The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wei, C.
Right arrow Articles by Goldschneider, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wei, C.
Right arrow Articles by Goldschneider, I.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Stem Cells
The Journal of Immunology, 2000, 164: 1961-1970.
Copyright © 2000 by The American Association of Immunologists

Murine Pro-B Cells Require IL-7 and Its Receptor Complex to Up-Regulate IL-7R{alpha}, Terminal Deoxynucleotidyltransferase, and cµ Expression1

Chiju Wei, Richard Zeff and Irving Goldschneider2

Department of Pathology, University of Connecticut Health Center, Farmington, CT 06030


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Phenotypic analysis of bone marrow cells from IL-7 knockout (KO) mice revealed that B cell development is blocked precisely at the transition between pro-B cells and pre-B cells. In contrast, the generation of pre-pro-B cells and pro-B cells appeared to be normal, as judged by total cell numbers, proliferative indexes, D-JH and V-DJH gene rearrangements, and mRNA for recombinase-activating gene-1 (RAG-1), RAG-2, TdT, Igµ, {lambda}5, and VpreB. However, upon closer inspection, several abnormalities in pro-B cell development were identified that could be corrected by injection of rIL-7 in vivo. These included the absence of the subset of late pro-B cells that initiates cµ expression for pre-B cell Ag receptor (BCR) formation, and the failure of pro-B cells to up-regulate TdT and the IL-7R{alpha} (but not the common {gamma}-chain) chain. Similar defects were present in common {gamma}-chain and Jak3 KO mice, but not in {lambda}5 or (excluding cytoplasmic Ig µ heavy chain (cµ)) RAG-1 KO mice, all of which also arrest at the late pro-B cell stage. Consequently, up-regulation of TdT and IL-7R{alpha} expression requires signaling through the high affinity IL-7R, but does not require cµ expression or a functional pre-BCR. Taken together, these results suggest that IL-7 and its receptor complex are essential for 1) up-regulating the expression of TdT and IL-7R{alpha}, 2) initiating the production of cµ, and 3) promoting the formation of a functional pre-BCR in/on pro-B cells. These key events, in turn, appear to be prerequisite both for differentiation of pro-B cells to pre-B cells and for proliferation of these cell subsets upon continued stimulation with IL-7.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-7 was originally identified as a stromal cell-derived cytokine that stimulated proliferation of pre-B cells in a long term mouse bone marrow lymphoid culture system (1, 2). The importance of IL-7 in early B cell development was further documented by in vitro and in vivo neutralization studies with anti-IL-7 mAbs (3, 4), and more recently in IL-7R{alpha} and IL-7 gene-deleted knockout (KO)3 (3) mice (5, 6). However, knowledge of the exact functions of IL-7 in regulating the survival, proliferation, and/or differentiation of B-lineage cells at different stages of development in bone marrow (BM) is incomplete and somewhat contradictory (7). For example, Hardy et al. (8) reported that freshly explanted BM pre-B cells, unlike pre-B cells from long term cultures, do not respond to rIL-7 even through the IL-7R{alpha} is expressed (9). Furthermore, pro-B cells were found to respond to rIL-7 in a cell contact-dependent manner, whereas the response of pre-pro-B cells was minimal. We have recently provided a possible explanation for this latter phenomenon by describing an heterodimeric form of IL-7 (PPBSF) that selectively stimulates the proliferation of pre-pro-B cells in vitro and primes their progeny to respond to monomeric IL-7 (10, 11). In contrast, Saffran et al. (12) reported that pro-B cells can be generated in long term culture in the absence of IL-7, and Winkler et al. (13) demonstrated that IL-3 can substitute for IL-7 in the generation of pro-B cells in vitro. These latter two studies are consistent with the observation that B cell development progresses through the pro-B cell stage in IL-7 KO mice (6), but not with the observations that B cell development is blocked at the pre-pro-B cell stage in IL-7R KO mice and in anti-IL-7 Ab-treated mice (4, 5).

The function of IL-7 in the rearrangement of Ag receptor genes in B and T cells has been studied extensively in vitro (reviewed in Ref. 14). However, the results are inconclusive, due in large part to difficulties in distinguishing mechanistic from trophic effects on the rearrangement process (15, 16, 17). Studies of the function of IL-7 on IgH rearrangement have focused on the generation of pre-B cells in vitro by BM cells from IL-7R{alpha} KO mice. Restoration of pre-B cell production was observed when the IL-7R{alpha} was reintroduced by means of retroviral transfection (18), and distinct signals for proliferation and differentiation were identified when the transfected IL-7R{alpha} was mutated or swapped with the cytoplasmic domain of IL-2Rß. In contrast, rIL-7 was found to reduce the rearrangement of an artificial VDJ recombination substrate in a cultured pre-B cell line (19). Moreover, introduction of a bcl-2 transgene in IL-7R{alpha}-deficient mice or common {gamma}-chain ({gamma}c)-deficient mice ({gamma}c is a component of the high affinity IL-7R) did not restore B cell development (20, 21).

TCR gene rearrangement among developing thymocytes has also been studied in IL-7R{alpha} KO mice. The results showed normal rearrangement of the TCRß gene, but were inconsistent regarding the TCR{gamma} gene (22, 23, 24). Furthermore, although a functional TCR{alpha}ß transgene resulted in the development of double-positive and single-positive thymocytes, their numbers were markedly reduced (25, 26). Most importantly, a bcl-2 transgene was able to completely restore T cell development in IL-7R{alpha} KO mice (27, 28), thereby convincingly arguing against an instructive function for IL-7 in TCR gene rearrangement. These results in aggregate suggest that IL-7 (and/or the IL-7R) may have somewhat different functions in B cell and T cell development.

In this study we have conducted phenotypic, cell cycle, and IgH gene rearrangement studies on BM cells from IL-7 KO mice as well as from {gamma}c and Jak3 KO mice to more precisely define the role of IL-7 in early B cell development. The results indicate that IL-7 is required for both the proliferation and differentiation of early pre-B cells, but not for the proliferation or phenotypic differentiation of pre-pro-B cells to pro-B cells or for IgH gene rearrangement. Nonetheless, the results clearly indicate that both IL-7 and its receptor complex are essential to up-regulate the expression of IL-7R{alpha}, TdT, and cµ at the early and/or late pro-B cell stages.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

Breeding pairs of IL-7 KO, {gamma}c KO, and Jak3 KO mice (6, 29, 30, 31, 32, 33) were provided by Drs. Richard Murray (DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, CA), Warren Leonard (Laboratory of Molecular Immunology, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD), and James Ihle (Department of Biochemistry, St. Jude Children’s Research Hospital, Memphis, TN), respectively. RAG-1 KO mice and {lambda}5 KO mice were generous gifts from Dr. Michel Nussenzweig (Laboratory of Molecular Immunology, Rockefeller University, New York, NY). Male and female progeny were raised in an isolated microenvironment in our animal care facility and were used at 5–9 wk of age. IL-7+/+ mice were used as controls in most experiments, as were wild-type C57BL/6 and BALB/C mice (National Cancer Institute, Charles River, MD). No significant differences were observed between the IL-7+/+ and wild-type animals.

Antibodies

FITC-, PE-, or biotin-conjugated rat mAbs against mouse B220 (RA3-6B2), HSA (M1/69), CD43 (S7), BP-1, CD5 (53-7.3), {gamma}c (TUGm2), and CD25 (7D4) Ags were purchased from PharMingen (San Diego, CA). Tricolor-conjugated rat anti-mouse B220 mAb (RA3-6B2) was purchased from Caltag (Burlingame, CA). Polyclonal rabbit anti-TdT and FITC-conjugated goat anti-rabbit IgG were purchased from Supertechs (Bethesda, MD). Biotin-conjugated and FITC-conjugated polyclonal rat anti-mouse IgM(µ) were purchased from Serotec (Kidlington, Oxford, U.K.). A7R34 (anti-IL-7R{alpha}) mAb was provided by Dr. Shin-Ichi Nishikawa (Department of Molecular Genetics, Faculty of Medicine, Kyoto University, Japan). Streptavidin-Red 670 was purchased from Life Technologies (Grand Island, NY).

