The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marchand, P.
Right arrow Articles by Radeke, H. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marchand, P.
Right arrow Articles by Radeke, H. H.
The Journal of Immunology, 2000, 164: 2070-2076.
Copyright © 2000 by The American Association of Immunologists

Selective Inhibition of Monocyte Chemoattractant Protein-1 Gene Expression in Human Embryonal Kidney Cells by Specific Triple Helix-Forming Oligonucleotides1

Petra Marchand, Klaus Resch and Heinfried H. Radeke2

Institute of Pharmacology, Medical School Hannover, Hannover, Germany


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Monocyte chemoattractant protein-1 (MCP-1) is a chemokine that is expressed by a variety of tissue cells in response to inflammatory stimuli, such as IL-1ß, TNF-{alpha}, and IFN-{gamma}. A major function of MCP-1 is the recruitment and activation of monocytes and T lymphocytes. Overexpression of MCP-1 has been implicated in a number of diseases, including glomerulonephritis and rheumatoid arthritis, indicating that the modulation of MCP-1 activity and/or expression is a desired therapeutic strategy. In the present study, our aim was to test whether the MCP-1 expression could be inhibited at the transcriptional level using triple helix-forming oligonucleotides (TFOs). We designed a TFO targeted to the SP-1 binding site in the human MCP-1 gene promoter. Gel mobility shift assays demonstrated that the phosphodiester TFO formed a sequence-specific triplex with its dsDNA target with an EC50 of ~1.9 x 10-7 M. The corresponding phosphorothioated oligonucleotide was also effective in this assay with an 8-fold higher EC50 value. Binding of the TFO to the target DNA prevented the binding of rSP-1 and of nuclear proteins in vitro. The TFO could also partially inhibit endogenous MCP-1 gene expression in cultured human embryonic kidney cells. Treatment of TNF-{alpha}-stimulated human embryonic kidney 293 cells with the TFO inhibited the secretion of MCP-1 in a dose-dependent manner (up to 45% at 5 µM oligonucleotide). The inhibition of MCP secretion was caused at the level of gene transcription, because MCP-1 mRNA levels in oligonucleotide-treated cells were also decreased by ~40%.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Chemokines are a rapidly growing superfamily of glycoproteins with molecular masses ranging from 6 to 25 kDa. They play a key role in the cellular infiltration of inflamed tissues. Chemokines activate latent integrins on the surface of rolling leukocytes and up-regulate integrin de novo expression, allowing rolling leukocytes to adhere to the endothelium through interactions with integrin receptors on the endothelial cells (1, 2). Once the leukocytes have stopped rolling, they respond with chemotaxis along the chemokine gradient, leave the circulation, and migrate through the endothelium into the inflamed tissue (2). Additional leukocyte responses to chemokines, besides chemotaxis, include enzyme release from intracellular stores, oxygen radical formation, cytoskeletal rearrangement, and generation of lipid mediators (3). Chemokines have also been shown to be involved in the regulation of angiogenesis (4) and in neuronal cell regulation (5). Chemokines mediate their effects through binding to G protein-coupled chemokine receptors on the target cells.

Chemokines are believed to be both beneficial in host defense against foreign agents and harmful in diseases marked by pathologic inflammation (6). One of the major chemokines produced during glomerulonephritis and several other inflammatory diseases, and implicated to play a pathological role during the course of these diseases, is monocyte chemoattractant protein-1 (MCP-1)3 (7, 8). MCP-1 is expressed in many different cell types including monocytes, T lymphocytes, endothelial cells, fibroblasts, and mesangial cells (9, 10, 11). Typically, under in vitro conditions, these cells express low constitutive levels of MCP-1, and the synthesis of MCP-1 is markedly increased during inflammation by gene induction through cytokines such as IL-1ß, TNF-{alpha}, and IFN-{gamma}. The only known receptor for MCP-1 is CCR2, which can be found on the surface of monocytes, memory or activated T lymphocytes, basophils, immature dendritic cells, B cells, and some tissue cells such as IFN-{gamma}-stimulated mesangial cells (12, 13).

Several studies show that MCP-1 plays a predominant role in the initiation and progression of various forms of nephritis (7, 14, 15). In experimental models of crescentic nephritis and antiglomerular basement membrane nephritis, treatment with neutralizing anti-MCP-1 Abs or antagonistic MCP-1 muteins prevented proteinuria and formation of lesions, reduced infiltration of mononuclear cells and T lymphocytes, and reduced sclerosis by lowering collagen and matrix production (16, 17). These findings indicate that the modulation of MCP-1 activity and/or expression may be a useful therapeutic strategy for nephritis and possibly other inflammatory diseases.

The ability to modify the expression of specific mammalian genes is a major goal in biotechnology and medicine, and considerable research effort has gone into the development of oligonucleotide-based principles to achieve this end (18). Current oligonucleotide technologies allow the manipulation of gene function at several levels: Oligonucleotides can bind to genomic DNA (antigene or triple helix-forming oligonucleotides (TFOs), to RNA (antisense oligonucleotides), or to protein (aptamers). TFO technology has the potential advantage that typically only two copies of the target DNA exist per cell, compared with hundreds or thousands of RNA and protein targets for antisense oligonucleotides and aptamers. It has been demonstrated that triplex formation at a promoter can block the binding of various transcription factors, including SP-1, thereby inhibiting transcription initiation (reviewed in Ref. 19). Inhibition of endogenous gene expression by cellular TFO treatment has also been observed; examples include the IL-2R (20), TNF-{alpha} (21), and GM-CSF (22).

The mechanisms underlying triple helix formation are reasonably well understood. TFOs bind to their dsDNA target in a sequence-specific manner. Triplex formation has only been observed at homopurine regions of DNA (19). The TFO binds in the major groove of DNA, forming Hoogsteen or reverse Hoogsteen hydrogen bonds with bases in the purine-rich strand. The TFO itself can consist of either pyrimidines or purines. Pyrimidine-containing TFOs generally bind parallel to the purine-rich strand; sequence specificity is mediated by specific binding of thymine bases to A:T base pairs and protonated cytosine bases (C+) to G:C base pairs. Because cytosine is only protonated under acidic pH, pyrimidine TFOs do not usually bind to duplex DNA under physiological pH without base modifications. Purine-containing oligonucleotides bind antiparallel to the purine-rich strand in the target DNA, and the binding occurs readily at physiological pH. Sequence specificity is mediated by binding of G to G:C and T to A:T base pairs.

The aim of the present study was to test whether the MCP-1 gene expression can be inhibited at the level of transcription using the TFO technology. A 19-bp TFO was designed that targets the binding site for the transcription factor SP-1 and a consensus sequence for AP-1 binding in the human MCP-1 promoter; the SP-1 binding site has previously been shown to be essential for MCP-1 expression in a variety of human cell types (23). The TFO formed a sequence-specific triplex with target DNA in vitro, blocked in vitro binding of nuclear extract proteins and rSP-1 to the promoter DNA, and partially inhibited expression of the endogenous MCP-1 gene in human embryonic kidney (HEK) 293 cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cells and reagents

HEK 293 cells (CRL 1573) were obtained from American Type Culture Collection (Manassas, VA). Human rSP-1 was purchased from Promega (Madison, WI), human IL-1ß from Roche Molecular Biochemicals (Mannheim, Germany), and human TNF-{alpha} from Phillips (Bissendorf, Germany). The phosphodiester oligodeoxyribonucleotides used in this study were obtained from Life Technologies (Eggenstein, Germany); phosphorothioated oligonucleotides were from Metabion (Munich, Germany). Oligonucleotides used in cell culture experiments were HPLC purified, desalted, and filter sterilized.

Preparation of synthetic double-stranded MCP-1 and IL-6 promoter fragments

For each promoter fragment, two 39-mer oligonucleotides with complementary sequences were synthesized and subsequently annealed. The oligonucleotides for the MCP-1 promoter corresponded to the region between bp -76 and bp -38 of the human MCP-1 promoter; the oligonucleotide sequences were TCCTGCTTGACTCCGCCCTCTCTCCCTCTGCCCGCTTTC and GAAAGCGGGCAGAGGGAGAGAGGGCGGAGTCAAGCAGGA. The IL-6 promoter fragment was prepared with oligonucleotides spanning the SP-1 binding region of the human IL-6 promoter (24); the oligonucleotide sequences were TCAGCCCCACCCGCTCTGGCCCCACCCTCACCCTCCAAC and GTTGGAGGGTGAGGGTGGGGCCAGAGCGGGTGGGGCTGA. Annealing of the oligonucleotides to duplex DNA was achieved by mixing them in equimolar amounts in annealing buffer (10 mM Tris-HCl, 1 mM EDTA, 0.1 M NaCl, pH 8), incubation at 95°C for 10 min, followed by a slow cool-down to room temperature at a rate of 1°C/min. Quantitative annealing of the single-stranded oligonucleotides to duplex DNA was confirmed by native polyacrylamide gel electrophoresis through 12.5% gels, followed by ethidium bromide staining.

Triple helix gel shift assays

Double-stranded MCP-1 promoter DNA was 3' end labeled with digoxigenin-11-ddUTP and terminal deoxytransferase using reagents of the DIG Gel Shift Kit (Roche Molecular Biochemicals), according to the instructions of the manufacturer. To assess triple helix formation, band shift experiments were performed essentially as described by Durland et al. (25). Briefly, 60 fmol of the labeled duplex DNA was incubated for 1 h at 37°C with the indicated concentrations of triple helix-forming or control oligonucleotides in a buffer consisting of 10 mM Tris-HCl (pH 7.4), 5 mM MgCl2, and 10% sucrose. Immediately following the incubation, the samples were electrophoresed through 12.5% native polyacrylamide gels buffered with 89 mM Tris, 89 mM boric acid, and 5 mM MgCl2. Electrophoresis was at 80 V for 2 h at 4°C. The DNA was then transferred onto nylon membrane by electroblotting in DNA transfer buffer (22 mM Tris, 22 mM boric acid, pH 8). The digoxigenin-labeled DNA probes and complexes were detected on the nylon membrane using the DIG Chemiluminescent Nucleic Acid Detection Kit (Roche Molecular Biochemicals).

Protein-binding assays

MCP-1 promoter duplex DNA was incubated with 10 µM TFOs and/or binding proteins, as indicated. For the experiment with purified SP-1, 100 fmol of MCP-1 promoter duplex was incubated with 4 footprinting units of human rSP-1 (Promega) for 1 h at 20°C in the presence or absence of 10 µM TFO in a buffer that consisted of 10 mM Tris-HCl (pH 7.4), 10% sucrose, 20% glycerol, 20 mM KCl, 1 mM DTT, 4 mM HEPES, and 5 mM MgCl2. For the experiment with nuclear extract proteins, 100 fmol of MCP-1 promoter duplex was incubated for 15 min at 20°C with 15 µg of nuclear extract proteins from unstimulated or TNF-{alpha}-stimulated HEK 293 cells (see below) in the presence or absence of 10 µM TFO in a buffer consisting of 10 mM Tris-HCl (pH 7.4), 10% sucrose, 5 mM MgCl2, and 1 µg poly(d(AT)). All samples were electrophoresed through 7% polyacrylamide gels buffered with 89 mM Tris, 89 mM boric acid, and 5 mM MgCl2. The samples were transferred to nylon membrane, and digoxigenin-labeled DNA was detected using the DIG Chemiluminescent Nucleic Acid Detection Kit (Roche Molecular Biochemicals).

Cell culture, oligonucleotide, and cytokine treatment

HEK 293 cells were cultured in DMEM supplemented with 10% FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM L-glutamine. For analysis of cytokine-induced stimulation of chemokine production, the cells were plated in 24-well plates at a density of 160,000 cells/well and grown to 80% confluency. Then the culture media were replaced with 400 µl of fresh medium per well, and the cells were left unstimulated or treated with various cytokines (500 U/ml TNF-{alpha}, 10 ng/ml IL-1ß, or 1000 U/ml IFN-{gamma}) for 24 h. For oligonucleotide treatment experiments, the cells were also plated in 24-well plates at a density of 160,000 cells/well. On the following day, the cells were pretreated with 2 µM or 5 µM phosphorothioated TFO or control oligonucleotide for 48 h. The oligonucleotides were added directly to the culture medium without the addition of a transfection reagent. After a 48-h incubation, the medium was removed, fresh medium (400 µl/well) was added containing the same concentration of oligonucleotide as before, and the cells were cultured for additional 24 h in the absence or presence of 500 U/ml TNF-{alpha}. At the end of each experiment, the culture media were harvested, centrifuged for 5 min at 12,000 x g to remove cell debris, and stored at -20°C until analysis of secreted proteins by ELISA.

For Northern analysis, HEK 293 cells were treated for 48 h with 5 µM phosphorothioated TFO or control oligonucleotide. The cells were then stimulated with 500 U/ml TNF-{alpha} or left unstimulated. After 3 h of stimulation, the cells were harvested, and total RNA was isolated.

Preparation of nuclear extract proteins

A total of 1 x 107 unstimulated or TNF-{alpha}-stimulated (500 U TNF-{alpha}/ml, 24 h) HEK 293 cells was trypsinized, washed twice with ice-cold PBS, and resuspended in 400 µl buffer A (10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM PMSF, and 10 µg/ml leupeptin). The samples were incubated for 15 min on ice. After addition of 25 µl Nonidet P-40 solution (10% in sterile water), the samples were mixed for 30 s and immediately centrifuged in a microfuge at 13,000 rpm for 30 s. The resulting precipitate was resuspended in 30 µl buffer B (20 mM HEPES (pH 7.9), 400 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, and 1 mM PMSF), and incubated for 15 min on ice. The extract was centrifuged at 13,000 rpm for 5 min at 4°C; the resulting supernatant contained the nuclear extract proteins. The protein concentrations were determined using the Bradford Protein Assay (Bio-Rad, Hercules, CA) with BSA as standard.

Determination of MCP-1, IL-8, and IL-6 protein levels in the culture medium

The concentrations of secreted chemokines in the culture media of cells were determined by ELISA. The MCP-1 and IL-6 ELISAs were performed with reagents from R&D Systems (Minneapolis, MN); the IL-8 ELISA was performed with the IL-8 Duoset System from Genzyme (Cambridge, MA). Each data point was determined in duplicate.

Preparation of total RNA and Northern blot analysis

For isolation of RNA, the cells were washed twice in ice-cold PBS, and total RNA was isolated using the RNA-Clean System (Angewandte Gentechnologie Systeme, Heidelberg, Germany). For Northern blot analysis, 10 µg of RNA/lane was electrophoresed through formaldehyde-agarose gels, transferred onto nylon membrane, and hybridized with digoxigenin-labeled RNA probes specific for MCP-1 or GAPDH. The probes were labeled using the DIG RNA labeling kit, and detection of nucleic acids was performed with the DIG Chemiluminescent Detection Kit (both reagents systems were from Roche Molecular Biochemicals). The resulting bands were quantitated by densitometry.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Design of the TFO

A computer search was conducted to identify potential triple helix-forming target sites within the human MCP-1 gene using the sequences reported for the mRNA and the 5' genome region in the GenBank database (26, 27). The sequences were scanned for motifs consisting of a continuous stretch of at least 15 purine bases in one strand, with no more than one mismatch (pyrimidine), and a minimum G content of 65%. One possible target site consisting of 19 bp was identified in the promoter region of MCP-1 at bp -66 to -48 (Fig. 1Go). The TFO target site in the MCP-1 promoter includes the binding site for the transcription factor SP-1 and partially overlaps a putative AP-1 binding site; both are sites that have been implicated in the regulation of MCP-1 gene expression. Since it has previously been shown that triple helix formation can interfere with transcription factor-DNA interactions, we anticipated that this might be a suitable target site for a TFO aimed at the inhibition of gene transcription. A triplex-forming oligonucleotide based on the antiparallel purine motif was designed according to the known rules, e.g., T opposite A:T pairs and G opposite G:C pairs (19). T was placed opposite the C-G inversion, because this base was previously shown to be tolerated opposite C:G pairs in triple helix motifs without adverse effect on the binding affinity of the TFO (28, 29). The purine motif was chosen, because purine oligonucleotides, unlike pyrimidine oligonucleotides, can bind to the target DNA at physiological pH (19).



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 1. Structure of the human MCP-1 promoter, TFO target sequence in the promoter, sequences of the oligonucleotides, and the synthetic promoter fragment used in this study. The proximal promoter region of the human MCP-1 gene contains putative binding sites for the transcription factors NF-{kappa}B, AP-1, and SP-1, as well as a TATA box. Position +1 corresponds to the major transcriptional start site, as described by Ueda et al. (23 ). The 19-bp target site for the TFO is indicated; a point of mismatch is shown by small capital letters. The TFO was designed as homopurine oligonucleotide binding to the target site in an antiparallel manner. The control oligonucleotide has the same base composition as the TFO in scrambled order. For gel shift assays of triple helix formation, a synthetic promoter fragment spanning bp -76 to -38 was used as target duplex DNA.

 
In vitro binding of the TFO to the MCP-1 promoter

To assess the ability of the TFO to form triple helices with the target site in the MCP-1 promoter, gel mobility shift assays were performed. A synthetic 39-bp promoter fragment (Fig. 1Go) spanning the TFO target sequence and flanking regions was synthesized and end labeled with digoxigenin to allow detection. The promoter fragment was incubated with 10 µM TFO or control oligonucleotide (a scrambled oligonucleotide of the same base composition) in the presence of 5 mM MgCl2 and subjected to native polyacrylamide gel electrophoresis. Under the conditions used, triple helical complexes are stable during the course of the electrophoresis run (2 h) and migrate significantly slower than the corresponding duplex target (30). At 10 µM TFO, the MCP-1 duplex was quantitatively converted to triplex DNA (Fig. 2Go). The triple helix formation was sequence specific, because the control oligonucleotide did not bind to the MCP-1 promoter fragment. Conversely, the TFO did not bind to two 39-bp control DNA duplexes; one of the controls was a DNA of unrelated sequence provided by the manufacturer of the gel shift reagent system (control duplex 1), and the second control was the SP-1 binding region of the human IL-6 promoter (Fig. 2Go).



View larger version (47K):
[in this window]
[in a new window]
  		FIGURE 2. In vitro determination of triple helix formation by gel mobility shift assay. Binding of the TFO or control oligonucleotide to duplex DNA was assayed by native gel electrophoresis through 12.5% polyacrylamide gels. The target duplex was the digoxigenin-3' end-labeled 39-bp fragment spanning bp -76 to -38 of the MCP-1 promoter, shown in Fig. 1Go. Control duplex 1 was a 39-mer digoxigenin-labeled duplex provided by the DIG Gel Shift Kit (Roche Molecular Biochemicals); the second control was a promoter fragment containing the SP-1 binding sites of the human IL-6 promoter. The DNA duplexes were incubated for 1 h at 37°C with 10 µM TFO or control oligonucleotide, as indicated, in a buffer consisting of 10 mM Tris-HCl (pH 7.4), 10% sucrose, and 5 mM MgCl2. After electrophoresis, the samples were transferred onto nylon membrane, and labeled DNA was detected using digoxigenin-specific chemiluminescent detection reagents.

 
Triple helix formation between the TFO and the promoter fragment was dose dependent; a typical gel of a titration with increasing amounts of oligonucleotide is shown in Fig. 3GoA. For the phosphodiester TFO, the EC50 value for in vitro triplex formation was ~1.9 x 10-7 M (Fig. 3GoD). Since it was our aim to develop a TFO that can be tested in biological systems, we also analyzed the corresponding phosphorothioated oligonucleotide of same sequence. Phosphorothioated oligonucleotides are much more stable to cellular nucleases than the phosphodiester oligonucleotides. In addition, they may have advantages for triple helix formation in cellular environments, because their interaction with DNA targets appears to be less sensitive to physiological concentrations of potassium ions (31). The phosphorothioated oligonucleotide also formed triple helices in a dose-dependent manner (Fig. 3GoC), with an EC50 value of ~1.5 x 10-6 M (Fig. 3GoD).



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 3. Triple helix formation: dose response and effect of oligonucleotide backbone. Triple helix formation was assayed by native gel electrophoresis, as described under Materials and Methods. The digoxigenin-labeled promoter fragment was incubated for 1 h at 37°C with increasing concentrations of phosphodiester TFO, phosphodiester control oligonucleotide, or phosphorothioated TFO, as indicated, in a buffer consisting of 10 mM Tris-HCl (pH 7.4), 10% sucrose, and 5 mM MgCl2. After electrophoresis, the samples were transferred onto nylon membrane, and labeled DNA was detected using digoxigenin-specific chemiluminescent detection reagents. A–C, One representative experiment of at least two for each oligonucleotide. D, Graphic representation of the titration curves, in which the data from all experiments were combined.

 
Inhibition of transcription factor binding by TFOs

Because the TFO binding site in the MCP-1 promoter spans the entire binding site for the transcription factor SP-1, it was determined whether the binding of the TFO could interfere with transcription factor binding in vitro. The digoxigenin-labeled MCP-1 promoter duplex was incubated with the TFO and/or rSP-1, and the resulting DNA-DNA and DNA-protein complexes were analyzed by in vitro gel mobility shift assays (Fig. 4GoA). rSP-1 bound to the promoter duplex, and the interaction was inhibited in the presence of the TFO. The binding of cellular transcription factors was also analyzed. Nuclear extract proteins from unstimulated or TNF-{alpha}-stimulated HEK 293 cells were incubated with the digoxigenin-labeled MCP-1 promoter duplex that had or had not been pretreated with the TFO. Under the assay conditions used, no DNA-protein complexes were observed when the DNA was incubated with nuclear extract proteins from unstimulated cells; however, two DNA-protein complexes were detected following incubation of the promoter DNA with TNF-{alpha}-stimulated nuclear extract. In the presence of the TFO, the formation of both complexes was markedly reduced. We have tentatively identified SP-1 as one component of the DNA-protein complexes, because disruption of the SP-1 binding motif in the synthetic promoter duplex prevented the formation of the complexes; in contrast, mutation of the AP-1 binding site did not affect DNA-protein complex formation (data not shown).



View larger version (46K):
[in this window]
[in a new window]
  		FIGURE 4. Inhibition of transcription factor binding by triple helix formation in vitro. A, The digoxigenin-labeled MCP-1 promoter fragment described in Fig. 1Go was incubated with 4 footprinting units, as defined by the supplier, of human rSP-1 in the presence or absence of 10 µM TFO. Incubation was for 1 h at 20°C in a buffer consisting of 10 mM Tris-HCl (pH 7.4), 10% sucrose, 20% glycerol, 20 mM KCl, 1 mM DTT, 4 mM HEPES, and 5 mM MgCl2. The samples were electrophoresed through 7% native polyacrylamide gels and transferred to nylon membrane, and digoxigenin-labeled DNA was detected using chemiluminescent detection reagents. B, Digoxigenin-labeled MCP-1 promoter fragment was incubated with 15 µg of nuclear extract proteins from unstimulated or TNF-{alpha}-stimulated HEK 293 cells in the presence or absence of 10 µM TFO. Incubation was for 15 min at 20°C in a buffer consisting of 10 mM Tris-HCl (pH 7.4), 10% sucrose, 5 mM MgCl2, and 1 µg poly(d(AT)). Electrophoresis and detection were performed as described for A.

 
Inhibition of the expression of endogenous MCP-1 in cultured cells

Our next aim was to test whether the TFO can inhibit expression of MCP-1 in cultured cells. Several human cell lines were initially screened by ELISA for cytokine-induced secretion of chemokines. HEK 293 cells were found to produce low basal concentrations of MCP-1 and IL-8, and they could be induced by proinflammatory cytokines to secrete higher levels of these two chemokines (Fig. 5Go); IL-6 could not be detected in the supernatants of HEK cells (the detection limit was 25 pg/ml). The best stimulus for the induction of MCP-1 in HEK 293 cells was TNF-{alpha}, which increased the amount of secreted MCP-1 7-fold. HEK 293 cells can therefore serve as a model system to study MCP-1 gene expression, and this cell line was chosen for additional experiments.



View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 5. Cytokine-inducible secretion of the chemokines MCP-1 and IL-8 by HEK 293 cells. HEK 293 cells plated in 24-well plates at a density of 160,000 cells/well were left unstimulated or treated with the indicated cytokines (500 U/ml TNF-{alpha}, 10 ng/ml IL-1ß, or 1000 U/ml IFN-{gamma}) for 24 h. Following cytokine treatment, the culture media were harvested and the concentrations of secreted MCP-1 and IL-8 were determined by ELISA. The cell cultures were performed in duplicate; the error bars indicate the data range.

 
HEK 293 cells were treated with various concentrations of phosphorothioated TFO for 48 h. To increase the resistance of the oligonucleotides to cellular nucleases and to reduce the dependence of the TFO-DNA interaction on K+ ions, the oligonucleotides with a phosphorothioate backbone were used. The oligonucleotides were added directly to the culture medium without the help of transfection reagents, because of earlier observations that the stress caused by mock transfections alone is sufficient to induce the expression of chemokines. Pretreatment of HEK 293 cells with the TFO for 48 h inhibited the secretion of MCP-1, but not IL-8, in unstimulated and TNF-{alpha}-stimulated cells, as determined by ELISA (Fig. 6Go). At 2 µM TFO, the MCP-1 secretion in unstimulated cells was reduced by 11%; in TNF-{alpha}-stimulated cells by 23%. At 5 µM, the effect was more pronounced; MCP-1 secretion from unstimulated cells was again lowered by 11% and secretion by TNF-{alpha}-stimulated cells was reduced by 45%. The secretion of IL-8 was unaffected at 2 or 5 µM TFO, indicating that the effects of the TFO were not caused by nonspecific inhibition of protein synthesis, but appear to be gene specific. The control oligonucleotide used had no effect on MCP-1 or IL-8 secretion at concentrations up to 5 µM. Higher concentrations of the TFO or control oligonucleotide resulted in decreased cell viability with concomittantly decreased secretion of both MCP-1 and IL-8 (data not shown). Treatment of the cells with 5 µM TFO for 24 h only did not result in significant reduction of MCP-1 secretion, indicating that oligonucleotide uptake and/or target binding in cells are slow processes.



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 6. Inhibition of MCP-1 secretion by incubation with the TFO. HEK 293 cells plated in 24-well plates at a density of 160,000 cells/well were pretreated with 2 µM or 5 µM phosphorothioated TFO or control oligonucleotide, as indicated, for 48 h. Thereafter, the medium was replaced (400 µl/well) with medium containing the same concentration of oligonucleotide as before, and the cells were cultured for additional 24 h in the absence or presence of 500 U/ml TNF-{alpha}. At the end of the incubation period, the culture supernatants were harvested, and the concentrations of MCP-1 and IL-8 were determined by ELISA. One experiment of two with similar results is shown. The cell culture was performed in triplicate; the error bars indicate the SEM.

 
To investigate whether the effects on MCP-1 secretion were caused by reduced gene transcription, MCP-1 expression was analyzed at the mRNA level. HEK 293 cells were treated with 5 µM TFO or control oligonucleotide for 48 h, then the cells were treated with TNF-{alpha} for 3 h and total RNA was isolated. The MCP-1 gene expression was analyzed by Northern analyses; a typical gel is shown in Fig. 7GoA. Densitometric analysis of three similar gels showed that the expression of MCP-1 mRNA in TNF-{alpha}-treated cells was reduced by ~40% by the TFO pretreatment compared with cells without oligonucleotide addition (Fig. 7GoB). Pretreatment with the control oligonucleotide resulted in a statistically nonsignificant 18% increase of MCP-1 mRNA. The effect of the TFO on the MCP-1 mRNA in unstimulated HEK 293 cells could not be determined, because in unstimulated cells the mRNA level was at or below the detection limit.



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 7. Inhibition of MCP-1 gene transcription by the TFO. HEK 293 cells were treated with 5 µM TFO or control oligonucleotide or left untreated, as indicated, for 48 h. Then the cells were left unstimulated or stimulated with TNF-{alpha} (500 U/ml) for 3 h. Total RNA was isolated from the cells, and 10 µg of RNA was subjected to formaldehyde-agarose gel electrophoresis, transferred to nylon membrane, and hybridized with digoxigenin-labeled RNA probes specific for MCP-1 or GAPDH. Detection of the labeled probes was performed with digoxigenin-specific chemiluminescence detection reagents. A, Shows one representative experiment of three. B, The TNF-{alpha}-stimulated samples were analyzed by densitometry. The relative OD of the MCP-1 bands were normalized using the GAPDH bands as control. The RNA level without oligonucleotide treatment was then defined as 100% and used as reference for the oligonucleotide-treated samples. The graph shows the mean values of all three experiments ± SEM.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The present investigation shows that a TFO is capable of in vitro binding to the SP-1 site of the human MCP-1 gene promoter. This interaction appears to be gene specific, because the oligonucleotide did not bind to the SP-1 region of the IL-6 gene. Binding of the oligonucleotide replaces the binding of nuclear proteins to the same site, including the transcription factor SP-1. It was further demonstrated that it is possible to use the oligonucleotide to partially inhibit the secretion of MCP-1 from HEK 293 cells. A reduction of MCP-1 mRNA was achieved by the TFO treatment, suggesting that the inhibitory effect on MCP-1 secretion was caused at the transcriptional level. The data have implications for the long-range goal to assess the feasibility of developing oligonucleotide-based anti-inflammatory agents that specifically reduce the expression of MCP-1 or other chemokines in vivo.

Previously, TFOs targeted to the IL-2R, TNF-{alpha}, GM-CSF, human mitochondrial aldehyde dehydrogenase, and several other genes have been described, with the observed EC50 values for in vitro triplex formation ranging from 3 x 10-10 M to >10-5 M (20, 21, 22, 31). The EC50 values for the TFOs described in this study fall within this range. The observation that the phosphorothioated oligonucleotide had an 8-fold higher EC50 than the phosphodiester oligonucleotide of same sequence was unexpected. Hacia et al. (32) examined in detail the effects of changing the backbone from phosphodiester to phosphorothioate for two triplex target sites, and observed similar affinities for oligonucleotides in the antiparallel purine motif regardless of the backbone. The effects of the oligonucleotide backbone on the in vitro binding affinity may vary with sequence composition.

A comparison of the published data on different TFO targets shows that the EC50 values determined in binding assays are only of limited value for predicting the concentrations required to achieve effects in cell culture. Nevertheless, the in vitro binding assay can be a rapid and meaningful assay to compare the affinities of different probes for a given site and thus aid in the development of tighter binding analogues (25). For example, substituting some of the guanosine residues with 6-thioguanosine has been reported to increase the stability of the triplexes and to lower the sensitivity to K+ ions in some instances (33). Oligonucleotides with nonionic backbones are also predicted to have improved binding characteristics due to the elimination of electrostatic repulsion, and they have the added advantage of being resistant to cellular nucleases; these backbone modifications include methylphosphonates and phosphoramidates (19). Finally, the use of a nonnatural base analogue in the position binding to the C:G inversion could potentially improve the overall binding affinity of the TFO. These and other modifications of the TFO and observation of their effects on triplex formation represent an interesting area for future studies.

Occupancy of the SP-1 binding site by the TFO prevented the in vitro binding of SP-1 to the same site; thus, binding of either the TFO or of SP-1 to the promoter are mutually exclusive events. The binding experiments with the nuclear extract proteins from HEK 293 cells also showed that the binding of oligonucleotide or protein to the DNA target are competing reactions. The identities of the proteins in the nuclear extract that bind to the promoter fragment are not entirely clear. Based on preliminary results with promoter fragments containing mutations in the SP-1 or AP-1 binding sites, we have seen evidence for the participation of SP-1, but not AP-1, in the complexes; additional unidentified proteins may be present. This is consistent with previous reports that the SP-1 binding site is important in a broad range of cell types, whereas the AP-1 site in the promoter fragment regulates cytokine-induced MCP-1 expression in some but not all cell lines tested (23, 34). The observation that the promoter-binding proteins were present in nuclear extracts only after TNF-{alpha} stimulation is not necessarily inconsistent with the involvement of SP-1. In the past, SP-1 has been thought of as a factor that is mainly associated with basal transcription, but there is increasing evidence now that SP-1 can be involved in the regulation of cytokine- and shear stress-induced transcription as well (35, 36). In any case, these in vitro findings support our hypothesis that triple helix formation at the MCP-1 promoter can serve as a mechanism for transcriptional repression by replacing or preventing the binding of necessary transcription factors.

In the tissue culture experiments, a partial inhibition of TNF-{alpha}-induced MCP-1 expression was seen; the observed inhibition levels are consistent with those reported by other laboratories for other TFO target genes in tissue culture. In one instance, up to 90% inhibition was achieved (31), but inhibition levels ranging from 14%–60% in cell culture have been more common. It is possible that to achieve quantitative inhibition of TNF-{alpha}-induced MCP-1 gene expression, other regulatory elements of the promoter, such as an NF-{kappa}B binding site at bp -2613/-2603, would have to be targeted as well; this cis element is essential for TNF-{alpha}- and IL-1ß-induced enhancer activity in a number of cell types (23, 34).

It is also possible that the inhibition levels seen in cell culture were limited by the rate and extent of oligonucleotide uptake into the cells. Oligonucleotides have little ability to passively diffuse across cell membranes. They are taken up primarily through endocytosis, which is mediated in part by receptor-like oligonucleotide-binding proteins on the cell surface (37). After internalization, the oligonucleotides have to escape the vesicles and enter the cytoplasm intact. From the cytoplasm they reach the nucleus most likely by passive diffusion through the nuclear pore complex, an aqueous channel of ~9 nm in diameter that allows unhindered passage of molecules up to 40–60 kDa (38). Different cell types vary widely in their ability to endocytose oligonucleotides; it is also clear that depending on cell type there are more or less efficient efflux mechanisms leading to the elimination of oligonucleotides from the nucleus (20, 38). The relatively long incubation period of 48 h required for the TFO to be effective indicates that the accumulation of effective oligonucleotide concentrations in the nucleus may be a slow process.

It is noteworthy that the inhibition of MCP-1 secretion was significantly more pronounced in the TNF-{alpha}-stimulated cells than in the unstimulated cells (45% vs 11%, respectively, at 5 µM TFO). This latter observation might be related to differences in the accessibility of the target sequence under different stimulation conditions. For the TFO to bind to the target sequence, it must overcome possible steric hindrance by the chromatin structure in the gene, which can undergo major changes upon up-regulation of transcription. The hypothesis that the TFO target region in the MCP-1 gene can change accessibility under cytokine stimulation is supported by a recent study that showed that IFN-{gamma}-induced signaling resulted in changes in the genomic footprinting pattern of the MCP-1 promoter SP-1 binding site in astrocytoma cells (35).

To date, the successes achieved with TFOs in cell culture have not translated into TFO applications in in vivo models. To achieve this end, another area of intense research, besides the earlier mentioned efforts to develop base analogues with improved binding affinity, is the development of improved oligonucleotide delivery systems. Potentially interesting delivery systems in this regard could consist of the recently described penetratins, which are reported to function as trojan peptides for the intracellular delivery of DNA (39), or of polylysine-conjugated oligonucleotides in the presence of the capsid of a replication-deficient adenovirus (40). These systems can be readily studied in cell culture models such as the one we described, and insights gained by these studies might provide useful information for the development of novel in vivo delivery systems.

This study, using the human MCP-1 gene as an example, supports the notion that, despite the current limitations of TFO technology such as limited number of genes with appropriate target sequences and variable accessibility of the target sequences in living cells, TFOs can be used in selected cases to specifically inhibit gene expression. It is the first report showing that the cytokine-induced synthesis of a chemokine can be influenced by TFO treatment in cell culture. Given the importance of MCP-1 in the progression of inflammatory diseases, such as glomerulonephritis or rheumatoid arthritis, it is imaginable that the ability to block the synthesis of this chemokine in vivo during an inflammatory reaction could have a beneficial effect on the course of these diseases. Thus, the further development of oligonucleotide-based reagents with improved binding affinities and/or delivery systems could be an alternative therapeutic strategy to MCP-1 receptor antagonists.


   Acknowledgments
 
We thank Drs. Frauke Rininsland, Michael Martin, and Michael Kracht for helpful suggestions; and Juliane von der Ohe and Dorothea Bouillon-Ludwig for excellent technical assistance.


   Footnotes
 
1 This work was supported by a grant from the Deutsche Forschungsgemeinschaft, SFB 244 B1. Back

2 Address correspondence and reprint requests to Dr. Heinfried H. Radeke, Institute of Pharmacology, Medical School Hannover, D-30625 Hannover, Germany. E-mail address: Back

3 Abbreviations used in this paper: MCP, monocyte chemoattractant protein; HEK, human embryonic kidney; TFO, triple helix-forming oligonucleotide. Back

Received for publication August 4, 1999. Accepted for publication December 3, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Vaddi, K., R. C. Newton. 1994. Regulation of monocyte integrin expression by ß-family chemokines. J. Immunol. 153:4721.[Abstract]
  2. Murphy, P. M.. 1994. The molecular biology of leukocyte chemoattractant receptors. Annu. Rev. Immunol. 12:593.[Medline]
  3. Ward, S. G., J. Westwick. 1998. Chemokines: understanding their role in T-lymphocyte biology. Biochem. J. 333:457.
  4. Cao, Y. H., C. Chen, J. A. Weatherbee, M. Tsang, J. Folkman. 1995. gro-beta, a C-X-C chemokine, is an angiogenesis inhibitor that suppresses the growth of Lewis lung carcinoma in mice. J. Exp. Med. 182:2069.[Abstract/Free Full Text]
  5. Hesselgesser, J., M. Halks-Miller, V. DelVecchio, S. C. Peiper, J. Hoxie, D. L. Kolson, D. Taub, R. Horuk. 1997. CD4-independent association between HIV-1 gp120 and CXCR4: functional chemokine receptors are expressed in human neurons. Curr. Biol. 7:112.[Medline]
  6. Locati, M., P. M. Murphy. 1999. Chemokines and chemokine receptors: biology and clinical relevance in inflammation and AIDS. Annu. Rev. Med. 50:425.[Medline]
  7. Rovin, B. H., M. Rumancik, L. Tan, J. Dickerson. 1994. Glomerular expression of monocyte chemoattractant protein-1 in experimental and human glomerulonephritis. Lab. Invest. 71:536.[Medline]
  8. Rovin, B. H., N. Doe, L. C. Tan. 1996. Monocyte chemoattractant protein-1 levels in patients with glomerular disease. Am. J. Kidney Dis. 27:640.[Medline]
  9. Rollins, B. J., T. Yoshimura, E. J. Leonard, J. S. Pober. 1990. Cytokine-activated human endothelial cells synthesize and secrete a monocyte chemoattractant, MCP-1/JE. Am. J. Pathol. 136:1229.[Abstract]
  10. Rovin, B. H., T. Yoshimura, L. Tan. 1992. Cytokine-induced production of monocyte chemoattractant protein-1 by cultured human mesangial cells. J. Immunol. 148:2148.[Abstract]
  11. Schwarz, M., H. H. Radeke, K. Resch, P. Uciechowski. 1997. Lymphocyte-derived cytokines induce sequential expression of monocyte- and T cell-specific chemokines in human mesangial cells. Kidney Int. 52:1521.[Medline]
  12. Sallusto, F., A. Lanzavecchia, C. R. Mackay. 1998. Chemokines and chemokine receptors in T-cell priming and Th1/Th2-mediated responses. Immunol. Today 19:568.[Medline]
  13. Frade, J. M. R., M. Mellado, G. del Real, J. C. Gutierrez-Ramos, P. Lind, C. Martinez-A. 1997. Characterization of the CCR2 chemokine receptor: functional CCR2 receptor expression in B cells. J. Immunol. 159:5576.[Abstract]
  14. Moxey-Mims, M. M., L. Nielsen, B. Noble, J. S. Lwebuga-Mukasa. 1996. Monocyte chemoattractant protein-1 in chronic proliferative immune complex nephritis. Clin. Immunol. Immunopathol. 80:123.[Medline]
  15. Stahl, R. A., F. Thaiss, M. Disser, U. Helmchen, K. Hora, D. Schlondorff. 1993. Increased expression of monocyte chemoattractant protein-1 in anti-thymocyte antibody-induced glomerulonephritis. Kidney Int. 44:1036.[Medline]
  16. Lloyd, C. M., A. W. Minto, M. E. Dorf, A. Proudfoot, T. N. Wells, D. J. Salant, J. C. Gutierrez-Ramos. 1997. RANTES and monocyte chemoattractant protein-1 (MCP-1) play an important role in the inflammatory phase of crescentic nephritis, but only MCP-1 is involved in crescent formation and interstitial fibrosis. J. Exp. Med. 185:1371.[Abstract/Free Full Text]
  17. Wada, T., H. Yokoyama, K. Furuichi, K. I. Kobayashi, K. Harada, M. Naruto, S. B. Su, M. Akiyama, N. Mukaida, K. Matsushima. 1996. Intervention of crescentic glomerulonephritis by antibodies to monocyte chemotactic and activating factor (MCAF/MCP-1). FASEB J. 10:1418.[Abstract]
  18. Vasquez, K. M., J. H. Wilson. 1998. Triplex-directed modification of genes and gene activity. Trends Biochem. Sci. 23:4.[Medline]
  19. Chan, P. P., P. M. Glazer. 1997. Triplex DNA: fundamentals, advances, and potential applications for gene therapy. J. Mol. Med. 75:267.[Medline]
  20. Orson, F. M., D. W. Thomas, W. M. McShan, D. J. Kessler, M. E. Hogan. 1991. Oligonucleotide inhibition of IL2R{alpha} mRNA transcription by promoter region collinear triplex formation in lymphocytes. Nucleic Acids Res. 19:3435.[Abstract/Free Full Text]
  21. Aggarwal, B. B., L. Schwarz, M. E. Hogan, R. F. Rando. 1996. Triple helix-forming oligodeoxyribonucleotides targeted to the human tumor necrosis factor (TNF) gene inhibit TNF production and block the TNF-dependent growth of human glioblastoma tumor cells. Cancer Res. 56:5156.[Abstract/Free Full Text]
  22. Kochetkova, M., M. F. Shannon. 1996. DNA triplex formation selectively inhibits granulocyte-macrophage colony-stimulating factor gene expression in human T cells. J. Biol. Chem. 271:14438.[Abstract/Free Full Text]
  23. Ueda, A., K. Okuda, S. Ohno, A. Shirai, T. Igarashi, M. Keiichirou, J. Fukushima, S. Kawamoto, Y. Ishigatsubo, T. Okubo. 1994. NF-{kappa}B and SP-1 regulate transcription of the human monocyte chemoattractant protein-1 gene. J. Immunol. 153:2052.[Abstract]
  24. Kang, S.-H., D. A. Brown, I. Kitajima, X. Xu, O. Heidenreich, S. Gryaznov, M. Nerenberg. 1996. Binding and functional effects of transcriptional factor SP-1 on the murine interleukin-6 promoter. J. Biol. Chem. 271:7330.[Abstract/Free Full Text]
  25. Durland, R. H., D. J. Kessler, S. Gunnell, M. Duvic, B. M. Pettitt, M. E. Hogan. 1991. Binding of triple helix forming oligonucleotides to sites in gene promoters. Biochemistry 30:9246.[Medline]
  26. Yoshimura, T., N. Yuhki, S. K. Moore, E. Appella, M. I. Lerman, E. J. Leonard. 1989. Human monocyte chemoattractant protein-1 (MCP-1): full-length cDNA cloning, expression in mitogen-stimulated blood mononuclear leukocytes, and sequence similarity to mouse competence gene JE. FEBS Lett. 244:487.[Medline]
  27. Rollins, B. J., P. Stier, T. Ernst, G. G. Wong. 1989. The human homolog of the JE gene encodes a monocyte secretory protein. Mol. Cell. Biol. 9:4687.[Abstract/Free Full Text]
  28. Beal, P. A., P. B. Dervan. 1992. The influence of single base triplet changes on the stability of a pur.pur.pyr. triple helix determined by affinity cleaving. Nucleic Acids Res. 20:2773.[Abstract/Free Full Text]
  29. Durland, R. H., T. S. Rao, G. R. Revankar, J. H. Tinsley, M. A. Myrick, D. M. Seth, J. Rayford, P. Singh, K. Jayaraman. 1994. Binding of T and T analogs to CG base pairs in antiparallel triplexes. Nucleic Acids Res. 22:3233.[Abstract/Free Full Text]
  30. Cooney, M., G. Czernuszewicz, E. H. Postel, S. J. Flint, M. E. Hogan. 1988. Site-specific oligonucleotide binding represses transcription of the human c-myc gene in vitro. Science 241:456.[Abstract/Free Full Text]
  31. Tu, G.-C., Q.-N. Cao, Y. Israel. 1995. Inhibition of gene expression by triple helix formation in hepatoma cells. J. Biol. Chem. 270:28402.[Abstract/Free Full Text]
  32. Hacia, J. G., B. J. Wold, P. B. Dervan. 1994. Phosphorothioated oligonucleotide-directed triple helix formation. Biochemistry 33:5367.[Medline]
  33. Vasquez, K. M., T. G. Wensel, M. E. Hogan, J. H. Wilson. 1995. High-affinity triple helix formation by synthetic oligonucleotides at a site within a selectable mammalian gene. Biochemistry 34:7243.[Medline]
  34. Martin, T., P. M. Cardarelli, G. C. N. Parry, K. A. Felts, R. R. Cobb. 1997. Cytokine induction of monocyte chemoattractant protein-1 gene expression in human endothelial cells depends on cooperative action of NF-{kappa}B and AP-1 expression. Eur. J. Immunol. 27:1091.[Medline]
  35. Zhou, Z.-H. L., P. Chaturvedi, Y. Han, S. Aras, Y. Li, P. E. Kolattukudy, D. Ping, J. M. Boss, R. M. Ransohoff. 1999. IFN-{gamma} induction of the human monocyte chemoattractant protein (hMCP)-1 gene in astrocytoma cells: functional interaction between an IFN-{gamma}-activated site and a GC-rich element. J. Immunol. 160:3908.[Abstract/Free Full Text]
  36. Lin, M. C., J. F. Almus, H. H. Chen, G. C. Parry, N. Mackman, J. Y. Shyy, S. Chien. 1997. Shear stress induction of the tissue factor gene. J. Clin. Invest. 99:737.[Medline]
  37. Gewirtz, A. M., C. A. Stein, P. M. Glazer. 1996. Facilitating oligonucleotide delivery: helping antisense deliver on its promise. Proc. Natl. Acad. Sci. USA 93:3161.[Abstract/Free Full Text]
  38. Weis, K.. 1998. Importins and exportins: how to get in and out of the nucleus. Trends Biochem. Sci. 23:185.[Medline]
  39. Derossi, D., G. Chassaing, A. Prochiantz. 1998. Trojan peptides: the penetration system for intracellular delivery. Trends Cell Biol. 8:84.[Medline]
  40. Wagner, E., K. Zatloukal, M. Cotten, H. Kirlappos, K. Mechtler, D. T. Curiel, M. L. Birnstiel. 1992. Coupling of adenovirus to transferrin-polylysine/DNA complexes greatly enhances receptor-mediated gene delivery and expression of transfected genes. Proc. Natl. Acad. Sci. U S A 89:6099.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
M. Duca, P. Vekhoff, K. Oussedik, L. Halby, and P. B. Arimondo
The triple helix: 50 years later, the outcome
Nucleic Acids Res., September 1, 2008; 36(16): 5123 - 5138.
[Abstract] [Full Text] [PDF]

Home page
 Nephrol Dial TransplantHome page
L. Gu, S. Hagiwara, Q. Fan, M. Tanimoto, M. Kobata, M. Yamashita, T. Nishitani, T. Gohda, Z. Ni, J. Qian, et al.
Role of receptor for advanced glycation end-products and signalling events in advanced glycation end-product-induced monocyte chemoattractant protein-1 expression in differentiated mouse podocytes
Nephrol. Dial. Transplant., February 1, 2006; 21(2): 299 - 313.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
T. G. Uil, H. J. Haisma, and M. G. Rots
Therapeutic modulation of endogenous gene function by agents with designed DNA-sequence specificities
Nucleic Acids Res., November 1, 2003; 31(21): 6064 - 6078.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Schwarz and P. M. Murphy
Kaposi's Sarcoma-Associated Herpesvirus G Protein-Coupled Receptor Constitutively Activates NF-{{kappa}}B and Induces Proinflammatory Cytokine and Chemokine Production Via a C-Terminal Signaling Determinant
J. Immunol., July 1, 2001; 167(1): 505 - 513.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
E. M. McGuffie, D. Pacheco, G. M. R. Carbone, and C. V. Catapano
Antigene and Antiproliferative Effects of a c-myc-targeting Phosphorothioate Triple Helix-forming Oligonucleotide in Human Leukemia Cells
Cancer Res., July 1, 2000; 60(14): 3790 - 3799.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marchand, P.
Right arrow Articles by Radeke, H. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marchand, P.
Right arrow Articles by Radeke, H. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS