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. O'Gradaigh and J. E. Compston T-cell involvement in osteoclast biology: implications for rheumatoid bone erosion Rheumatology, February 1, 2004; 43(2): 122 - 130. [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-T. A. Teng THE ROLE OF ACQUIRED IMMUNITY AND PERIODONTAL DISEASE PROGRESSION Critical Reviews in Oral Biology & Medicine, July 1, 2003; 14(4): 237 - 252. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. HENDERSON, M. WILSON, L. SHARP, and J. M. WARD Actinobacillus actinomycetemcomitans J. Med. Microbiol., December 1, 2002; 51(12): 1013 - 1020. [Full Text] [PDF]
|
|
|
|
|
|
Y.-T. A. Teng Mixed Periodontal Th1-Th2 Cytokine Profile in Actinobacillus actinomycetemcomitans-Specific Osteoprotegerin Ligand (or RANK-L)- Mediated Alveolar Bone Destruction In Vivo Infect. Immun., September 1, 2002; 70(9): 5269 - 5273. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Gasper, C. C. Petty, L. W. Schrum, I. Marriott, and K. L. Bost Bacterium-Induced CXCL10 Secretion by Osteoblasts Can Be Mediated in Part through Toll-Like Receptor 4 Infect. Immun., August 1, 2002; 70(8): 4075 - 4082. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q.-B. Yang, M. Martin, S. M. Michalek, and J. Katz Mechanisms of Monophosphoryl Lipid A Augmentation of Host Responses to Recombinant HagB from Porphyromonas gingivalis Infect. Immun., July 1, 2002; 70(7): 3557 - 3565. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Gemmell, K. Yamazaki, and G.J. Seymour DESTRUCTIVE PERIODONTITIS LESIONS ARE DETERMINED BY THE NATURE OF THE LYMPHOCYTIC RESPONSE Critical Reviews in Oral Biology & Medicine, January 1, 2002; 13(1): 17 - 34. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Jotwani, A. K. Palucka, M. Al-Quotub, M. Nouri-Shirazi, J. Kim, D. Bell, J. Banchereau, and C. W. Cutler Mature Dendritic Cells Infiltrate the T Cell-Rich Region of Oral Mucosa in Chronic Periodontitis: In Situ, In Vivo, and In Vitro Studies J. Immunol., October 15, 2001; 167(8): 4693 - 4700. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Smith, W. F. King, L. A. Barnes, D. Trantolo, D. L. Wise, and M. A. Taubman Facilitated Intranasal Induction of Mucosal and Systemic Immunity to Mutans Streptococcal Glucosyltransferase Peptide Vaccines Infect. Immun., August 1, 2001; 69(8): 4767 - 4773. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.A. Taubman and T. Kawai Involvement of T-Lymphocytes in Periodontal Disease and in Direct and Indirect Induction of Bone Resorption Critical Reviews in Oral Biology & Medicine, January 1, 2001; 12(2): 125 - 135. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. O. Jacoby, E. A. Johnson, F. X. Paturzo, and L. Ball-Goodrich Persistent Rat Virus Infection in Smooth Muscle of Euthymic and Athymic Rats J. Virol., December 15, 2000; 74(24): 11841 - 11848. [Abstract] [Full Text]
|
|
|
|
|
|
O. Takeichi, J. Haber, T. Kawai, D.J. Smith, I. Moro, and M.A. Taubman Cytokine Profiles of T-lymphocytes from Gingival Tissues with Pathological Pocketing Journal of Dental Research, August 1, 2000; 79(8): 1548 - 1555. [Abstract] [PDF]
|
|
|
|
 |
|
 T. Kawai, M. Seki, H. Watanabe, J. W. Eastcott, D. J. Smith, and M. A. Taubman Th1 transmigration anergy: a new concept of endothelial cell-T cell regulatory interaction Int. Immunol., June 1, 2000; 12(6): 937 - 948. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
). Open circles (
) are the cells incubated with APC alone. The
cells in A, C, and E come
from animals that received gingival challenge (left experiment side) of
Omp29 and A. actinomycetemcomitans LPS who also received
G23 clone cells. D was the same animals in
C, but the gingivae (right control side) were challenged
with saline alone and also received G23 clone cells. The animals in
B received gingival challenge with Omp29 and LPS and did
not receive G23 clone cells. Each point represents mean ± SD of T
cells from three animals.
). Sera
were collected from animals on day 0 and day 10 after Ag challenge with
or without T clone cells or LPS. Five animals were tested in each
group. *, p < 0.01, significantly different from
the day 0 (before treatment), as determined by Student’s
t test.