Flow immunocytometric analysis (FCM) and cell sorting

Femoral BM cells were collected by flushing with ice-cold RPMI 1640 (Life Technologies). Red blood cells were lysed with 0.165 M NH4Cl for 2 min at room temperature. Samples were washed and suspended with staining medium (PBS plus 1% BSA and 0.1% NaN3). Single-cell suspensions were made by pipetting and filtering through a nylon cloth.

One million cells per well were incubated with 20 µl of pretitrated Abs in 96-well plates (Costar, Cambridge, MA) for 30 min at 4°C. For two- or three-color staining, cells were incubated with Abs sequentially and washed twice with staining medium after each incubation. Biotin-conjugated Abs were developed by incubation with streptavidin-Red 670. Samples applied to a FACScan or FACScaliber flow cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA) were activated with a single argon ion laser (488 nm). The instrument was calibrated with dye-conjugated beads, and each channel was compensated with single-color cell samples before acquisition. Dead cells and debris were excluded, and lymphocytes were gated on the basis of forward and side scatter. A total of 40,000 events for each sample were acquired and analyzed with CellQuest (Becton Dickinson Immunocytometry Systems). Isotype-matched rat mAbs of unknown specificity were used as negative controls for IL-7R{alpha} and {gamma}c staining, and PBS was used as a negative control for autofluorescence.

For cµ staining, cells were fixed with 2% paraformaldehyde for 30 min at 4°C followed by permeabilization with 0.2% Tween-20 for 30 min at room temperature in the dark. Cells were then stained with FITC-anti-IgM(µ) for 30 min at 4°C. TdT staining was conducted at 4°C. Cells were fixed with 1% paraformaldehyde for 5 min, permeabilized with 70% methanol for 30 min, blocked with normal goat serum for 30 min, and incubated with rabbit anti-TdT and FITC-goat anti-rabbit IgG as previously described (34).

To sort early B-lineage cells, 2–3 x 107 BM cells stained with FITC-B220 and PE-CD43 Abs were applied to a FACStar Plus cell sorter (Becton Dickinson Immunocytometry Systems) at 4°C. Reanalysis of sorted cells showed purities of >95% for B220+CD43+ cells from both IL-7 KO and wild-type mice, with <0.5% contamination with CD43- B cells.

Immunomagnetic cell separation (IMS)

BM cells from IL-7 KO and wild-type mice were stained with biotin-anti- IgM(µ) Ab, and 1 x 108 cells in 900 µl of PBS plus 0.1% NaN3 were incubated for 15 min at 4°C with 100 µl of streptavidin microbeads (Miltenyi Biotec, Sunnyvale, CA). The cell suspension was then applied to a prefilled and washed MACS magnetic column. A 25-gauge needle was used to control the flow speed. The cells in the effluent and subsequent 3 ml of medium wash, collected as the sIgM- fraction, were stained for B220 and CD43, and phenotyped by FCM analysis. The sIgM+ B cells were completely depleted by this procedure, whereas, cµ+ pre-B cells were not affected.

Phenotypic classification of B-lineage cells

Three-color FCM analysis of BM B-lineage cell fraction was performed according to the definition given by Hardy et al. (8). Briefly, BM cells were stained for B220 and CD43. Double-positive cells were further stained for HSA. Fr. A, B-C, and C' cells were identified as HSA-, HSAlow, and HSAhigh, respectively. To determine Fr. C cells, the B220+CD43+ fraction was further stained for BP-1. Fr. A-B and C-C' were defined as BP-1- and BP-1+ respectively. Thus, as shown in Table IGo, Fr. C was calculated by subtraction of Fr. C' from Fr. C-C', and Fr. B was calculated by subtraction of Fr. C from Fr. B-C. To determine Fr. D-F, B220+CD43- cells were stained for sIgM. Fr. D was defined as sIgM-, while Fr. E and F were defined as sIgM+. Fr. F was separated from Fr. E by its higher expression of B220.


View this table:
[in this window]
[in a new window]
 
Table I. Number of developing B-lineage cells/femur in BM from wild-type and IL-7 KO mice1

 
Cell cycle analysis

For total DNA staining, BM cells were first incubated with FITC-B220 and PE-CD43 Abs and fixed overnight at 4°C with 1 ml of 70% ethanol added drop by drop to 100 µl of cell suspension while vortexing. The cells were then incubated with 25 µg of 7-aminoactinomycin D (35) (Molecular Probes, Eugene, OR) in 1 ml of medium for 4 h at room temperature, and analyzed by FCM immediately after washing, using a doublet discrimination module. Cell cycle analysis was performed using the ModFit LT program (Becton Dickinson Immunocytometry Systems).

PCR analysis of IgH rearrangements

PCR conditions and primers were adapted from published procedures (36, 37, 38). Briefly 2 x 105 purified B220+CD43+ BM cells pooled from five mice were pelleted, washed, and resuspended in 100 µl of PCR buffer (10 mM Tris-HCl (pH 8.3 at 25°C), 50 mM KCl, 2.5 mM MgCl2, and 100 µg/ml gelatin). Samples were digested with proteinase K (40 µg/ml; Roche, Indianapolis, IN) at 50°C for 2 h and subsequently, at 90°C for 10 min. The PCR reaction was performed in a total volume of 50 µl containing 5 µl of sample cells, 200 µM each of four deoxynucleotide triphosphates, 15 pmol of primers, and 5 U of Taq polymerase (Life Technologies). PCR was run on a Programmable Thermal Controller PTC-100 (MJ Research, Watertown, MA). Cycles consisting of 1 min at 95°C, 1 min at 65°C, and 2.5 min at 72°C were repeated 26 times. After the last cycle, samples were incubated for an additional 10 min at 72°C. Primers used for PCR were as follows: 5'-Thy-1-CCATCCAGCATGAGTTCAGC, 3'-Thy-1-CTTGACCAGCTTGTCTGTGG; 5'-DH-ACAAGCTTCAAAGCACAATGCCTGGCT, 3'-JH4-CTCTCAGCCGGCTCCCTCAGGG; 5'-VH7183-GCAGCTGGTGGAGTCTGG; 5'-VHQ52-TCCAGACTGAGCATCAGCAA; and 5'-VHJ558-CAGGTCCAACTGCAGCAG.

For Southern blotting, PCR products were separated by 1.5% agarose gel electrophoresis and blotted onto a Gene Screen transfer membrane (DuPont, Boston, MA). Filters were UV cross-linked for 2 min, prehybridized for 1 h, and then hybridized overnight at 60°C. Membranes were washed twice for 30 min each time in 1x SSC at 60°C and imaged on x-ray film (Eastman Kodak, Rochester, NY). The following 32P-labeled oligonucleotides were used for identification of PCR products on Southern blots: JH4 oligo (detection of D-JH and V-DJH rearrangements), CCTGAGGAGACGGTGACTGAGGTTCCTTG; and Thy-1 oligo, CGAGAGAAGAGGAAGCACGTGCTCTCAGG.

To quantify D-JH and V-DJH rearrangements, serial 2-fold dilutions of digested cells were used for PCR reactions. PCR products were then slot blotted onto membranes, and the intensity of amplification was determined by PhosphorImager (Molecular Dynamics, Sunnyvale, CA). The intensities of D-JH and V-DJH amplifications were then plotted against the intensity of Thy-1 amplification.

RT-PCR assay

mRNA was purified with the QuickPrep Micro mRNA Purification Kit (Pharmacia, Piscataway, NJ) in 200 µl of elution buffer according to the protocol provided by the manufacturer. Twenty microliters of the mRNA was reverse transcribed to single-stranded cDNA in 40 µl using the RT system (Promega, Madison, WI) at 42°C for 1 h. Initially, mRNA was isolated from 1 x 105 purified B220+CD43+ BM cells. However, due to the low efficiency of mRNA recovery and gene expression, subsequent RT PCR was not successful even with BM from wild-type mice. Therefore, mRNA purified from 1 x 107 unsorted BM cells pooled from five mice was used for RT-PCR analysis of RAG-1, RAG-2, TdT, VpreB, and {lambda}5 genes. To detect the transcripts for Igµ in BM, immunomagnetic beads were used to deplete sIgM+ B cells. The amplification of ß-actin was used as an internal control for the amount of mRNA in each PCR reaction. The level of expression of each gene was estimated by determining the intensity of amplification (data not shown). Serial 2-fold dilutions of purified mRNA were used to ensure that the amplification was in the linear range (data not shown).

RT-PCR conditions and primers were adapted from the literature (37). Briefly, 5 µl of the cDNA was added to the PCR reaction, as before. PCR cycles consisting of 30 s at 95°C, 30 s at 53°C (for RAG-1) or 55°C (for VpreB and {lambda}5) or 65°C (for cµ), and 45 s at 72°C were repeated 30 times. PCR cycles used for actin, TdT, and RAG-2 were as follows: 30 s at 95°C, 30 s at 62°C (for the first five cycles) or 58°C (for the final 25 cycles), and 45 s at 72°C. After the last cycle, the reactions were held at 72°C for another 10 min. The primers used were as follows: actin, 5'- CCTAAGGCCAACCGTGAAAAG, 3'-TCTTCATGGTGCTAGGAGCCA; TdT, 5'- GAAGATGGGAACAACTCGAAGAG, 3'-CAGGTGCTGGAACATTCTGGGAG; {lambda}5, 5'-CTTGAGGGTCAATGAAGCTCAGA, 3'-CTTGGGCTGACCTAGGATTG; VpreB, 5'-CGTCTGTCCTGCTCATGCT, 3'-ACGGCACAGTAATACACAGCC; RAG-1, 5'-TGCAGACATTCTAGCACTCTGG, 3'-ACATCTGCCTTCACGTCGAT; and RAG-2, 5'-CACATCCACAAGCAGGAAGTACAC, 3'-TCCCTCGACTATACACCACGTCAA.

For Igµ transcripts, the same 5'-oligos for V-DJH rearrangement were used, whereas the 3'-oligo used was CGAGGGGGAAGACATTTGGGAAGGA. The following 32P-labeled oligonucleotides probes were used to identify the specificity of the PCR reactions: actin, oligo-TCTGGTGGTACCACCATGTAC; RAG-1, oligo-CTCATTGCCAGGATTTTCCG; TdT, oligo-TGAATAGAAACTCCTCCCCGAGT, RAG-2-oligo-AGATGTCCCTGAACCCAGATACGG; {lambda}5, oligo-TGGTATGTCTTTGGTGGTGG; and VpreB, oligo-GCATCTCTGAACTGCAGCCT. JH4 oligo was used to identify Igµ transcripts. Southern blot conditions were the same as those described above.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
B cell development is arrested at the transition between Fr. C and Fr. C' in BM of IL-7 KO mice

B cell development in BM of IL-7 KO mice has been shown to be blocked at some point between the pro-B cell and pre-B cell stages (6). To more precisely define the stage of maturation arrest, individual fractions of B220+CD43+ B-lineage cells were analyzed by FCM according to the relative expression of HSA. The results presented in Fig. 1Go revealed normal proportions of pre-pro-B cells (Fr. A) in BM of IL-7 KO mice, an approximately 30% reduction of pro-B cells (Fr. B-C), and an almost complete absence of cells in transition between pro-B cells and pre-B cells (Fr. C'). Similar analyses for the expression of BP-1 and CD25 revealed normal proportions of pre-pro-B cells and early pro-B cells (Fr. A-B), and a 2.2-fold decrease in late pro-B cells and transitional cells (Fr. C-C') in IL-7 KO mice.



View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 1. Phenotypic analysis of early B cell development in BM of IL-7 KO and wild-type (IL-7+/+) mice. B-lineage fractions A-C', identified as B220+CD43+, were further divided into Fr. A (pre-pro-B cells), B-C (pro-B cells), and C' (transitional cells), based on relative expression of HSA, or Fr. A-B (pre-pro-B and early pro-B cells) and C-C' (late pro-B and transitional cells), based on the relative expression of BP-1 or CD25. Data for each fraction represent the mean percentage ± SD of total nucleated BM cells.

 
Table IGo shows the absolute numbers of developing B-lineage cells per femur in wild-type and IL-7 KO mice. Collectively, the number of pre-pro-B cells (Fr. A) in BM of IL-7 KO mice is normal; early and late pro-B cells (Fr. B-C) are reduced about 30%; transitional pro-B cells (Fr. C'), pre-B cells (Fr. D), and immature B cells (Fr. E) are almost absent; and mature B cells (Fr. F) are reduced approximately 7.5-fold.

Proliferation of pre-pro-B and pro-B cells from IL-7 KO mice

To determine whether IL-7 is required to maintain the proliferative fraction of pre-pro-B and/or pro-B cells, the percentages of B220+CD43+ cells in S and G2/M were determined by DNA analysis of BM from IL-7 KO mice. In preliminary experiments the proportion of cycling cells was reduced 2-fold in IL-7 KO mice compared with that in wild-type controls, and the proportion of apoptotic (subG1) cells was increased 6.3-fold (data not shown). However, as shown in Fig. 2Go, when Fr. C' was excluded from analysis, the percentages of pre-pro-B cells (Fr. A) and pro-B cells (Fr. B-C) in S and G2/M did not differ significantly between IL-7 KO and wild-type mice. In addition, the proportions of apoptotic cells in Fr. A-C differed by only 2.7-fold (3.2 vs 1.2%).



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 2. Cell cycle analysis of early B-lineage cells in BM of IL-7 KO and wild-type mice. BM cells, stained for B220, HSA, and total DNA (7AAD, 7-aminoactinomycin D), were analyzed by three-color FCM. The percentage of cells in each stage of the cell cycle is indicated for pre-pro-B (Fr. A) and pro-B (Fr. B-C) cells. The respective values for IL-7 KO and wild-type mice were comparable (p > 0.05).

 
D-JH and V-DJH rearrangement and Igµ mRNA expression in pro-B cells from IL-7 KO mice

Despite the arrest in B cell development before the pre-B cell stage, both D-JH and V-DJH rearrangements of the IgH gene were readily detected by PCR among Fr. A-C BM cells from IL-7 KO mice (Fig. 3GoA). PCR for DJH rearrangements generated four bands of about 1880, 1560, 1190, and 620 bp, representing DJH1, DJH2, DJH3, and DJH4, respectively. PCR for VDJH rearrangements using three VH primers generated eight bands, two each representing JH1, JH2, JH3, and JH4. Of these, the 1720-, 1410-, 1030-, and 450-bp fragments represent rearrangements of both VH7183 and VHJ558, whereas the 1540-, 1230-, 850-, and 265-bp fragments represent rearrangements of VHQ52. To resolve the variability in intensity of these bands, each VH family was tested separately. The distal VHJ558 family was slightly reduced while the proximal VH7183 and VHQ52 were normal in BM of IL-7 KO mice (data not shown). Furthermore, when serially 2-fold diluted cells were used for the PCR reaction, the frequency of D-JH rearrangement was only slightly reduced in IL-7 KO mice, and the frequency of V-DJH rearrangement appeared to be normal (Fig. 3GoB).



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 3. PCR analysis (A) and frequency (B) of D-JH and V-DJH rearrangements in Fr. A-C cells in BM from IL-7 KO and wild-type mice. A, FACS-sorted B220+CD43+HSAneg/low BM cells were used in PCR reactions, and the products were identified by Southern blotting. BM cells from RAG-1 KO mice and 3T3 fibroblasts were included as negative controls (there was one nonspecific amplification in each sample). The amplification of Thy-1 DNA was used as an internal control. B, Twofold serially diluted FACS sorted B220+CD43+HSAneg/low BM cells were used for PCR amplification. The PCR products were slot-blotted onto the membrane. The intensity of the amplifications was determined with a phosphorimager. A representative experiment (one of three) is shown.

 
To study the mRNA expression for Igµ, sIgM- BM lymphoid cells, negatively selected by IMS, were analyzed by RT-PCR. As shown in Fig. 4Go, Igµ mRNA expression (VHJ558 and VHQ52, JH distal and proximal, respectively) (39) was detected in both wild-type and IL-7 KO mice. However, the mRNA expression level of Igµ in IL-7 KO mice was about 1/20th of that in wild-type mice. This appears to be explained by the almost complete absence of Fr. C' and D cells and a 30% reduction in Fr. B-C cells (Table IGo). Yet, despite the transcription of Igµ among the remaining pro-B cells, their expression of cµ was abnormally low (see below).



View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 4. Igµ mRNA expression by early B-lineage cells in BM cells from IL-7 KO and wild-type mice. The sIgM+ cells were depleted by IMS, and different dilutions of purified mRNA from the remaining cells (1 x 107) were analyzed by RT-PCR for transcription of the distal (VHJ558, 380 bp) and proximal (VHQ52, 200 bp) VH families (see Materials and Methods). The expression of ß-actin was included as an internal control. The reduced amplification at 1/1 dilution in IL-7 KO mice was due to interference from the RT buffer. A representative experiment (one of two) is shown.

 
mRNA expression of RAG-1, RAG-2, TdT, VpreB, and {lambda}5 in pro-B cells from IL-7 KO mice

It has been suggested that IL-7 affects the transcription of RAG-1 and RAG-2 genes (25), which are necessary for Ig gene rearrangement. However, as shown in Fig. 5Go, the mRNA levels of RAG-1 and RAG-2, like the associated IgH gene rearrangements, are only proportionately reduced in IL-7 KO mice. Even more surprisingly, transcription of the VpreB and {lambda}5 components of the surrogate light chain was found in IL-7 KO mice, albeit at proportionately reduced mRNA levels. Furthermore, the mRNA level of TdT, which induces junctional diversification of the Ig gene, was normal (if not higher) in IL-7 KO mice compared with that in wild-type mice. Nonetheless, as shown below, the expression of TdT itself was abnormally low.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 5. RT-PCR analysis of gene expression for RAG-1, RAG-2, TdT, {lambda}5, and VpreB in BM cells from IL-7 KO and wild-type mice. Serial dilutions similar to those in Fig. 3GoB were performed to confirm that the amplification was in the linear stage (data not shown). The upper band in the VpreB amplification was due to contamination of genomic DNA. A representative experiment (one of four) is shown.

 
Reduced expression of cµ in pro-B cells from IL-7 KO, {gamma}c KO, and Jak3 KO mice

As reviewed previously (34, 40), some pro-B cells in wild-type mice expressed readily detectable cµ (Fig. 6Go), sufficient to form functional pre-B cell receptors (pre-BCR). However, despite the expression of mRNA for Igµ, cµ expression among pro-B cells in IL-7 KO mice was markedly decreased as both a proportion of total cells and an amount of cµ per positive cell (Fig. 6Go). This is consistent with the 30% reduction in the number of pro-B cells in IL-7 KO mice (Table IGo; Fr. B-C). Similarly, the expression level of cµ among pro-B cells in {gamma}c KO and Jak3 KO mice was markedly reduced, suggesting that both IL-7 and its receptor complex are essential for the expression of cµ. However, cµ expression was normal in pro-B cells from {lambda}5 KO mice. Hence, the arrest in the transition of pro-B cells to pre-B cells in IL-7 KO mice, as in {lambda}5 KO mice, is presumably due to the inability to form a functional pre-BCR.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 6. FCM analysis of relative cµ expression in Fr. A-C cells in BM from IL-7 KO, {gamma}c KO, Jak3 KO, {lambda}5 KO, and wild-type mice. Data represent the mean percentage of cµ+ cells among Fr. A-C for each animal model.

 
Reduced expression of TdT in pro-B cells from IL-7 KO, {gamma}c KO, and Jak3 KO mice

For comparative purposes, the expression of TdT at various stages of B-lineage development was determined by FCM analysis of normal mouse BM. As shown in Fig. 7Go, about half of the cells in the pre-pro-B cell (Fr. A) and pro-B cell (Fr. B-C) fractions expressed TdT; the former was almost exclusively TdTlow, and the latter was mostly TdThigh. Conversely, the transitional cells in Fr. C' appeared to be mostly TdTlow, and few, if any, TdT-positive cells were present in Fr. D.-F.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 7. FCM analysis of relative TdT expression at various stages of early B cell development in wild-type BM. Proportions of TdTlow and TdThigh cells are indicated according to relative fluorescence intensity.

 
In contrast to the above (and despite the elevated levels of mRNA for TdT shown in Fig. 5Go), only TdTlow cells were observed in Fr. A-C from IL-7 KO, {gamma}c KO, and Jak3 KO mice (Fig. 8Go). However, the proportion of TdT-positive cells in Fr. A-C from these mice was normal. Hence, up-regulation of TdTlow to TdThigh pro-B cells does not appear to occur in these mice. This was not true in {lambda}5 and RAG-1 KO mice, indicating that neither the expression of cµ nor the presence of a functional pre-BCR is required to up-regulate TdT.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 8. FCM analysis of relative TdT expression in Fr. A-C cells in BM from IL-7 KO, {gamma}c KO, Jak3 KO, {lambda}5 KO, RAG-1 KO, and wild-type mice. Proportions of TdTlow and TdThigh cells are indicated as described in Fig. 7Go.

 
Reduced expression of IL-7R{alpha} in pro-B cells from IL-7 KO, {gamma}c KO, and Jak3 KO mice

As the expression of receptor often increases upon stimulation by its ligand (41), we determined the expression level of IL-7R on pro-B cells from IL-7 KO mice by FCM analysis. For comparative purposes, the expression of IL-7R{alpha} at all stages of B cell development in BM of wild-type mice was similarly determined. As shown in Fig. 9Go, two IL-7R{alpha}-positive populations can be identified among normal B-lineage cells, IL-7Rlow and IL-7Rhigh. Slightly more than half of the pre-pro-B cells (Fr. A) were IL-7R{alpha} positive, of which 90% were IL-7Rlow, and almost 90% of pro-B cells (Fr. B-C; and probably of transitional cells in Fr. C') were IL-7R{alpha} positive, of which 50% were IL-7Rhigh. Both the expression level of the IL-7R{alpha} (Fr. D) and the proportion of IL-7R{alpha}-positive cells (Fr. E) decreased thereafter, such that few mature B cells (Fr. F) were IL-7R{alpha} positive. In contrast, 40–70% of all stages of developing B cells in BM of wild-type mice expressed relatively constant levels of {gamma}c, which could associate with the {alpha}-chain of IL-7R to increase the affinity of the IL-7R (42, 43).



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 9. FCM analysis of relative IL-7R {alpha}-chain expression at various stages of early B cell development in wild-type BM. Proportions of IL-7Rlow, IL-7Rhigh, and {gamma}c+ cells in each cell fraction are indicated by brackets over filled histograms. Isotype control values are indicated by unfilled histograms.

 
As described above, approximately 75% of pre-pro-B cells and pro-B cells (Fr. A-C) in IL-7 KO mice expressed IL-7R{alpha} (Fig. 10Go). However, the proportion of IL-7Rhigh cells was markedly reduced. Similar reductions in IL-7Rhigh cells were seen in {gamma}c KO and Jak3 KO mice. In contrast, the proportions of IL-7Rhigh cells in Fr. A-C were markedly increased in {lambda}5 KO and RAG-1 KO mice, mostly due to the accumulation of pro-B cells in these animals. The only observed change in {gamma}c expression was the appearance of a major population of {gamma}chigh cells in Fr. A-C from Jak3 KO mice.



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 10. FCM analysis of relative IL-7R {alpha}-chain expression in Fr. A-C cells in BM from IL-7 KO, {gamma}c KO, Jak3 KO, {lambda}5 KO, RAG-1 KO, and wild-type mice. IL-7Rlow, IL-7Rhigh, and {gamma}c+ cells are indicated as described in Fig. 9Go.

 
IL-7 up-regulates expression of cµ, TdT, and IL-7R{alpha} in IL-7 KO mice

To confirm that the above abnormalities in pro-B cell development are, in fact, related to the absence of IL-7 signaling, IL-7 KO mice were reconstituted with 40 ng of rIL-7 injected i.p. daily for 7 days. As shown in Fig. 11Go, pro-B cells from rIL-7-treated animals were induced to up-regulate the expression of cµ, TdT, and IL-7R{alpha} so as to resemble their counterparts in IL-7+/+ mice (Figs. 6Go, 8Go, and 10Go). However, after cessation of rIL-7 treatment, expression levels of these products decreased to levels observed in noninjected IL-7 KO controls.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 11. Up-regulation of IL-7R{alpha}, cµ, and TdT in BM of IL-7 KO mice by in vivo injection of rIL-7. IL-7 KO mice were injected i.p. with 40 ng of rIL-7 daily for 7 days. BM cells were harvested 1 or 7 days after the final injection, and the B220+CD43+ population was analyzed for the expression of IL-7R{alpha}, cµ, and TdT. The proportions of IL-7Rlow, IL-7Rhigh, TdTlow, TdThigh, and, cµ+ cells are indicated according to relative fluorescence intensity.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Despite the designation of Fr. D as the pre-B cell fraction in Hardy’s classification (8), most cells in Fr. C' and about one-third of cells in Fr. B-C of normal mice also express cµ at the protein level to form a functional pre-BCR. The cµ+ cells in Fr. C' appear to correspond to the late pro-B cells reported by Osmond (44) and the large pre-B-II cells of Melchers et al. (45); whereas the cµ+ cells in Fr. B-C presumably represent some of the pro-B cells that recently have undergone productive V-DJH rearrangements, as described by Ehlich et al. (36). These developmental relationships have been summarized by Loffert et al. (40).

However, despite the transcription of Igµ in pro-B cells of IL-7 KO mice, cµ expression is severely reduced in Fr. B-C, and the absence of a functional pre-BCR complex is indicated by the marked reduction of cells expressing CD25 (34). Hence, the abrupt arrest of early B-lineage development at Fr. C' in IL-7 KO mice and the selective depletion of cµ+ cells among Fr. B and Fr. C cells formally demonstrate that IL-7 is essential for regulating the transition of pro-B cells to pre-B cells. Furthermore, the results of cell cycle analyses suggest that, in addition to its critical role in the survival of B cell progenitors (10, 46), IL-7 is essential for the proliferation of early pre-B cells (including Fr. C'). This may help to explain why, apparently unlike the situation in early thymocyte development (21, 27, 28, 47), the bcl-2 transgene does not rescue B lymphopoiesis in IL-7R{alpha} KO or {gamma}c KO mice (20, 21).

Conversely, the presence of normal numbers of cµ- cells and normal cell cycle kinetics in Fr. B and Fr. C from IL-7 KO mice clearly argues against an essential role for IL-7 in the phenotypic differentiation and proliferation of early pro-B cells. These results are consistent with the observation that IL-3 can substitute for IL-7 in supporting pro-B cell production in vitro (13). Nonetheless, we cannot exclude the possibility that IL-7 normally functions to stimulate the proliferation of pre-pro-B cells and pro-B cells under physiological conditions, especially given our recent description of a heterodimeric form of IL-7 (PPBSF) that selectively induces proliferation of rat pre-pro-B cells in vitro (10, 11). Further support for this possibility is provided by the accumulation of pre-pro-B and pro-B cells in BM of bcl-2 transgenic RAG-1 KO mice in the presence, but not the absence, of a functional IL-7R (20, 48).

Similarly, IL-7 does not appear to be necessary for the induction of D-JH and V-DJH gene rearrangements, which normally are observed in early and late pro-B cells, respectively (40). Indeed, despite the reduction in the number of Fr. B-C cells in IL-7 KO mice, the frequency of V-DJH rearrangement in these cell fractions is normal. This suggests that the proportion of pro-B cells that have completed V-DJH rearrangement is actually higher in IL-7 KO than in wild-type mice, presumably due to blockage of differentiation into early pre-B cells. Furthermore, despite contrary findings in thymocytes (25), IL-7 is not essential for RAG-1 or RAG-2 gene expression in pro-B cells or for {lambda}5 and VpreB surrogate Ig light chain gene expression for the pre-BCR (49, 50).

As IgH rearrangement appears to be normal in pro-B cells from IL-7 KO mice, and transcription of Igµ is detectable, it is likely that IL-7 regulates the expression of Igµ post-transcriptionally. However, we cannot exclude the possibility that IL-7 is essential for the expansion of a minor subset of pre-BCR+ pro-B cells, although such a trophic effect seems unlikely, as {lambda}5 KO mice generate normal levels of cµ+ pro-B cells (51) (Fig. 6Go). This interpretation is consistent with the suggestion that the IL-7R {alpha}-chain can transduce two separate developmental signals, one for cell proliferation and the other for cµ expression (18).

Although the results in the IL-7 KO mouse generally parallel those in the IL-7R{alpha} KO mouse (52), the marked differences in usage of proximal and distal VH families observed in IL-7R{alpha} KO mice were not observed in IL-7 KO mice. This discrepancy may reflect a more complete block in IL-7R{alpha} KO mice of the activities of other cytokines that can signal through the IL-7R{alpha} (e.g., thymic stromal-derived lymphopoietin) (53, 54). It also may reflect different patterns of compensatory cytokines in the two animal models. Nonetheless, a slight reduction in the use of the distal VHJ558 was observed in BM of IL-7 KO mice. One possible explanation is that the decreased expression of TdT in adult IL-7 KO mice, as in wild-type fetal and neonatal mice (55), may favor homologous recombination and thus bias the VH repertoire.

The increased expression of TdT observed during the progression of pre-pro-B cells to pro-B cells in wild-type mice is consistent with results from mRNA and immunofluorescence studies (56, 57). However, the failure of pro-B cells in IL-7 KO mice to express elevated levels of TdT (TdThigh) in the face of elevated mRNA expression requires explanation. Bentolila et al. (58) have identified two isoforms of TdT due to differential splicing: a smaller, active, form in the nucleus, and a larger, inactive, form in the cytoplasm. As the smaller isoform normally is dominant, it is possible that only the larger isoform is expressed in pro-B cells from IL-7 KO mice. If true, this would suggest that IL-7 influences the splicing of TdT, possibly by regulating the expression of one or more transcription factors that bind to the TdT gene (59, 60).

The expression of IL-7R{alpha} also normally increases as BM cells progress from the pre-pro-B cell (IL-7Rlow) through the pro-B cell (IL-7Rhigh) stage. This may help to explain why pre-pro-B cells from wild-type rat (10, 11) and mouse (our unpublished observation) BM fail to proliferate in vitro in response to rIL-7 unless they first are cultured in the presence of an IL-7+/+ BM stromal cell layer or with rIL-7 in the presence of an IL-7-/- stromal cell layer; and why early pro-B cells respond only to superphysiologic levels of IL-7 in vitro (61). It also may help to explain the failure of pro-B cells from IL-7 KO mice (which lack IL-7Rhigh) to proliferate in response to monomeric rIL-7 in the absence of a stromal cell layer (our unpublished observation), although the associated absence of a functional pre-BCR may also contribute (61). We cannot exclude the possibility that instead of (or in addition to) up-regulating the IL-7R{alpha} in wild-type mice, IL-7 selectively expands the IL-7Rhigh population. Nonetheless, our recent demonstration that PPBSF, a stromal cell-derived heterodimeric form of IL-7, can prime pre-pro-B cells to respond to rIL-7 in vitro (10, 11) favors the possibility that physiological concentrations of monomeric IL-7 are unable to transduce effectively a trophic signal in IL-7Rlow cells. This hypothesis is further supported by in vitro culture studies with rIL-7, which indicate that up-regulation of the IL-R{alpha}, as well as TdT and cµ, on pro-B cells requires signaling by IL-7 in association with an additional stromal cell-derived cofactor (C. Wei, L. Lai, and I. Goldschneider, manuscript in preparation). The need for IL-7 itself is formally demonstrated here by in vivo reconstitution studies in IL-7 KO mice.

The common abnormalities observed in IL-7 KO, {gamma}c KO, and Jak3 KO mice are consistent with current models for IL-7 signaling, which propose that dimerization of IL-7R{alpha} and {gamma}c, induced by the binding of IL-7, activates Jak1 and Jak3 of the Janus kinase family, respectively (62, 63, 64). Subsequent phosphorylation of tyrosine residues on the cytoplasmic domain of the IL-7R{alpha} provides docking sites for downstream signaling proteins (65, 66, 67, 68, 69). That these defects do not result simply from the arrested development of Fr. C' cells, is shown by the normal or elevated expression of cµ, TdT, and/or IL-7R{alpha} in {lambda}5 KO and RAG-1 KO mice, whose B cells also arrest between Fr. C and Fr. C'. Our results therefore suggest that signaling through the high affinity form of the IL-7R is required at the late pre-pro-B/early pro-B cell stage of development despite the expression of only low levels of IL-7R{alpha}. However, it remains to be determined whether up-regulation of the expression of IL-7R{alpha}, cµ, and TdT by pro-B cells as well as proliferation of early pre-B cells are regulated separately by individual downstream signals and whether the factor that initiates these events physiologically is the PPBSF heterodimer (10, 11).


    Footnotes
 
1 This work was supported in part by Grant AI32752 from the National Institutes of Health. Back

2 Address correspondence and reprint requests to Dr. Irving Goldschneider, Department of Pathology, School of Medicine, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-3105. E-mail address: Back

3 Abbreviations used in this paper: KO, knockout; BM, bone marrow; B cell, B lymphocyte; cµ, cytoplasmic Ig µ heavy chain; {gamma}c, receptor common {gamma}-chain; FCM, flow immunocytometry; Fr, phenotypic B cell fraction; HSA, heat-stable Ag; IMS, immunomagnetic separation; Jak, Janus kinase; PPBSF, pre-pro-B cell growth-stimulating factor; RAG, recombinase-activating gene; R, receptor; pre-BCR, pre-B cell receptor; {lambda}5 and V pre-B, surrogate Ig light chain components for pre-BCR; sIg, surface immunoglobulin. Back

Received for publication August 9, 1999. Accepted for publication December 9, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Namen, A. E., A. E. Schmierer, C. J. March, R. W. Overell, L. S. Park, D. L. Urdal, D. Y. Mochizuki. 1988. B cell precursor growth-promoting activity. Purification and characterization of a growth factor active on lymphocyte precursors. J. Exp. Med. 167:988.[Abstract/Free Full Text]
  2. Namen, A. E., S. Lupton, K. Hjerrild, J. Wignall, D. Y. Mochizuki, A. Schmierer, B. Mosley, C. J. March, D. Urdal, S. Gillis. 1988. Stimulation of B-cell progenitors by cloned murine interleukin-7. Nature 333:571.[Medline]
  3. Era, T., S. Nishikawa, T. Sudo, F. H. Wang, M. Ogawa, T. Kunisada, S. Hayashi. 1994. How B-precursor cells are driven to cycle. Immunol. Rev. 137:35.[Medline]
  4. Grabstein, K. H., T. J. Waldschmidt, F. D. Finkelman, B. W. Hess, A. R. Alpert, N. E. Boiani, A. E. Namen, P. J. Morrissey. 1993. Inhibition of murine B and T lymphopoiesis in vivo by an anti-interleukin 7 monoclonal antibody. J. Exp. Med. 178:257.[Abstract/Free Full Text]
  5. Peschon, J. J., P. J. Morrissey, K. H. Grabstein, F. J. Ramsdell, E. Maraskovsky, B. C. Gliniak, L. S. Park, S. F. Ziegler, D. E. Williams, C. B. Ware, et al 1994. Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J. Exp. Med. 180:1955.[Abstract/Free Full Text]
  6. von Freeden-Jeffry, U., P. Vieira, L. A. Lucian, T. McNeil, S. E. Burdach, R. Murray. 1995. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. J. Exp. Med. 181:1519.[Abstract/Free Full Text]
  7. Baird, A. M., R. M. Gerstein, L. J. Berg. 1999. The role of cytokine receptor signaling in lymphocyte development. Curr. Opin. Immunol. 11:157.[Medline]
  8. Hardy, R. R., C. E. Carmack, S. A. Shinton, J. D. Kemp, K. Hayakawa. 1991. Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow. J. Exp. Med. 173:1213.[Abstract/Free Full Text]
  9. Sudo, T., S. Nishikawa, N. Ohno, N. Akiyama, M. Tamakoshi, H. Yoshida. 1993. Expression and function of the interleukin 7 receptor in murine lymphocytes. Proc. Natl. Acad. Sci. USA 90:9125.[Abstract/Free Full Text]
  10. McKenna, S. D., F. Chen, L. Lai, I. Goldschneider. 1998. Identification of an IL-7-associated pre-pro-B cell growth-stimulating factor (PPBSF). I. Production of the non-IL-7 component by bone marrow stromal cells from IL-7 gene-deleted mice. J. Immunol. 160:2272.[Abstract/Free Full Text]
  11. Lai, L., F. Chen, S. McKenna, I. Goldschneider. 1998. Identification of an IL-7-associated pre-pro-B cell growth-stimulating factor (PPBSF). II. PPBSF is a covalently linked heterodimer of IL-7 and a Mr 30,000 cofactor. J. Immunol. 160:2280.[Abstract/Free Full Text]
  12. Saffran, D. C., E. A. Faust, O. N. Witte. 1992. Establishment of a reproducible culture technique for the selective growth of B-cell progenitors. Curr. Top. Microbiol. Immunol. 182:37.[Medline]
  13. Winkler, T. H., F. Melchers, A. G. Rolink. 1995. Interleukin-3 and interleukin-7 are alternative growth factors for the same B-cell precursors in the mouse. Blood 85:2045.[Abstract/Free Full Text]
  14. Candeias, S., K. Muegge, S. Durum. 1997. IL-7 receptor and VDJ recombination: trophic versus mechanistic actions. Immunity 6:501.[Medline]
  15. Muegge, K., M. P. Vila, S. K. Durum. 1993. Interleukin-7: a cofactor for V(D)J rearrangement of the T cell receptor ß gene. Science 261:93.[Abstract/Free Full Text]
  16. Oosterwegel, M. A., M. C. Haks, U. Jeffry, R. Murray, A. M. Kruisbeek. 1997. Induction of TCR gene rearrangements in uncommitted stem cells by a subset of IL-7 producing, MHC class-II-expressing thymic stromal cells. Immunity 6:351.[Medline]
  17. Tsuda, S., S. Rieke, Y. Hashimoto, H. Nakauchi, Y. Takahama. 1996. Il-7 supports D-J but not V-DJ rearrangement of TCR-ß gene in fetal liver progenitor cells. J. Immunol. 156:3233.[Abstract]
  18. Corcoran, A. E., F. M. Smart, R. J. Cowling, T. Crompton, M. J. Owen, A. R. Venkitaraman. 1996. The interleukin-7 receptor {alpha} chain transmits distinct signals for proliferation and differentiation during B lymphopoiesis. EMBO J. 15:1924.[Medline]
  19. Dobbeling, U.. 1996. The influence of IL-7 V(D)J recombination. Immunology 89:569.[Medline]
  20. Maraskovsky, E., J. Peschon, H. McKenna, T. Teepe, A. Strasser. 1998. Overexpression of Bcl-2 does not rescue impaired B lymphopoiesis in IL-7 receptor-deficient mice but can enhance survival of mature B cells. Int. Immunol. 10:1367.[Abstract/Free Full Text]
  21. Kondo, M., K. Akashi, J. Domen, K. Sugamura, I. L. Weissman. 1997. Bcl-2 rescues T lymphopoiesis, but not B or NK cell development, in common gamma chain-deficient mice. Immunity 7:155.[Medline]
  22. Candeias, S., J. Peschon, K. Muegge, S. Durum. 1997. Defective T-cell receptor {gamma} gene rearrangement in interleukin-7 receptor knockout mice. Immunol. Lett. 57:9.[Medline]
  23. Maki, K., S. Sunaga, K. Ikuta. 1996. The V-J recombination of T cell receptor-{gamma} genes is blocked in interleukin-7 receptor-deficient mice. J. Exp. Med. 184:2423.[Abstract/Free Full Text]
  24. Perumal, N. B., Jr T. W. Kenniston, D. J. Tweardy, K. F. Dyer, R. Hoffman, J. Peschon, P. M. Appasamy. 1997. TCR-{gamma} genes are rearranged but not transcribed in IL-7R {alpha}-deficient mice. J. Immunol. 158:5744.[Abstract]
  25. Crompton, T., S. V. Outram, J. Buckland, M. J. Owen. 1997. A transgenic T cell receptor restores thymocyte differentiation in interleukin-7 receptor {alpha} chain-deficient mice. Eur. J. Immunol. 27:100.[Medline]
  26. DiSanto, J. P., D. Guy-Grand, A. Fisher, A. Tarakhovsky. 1996. Critical role for the common cytokine receptor {gamma} chain in intrathymic and peripheral T cell selection. J. Exp. Med. 183:1111.[Abstract/Free Full Text]
  27. Akashi, K., M. Kondo, U. von Freeden-Jeffry, R. Murray, I. Weissman. 1997. Bcl-2 rescues T lymphopoiesis in interleukin-7 receptor-deficient mice. Cell 89:1033.[Medline]
  28. Maraskovsky, E., L. A. O’Reilly, M. Teepe, L. M. Corcoran, J. J. Peschon, A. Strasser. 1997. Bcl-2 can rescue T lymphocyte development in interleukin-7 receptor-deficient mice but not in mutant rag-1-/- mice. Cell 89:1011.[Medline]
  29. Cao, X., E. Shores, J. Hu-Li, M. Anver, B. Kelsall, S. Russell, J. Drago, M. Noguchi, A. Grinberg, E. Bloom, et al 1995. Defective lymphoid development in mice lacking expression of the common cytokine receptor {gamma} chain. Immunity 2:223.[Medline]
  30. DiSanto, J. P., W. Muller, D. Guy-Grand, A. Fischer, K. Rajewsky. 1995. Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor {gamma} chain. Proc. Natl. Acad. Sci. USA 92:377.[Abstract/Free Full Text]
  31. Nosaka, T., J. van Deursen, R. Tripp, W. Thierfelder, B. Witthuhn, A. McMickle, P. Doherty, G. Grosveld, J. Ihle. 1995. Defective lymphoid development in mice lacking Jak3. Science 270:800.[Abstract/Free Full Text]
  32. Thomis, D. C., C. B. Gurniak, E. Tivol, A. H. Sharpe, L. J. Berg. 1995. Defects in B lymphocyte maturation and T lymphocyte activation in mice lacking Jak3. Science 270:794.[Abstract/Free Full Text]
  33. Park, S., K. Saijo, T. Takahashi, M. Osawa, H. Arase, N. Hirayama, K. Miyake, H. Nakauchi, T. Shirasawa, T. Saito. 1995. Developmental defects of lymphoid cells in Jak3 kinase-deficient mice. Immunity 3:771.[Medline]
  34. Rolink, A., U. Grawunder, T. H. Winkler, H. Karasuyama, F. Melchers. 1994. IL-2 receptor alpha chain (CD25, TAC) expression defines a crucial stage in pre-B cell development. Int. Immunol. 6:1257.[Abstract/Free Full Text]
  35. Toba, K., E. F. Winton, T. Koike, A. Shibata. 1995. Simultaneous three-color analysis of the surface phenotype and DNA-RNA quantitation using 7-actinomycin D and pyronin Y. J. Immunol. Methods 182:193.[Medline]
  36. Ehlich, A., S. Schaal, H. Gu, D. Kitamura, W. Muller, K. Rajewsky. 1993. Immunoglobulin heavy and light chain genes rearrange independently at early stages of B cell development. Cell 72:695.[Medline]
  37. Li, Y., K. Hayakawa, R. Hardy. 1993. The regulated expression of B lineage associated genes during B cell differentiation in bone marrow and fetal liver. J. Exp. Med. 178:951.[Abstract/Free Full Text]
  38. Levinson, D. A., J. Campos-Torres, P. Leder. 1993. Molecular characterization of transgene-induced immunodeficiency in B-less mice using a novel quantitative limiting dilution polymerase chain reaction method. J. Exp. Med. 178:317.[Abstract/Free Full Text]
  39. Kofler, R., S. Geley, H. Kofler, A. Helmberg. 1992. Mouse variable-region gene families: complexity, polymorphism and use in non-autoimmune responses. Immunol. Rev. 128:5.[Medline]
  40. Loffert, D., S. Schaal, A. Ehlich, R. R. Hardy, Y. R. Zou, W. Muller, K. Rajewsky. 1994. Early B-cell development in the mouse: insights from mutations introduced by gene targeting. Immunol. Rev. 137:135.[Medline]
  41. Nakajima, H., X. W. Liu, A. Wynshaw-Boris, L. A. Rosenthal, K. Imada, D. S. Finbloom, L. Hennighausen, W. J. Leonard. 1997. An indirect effect of Stat5a in IL-2-induced proliferation: a critical role for Stat5a in IL-2-mediated IL-2 receptor {alpha} chain induction. Immunity 7:691.[Medline]
  42. Noguchi, M., Y. Nakamura, S. M. Russell, S. F. Ziegler, M. Tsang, X. Cao, W. J. Leonard. 1993. Interleukin-2 receptor {gamma} chain: a functional component of the interleukin-7 receptor. Science 262:1877.[Abstract/Free Full Text]
  43. Kondo, M., T. Takeshita, M. Higuchi, M. Nakamura, T. Sudo, S. Nishikawa, K. Sugamura. 1994. Functional participation of the IL-2 receptor {gamma} chain in IL-7 receptor complexes. Science 263:1453.[Abstract/Free Full Text]
  44. Osmond, D.G.. 1991. Proliferation kinetics and the lifespan of B cells in central and peripheral lymphoid organs. Curr. Opin. Immunol. 3:179.[Medline]
  45. Melchers, F., H. Karasuyama, D. Haasher, S. Bauer, A. Kudo, N. Sakaguchi, B. Jameson, A. Rolink. 1993. The surrogate light chain in B-cell development. Immunol. Today 14:60.[Medline]
  46. Lu, L., P. Chaudhury, D. G. Osmond. 1999. Regulation of cell survival during B lymphopoiesis: apoptosis and Bcl- 2/Bax content of precursor B cells in bone marrow of mice with altered expression of IL-7 and recombinase-activating gene-2. J. Immunol. 162:1931.[Abstract/Free Full Text]
  47. von Freeden-Jeffry, U., N. Solvason, M. Howard, R. Murray. 1997. The earliest T lineage-committed cells depend on IL-7 for Bcl-2 expression and normal cell cycle progression. Immunity 7:147.[Medline]
  48. Tarlinton, D., L. Corcoran, A. Strasser. 1997. Continued differentiation during B lymphopoiesis requires signals in addition to cell survival. Int. Immunol. 9:1481.[Abstract/Free Full Text]
  49. Tsubata, T., M. Reth. 1990. The products of pre-B cell-specific genes ({lambda}5 and VpreB) and the immunoglobulin µ chain form a complex that is transported onto the cell surface. J. Exp. Med. 172:973.[Abstract/Free Full Text]
  50. Karasuyama, H., A. Kudo, F. Melchers. 1990. The proteins encoded by the VpreB and {lambda} 5 pre-B cell-specific genes can associate with each other and with µ heavy chain. J. Exp. Med. 172:969.[Abstract/Free Full Text]
  51. ten Boekel, E., F. Melchers, A. G. Rolink. 1997. Changes in the V(H) gene repertoire of developing precursor B lymphocytes in mouse bone marrow mediated by the pre-B cell receptor. Immunity 7:357.[Medline]
  52. Corcoran, A. E., A. Riddell, D. Krooshoop, A. R. Venkitaraman. 1998. Impaired immunoglobulin gene rearrangement in mice lacking the IL-7 receptor. Nature 391:904.[Medline]
  53. Ray, R. J., C. Furlonger, D. E. Williams, C. J. Paige. 1996. Characterization of thymic stromal-derived lymphopoietin (TSLP) in murine B cell development in vitro. Eur. J. Immunol. 26:10.[Medline]
  54. Park, L., R. Paxton, P. Morrissey, J. Peschon, U. Martin, K. Garka, D. Foxworthe, B. Gliniak, C. Ware, S. Friend, et al 1993. Molecular cloning of a novel lymphoid growth factor defines a new IL-7 receptor family. Exp. Hematol. 21:5744.
  55. Marshall, A. J., N. Doyen, L. A. Bentolila, C. J. Paige, G. E. Wu. 1998. Terminal deoxynucleotidyl transferase expression during neonatal life alters DH reading frame usage and Ig-receptor-dependent selection of V regions. J. Immunol. 161:6657.[Abstract/Free Full Text]
  56. Wasserman, R., Y. S. Li, R. R. Hardy. 1997. Down-regulation of terminal deoxynucleotidyl transferase by Ig heavy chain in B lineage cells. J. Immunol. 158:1133.[Abstract]
  57. Lu, L., G. Smithson, P. Kincade, D. Osmond. 1998. Two models of murine B lymphopoiesis: a correlation. Eur. J. Immunol. 28:1755.[Medline]
  58. Bentolila, L., M. Fanton d’Andon, Q. Nguyen, O. Martinez, F. Rougeon, N. Doyen. 1995. The two isoforms of mouse terminal deoxynucleotidyl transferase differ in both the ability to add N regions and subcellular localization. EMBO J. 14:4221.[Medline]
  59. Ernst, P., K. Hahm, S. T. Smale. 1993. Both LyF-1 and an Ets protein interact with a critical promoter element in the murine terminal transferase gene. Mol. Cell. Biol. 13:2982.[Abstract/Free Full Text]
  60. Georgopoulos, K., D. D. Moore, B. Derfler. 1992. Ikaros, an early lymphoid-specific transcription factor and a putative mediator for T cell commitment. Science 258:808.[Abstract/Free Full Text]
  61. Marshall, A. J., H. E. Fleming, G. E. Wu, C. J. Paige. 1998. Modulation of the IL-7 dose-response threshold during pro-B cell differentiation is dependent on pre-B cell receptor expression. J. Immunol. 161:6038.[Abstract/Free Full Text]
  62. Leonard, W. J., J. J. O’Shea. 1998. Jaks and STATs: biological implications. Annu. Rev. Immunol. 16:293.[Medline]
  63. Ihle, J. N., B. A. Witthuhn, F. W. Quelle, K. Yamamoto, O. Silvennoinen. 1995. Signaling through the hematopoietic cytokine receptors. Annu. Rev. Immunol. 13:369.[Medline]
  64. O’Shea, J., L. Notarangelo, J. Johnston, F. Candotti. 1997. Advances in the understanding of cytokine signal transduction: the role of Jaks and STATs in immunoregulation and the pathogenesis of immunodeficiency. J. Clin. Immunol. 17:431.[Medline]
  65. Lin, J., T. Migone, M. Tsang, M. Friedmann, J. Weatherbee, L. Zhou, A. Yamauchi, E. Bloom, J. Mietz, S. John. 1995. The role of shared receptor motifs and common Stat proteins in the generation of cytokine pleiotropy and redundancy by IL-2, IL-4, IL-7, IL-13, and IL-15. Immunity 2:331.[Medline]
  66. Venkitaraman, A., R. Cowling. 1994. Interleukin-7 induces the association of phosphatidylinositol 3-kinase with the alpha chain of the interleukin-7 receptor. Eur. J. Immunol. 24:2168.[Medline]
  67. Page, T., F. Lali, B. Foxwell. 1995. Interleukin-7 activates p56lck and p59fyn, two tyrosine kinases associated with the p90 interleukin-7 receptor in primary human T cells. Eur. J. Immunol. 25:2956.[Medline]
  68. van der Plas, D. C., F. Smiers, K. Pouwels, L. H. Hoefsloot, B. Lowenberg, I. P. Touw. 1996. Interleukin-7 signaling in human B cell precursor acute lymphoblastic leukemia cells and murine BAF3 cells involves activation of STAT1 and STAT5 mediated via the interleukin-7 receptor {alpha} chain. Leukemia 10:1317.[Medline]
  69. Seckinger, P., M. Fougereau. 1994. Activation of Src family kinases in human pre-B cells by IL-7. J. Immunol. 153:97.[Abstract]



This article has been cited by other articles:


Home page
Cancer Res.Home page
V. I. Brown, J. Hulitt, J. Fish, C. Sheen, M. Bruno, Q. Xu, M. Carroll, J. Fang, D. Teachey, and S. A. Grupp
Thymic Stromal-Derived Lymphopoietin Induces Proliferation of Pre-B Leukemia and Antagonizes mTOR Inhibitors, Suggesting a Role for Interleukin-7R{alpha} Signaling
Cancer Res., October 15, 2007; 67(20): 9963 - 9970.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Feng, H. Wang, and H. C. Morse III
Functional Deficiency in IL-7 Caused by an N-Ethyl-N-nitrosourea-Induced Point Mutation
Genetics, February 1, 2007; 175(2): 545 - 551.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. Wen, Y. Chen, L. Bai, G. Fu, J. Schuman, X. Dai, H. Zeng, C. Yang, R. P. Stephan, J. L. Cleveland, et al.
Essential Role of Phospholipase C{gamma}2 in Early B-Cell Development and Myc-Mediated Lymphomagenesis
Mol. Cell. Biol., December 15, 2006; 26(24): 9364 - 9376.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Fujimura, Y. Xing, M. Takeya, Y. Yamashita, K. Ohshima, K. Kuwahara, and N. Sakaguchi
Increased Expression of Germinal Center-Associated Nuclear Protein RNA-Primase Is Associated with Lymphomagenesis
Cancer Res., July 1, 2005; 65(13): 5925 - 5934.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Sakaguchi, T. Kimura, S. Matsushita, S. Fujimura, J. Shibata, M. Araki, T. Sakamoto, C. Minoda, and K. Kuwahara
Generation of High-Affinity Antibody against T Cell-Dependent Antigen in the Ganp Gene-Transgenic Mouse
J. Immunol., April 15, 2005; 174(8): 4485 - 4494.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
P. M. Oliver, M. Wang, Y. Zhu, J. White, J. Kappler, and P. Marrack
Loss of Bim Allows Precursor B Cell Survival But Not Precursor B Cell Differentiation in the Absence of Interleukin 7
J. Exp. Med., November 1, 2004; 200(9): 1179 - 1187.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. I. Brown, J. Fang, K. Alcorn, R. Barr, J. M. Kim, R. Wasserman, and S. A. Grupp
Rapamycin is active against B-precursor leukemia in vitro and in vivo, an effect that is modulated by IL-7-mediated signaling
PNAS, December 9, 2003; 100(25): 15113 - 15118.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. C. Otero and R. C. Rickert
CD19 Function in Early and Late B Cell Development. II. CD19 Facilitates the Pro-B/Pre-B Transition
J. Immunol., December 1, 2003; 171(11): 5921 - 5930.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S.-K. Lee, J. F. Kalinowski, S. L. Jastrzebski, L. Puddington, and J. A. Lorenzo
Interleukin-7 Is a Direct Inhibitor of in Vitro Osteoclastogenesis
Endocrinology, August 1, 2003; 144(8): 3524 - 3531.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. R. Dillon and M. S. Schlissel
Partial restoration of B cell development in Jak-3-/- mice achieved by co-expression of IgH and E{micro}-myc transgenes
Int. Immunol., August 1, 2002; 14(8): 893 - 904.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Tsuruyama, T. Nakamura, G. Jin, M. Ozeki, Y. Yamada, and H. Hiai
Constitutive activation of Stat5a by retrovirus integration in early pre-B lymphomas of SL/Kh strain mice
PNAS, June 11, 2002; 99(12): 8253 - 8258.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. J. Fry and C. L. Mackall
Interleukin-7: from bench to clinic
Blood, May 13, 2002; 99(11): 3892 - 3904.
[Full Text] [PDF]


Home page
JEMHome page
T. L. Carvalho, T. Mota-Santos, A. Cumano, J. Demengeot, and P. Vieira
Arrested B Lymphopoiesis and Persistence of Activated B Cells in Adult Interleukin 7-/- Mice
J. Exp. Med., October 15, 2001; 194(8): 1141 - 1150.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Lai and I. Goldschneider
Cutting Edge: Identification of a Hybrid Cytokine Consisting of IL-7 and the {beta}-Chain of the Hepatocyte Growth Factor/Scatter Factor
J. Immunol., October 1, 2001; 167(7): 3550 - 3554.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. A. Martinez-M., S. Minguet, P. Gonzalo, P. G. Soro, B. de Andres, A. Izcue, M. A. R. Marcos, and M.-L. Gaspar
Long-lived polyclonal B-cell lines derived from midgestation mouse embryo lymphohematopoietic progenitors reconstitute adult immunodeficient mice
Blood, September 15, 2001; 98(6): 1862 - 1871.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Kouro, K. L. Medina, K. Oritani, and P. W. Kincade
Characteristics of early murine B-lymphocyte precursors and their direct sensitivity to negative regulators
Blood, May 1, 2001; 97(9): 2708 - 2715.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wei, C.
Right arrow Articles by Goldschneider, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wei, C.
Right arrow Articles by Goldschneider, I.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Stem Cells


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS