| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
, Terminal Deoxynucleotidyltransferase, and cµ Expression1
Department of Pathology, University of Connecticut Health Center, Farmington, CT 06030
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
5, and VpreB. However, upon closer
inspection, several abnormalities in pro-B cell development were
identified that could be corrected by injection of rIL-7 in vivo. These
included the absence of the subset of late pro-B cells that initiates
cµ expression for pre-B cell Ag receptor (BCR) formation, and the
failure of pro-B cells to up-regulate TdT and the IL-7R
(but not the
common 
-chain) chain. Similar defects were present in common
-chain and Jak3 KO mice, but not in 5 or (excluding cytoplasmic
Ig µ heavy chain (cµ)) RAG-1 KO mice, all of which also arrest at
the late pro-B cell stage. Consequently, up-regulation of TdT and
IL-7R expression requires signaling through the high affinity IL-7R,
but does not require cµ expression or a functional pre-BCR. Taken
together, these results suggest that IL-7 and its receptor complex are
essential for 1) up-regulating the expression of TdT and IL-7R, 2)
initiating the production of cµ, and 3) promoting the formation of a
functional pre-BCR in/on pro-B cells. These key events, in turn, appear
to be prerequisite both for differentiation of pro-B cells to pre-B
cells and for proliferation of these cell subsets upon continued
stimulation with IL-7. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and IL-7 gene-deleted knockout
(KO)3 (3)
mice (5, 6). However, knowledge of the exact functions of
IL-7 in regulating the survival, proliferation, and/or differentiation
of B-lineage cells at different stages of development in bone marrow
(BM) is incomplete and somewhat contradictory (7). For
example, Hardy et al. (8) reported that freshly explanted
BM pre-B cells, unlike pre-B cells from long term cultures, do not
respond to rIL-7 even through the IL-7R is expressed
(9). Furthermore, pro-B cells were found to respond to
rIL-7 in a cell contact-dependent manner, whereas the response of
pre-pro-B cells was minimal. We have recently provided a possible
explanation for this latter phenomenon by describing an heterodimeric
form of IL-7 (PPBSF) that selectively stimulates the proliferation of
pre-pro-B cells in vitro and primes their progeny to respond to
monomeric IL-7 (10, 11). In contrast, Saffran et al.
(12) reported that pro-B cells can be generated in long
term culture in the absence of IL-7, and Winkler et al.
(13) demonstrated that IL-3 can substitute for IL-7 in the
generation of pro-B cells in vitro. These latter two studies are
consistent with the observation that B cell development progresses
through the pro-B cell stage in IL-7 KO mice (6), but not
with the observations that B cell development is blocked at the
pre-pro-B cell stage in IL-7R KO mice and in anti-IL-7 Ab-treated
mice (4, 5).
The function of IL-7 in the rearrangement of Ag receptor genes in B and
T cells has been studied extensively in vitro (reviewed in Ref.
14). However, the results are inconclusive, due in large
part to difficulties in distinguishing mechanistic from trophic effects
on the rearrangement process (15, 16, 17). Studies of the
function of IL-7 on IgH rearrangement have focused on the generation of
pre-B cells in vitro by BM cells from IL-7R KO mice. Restoration of
pre-B cell production was observed when the IL-7R was reintroduced
by means of retroviral transfection (18), and distinct
signals for proliferation and differentiation were identified when the
transfected IL-7R was mutated or swapped with the cytoplasmic domain
of IL-2Rß. In contrast, rIL-7 was found to reduce the rearrangement
of an artificial VDJ recombination substrate in a cultured pre-B cell
line (19). Moreover, introduction of a bcl-2
transgene in IL-7R-deficient mice or common -chain
(c)-deficient mice (c is a component of the high affinity IL-7R)
did not restore B cell development (20, 21).
TCR gene rearrangement among developing thymocytes has also been
studied in IL-7R KO mice. The results showed normal rearrangement of
the TCRß gene, but were inconsistent regarding the TCR gene
(22, 23, 24). Furthermore, although a functional TCRß
transgene resulted in the development of double-positive and
single-positive thymocytes, their numbers were markedly reduced
(25, 26). Most importantly, a bcl-2 transgene
was able to completely restore T cell development in IL-7R KO mice
(27, 28), thereby convincingly arguing against an
instructive function for IL-7 in TCR gene rearrangement. These results
in aggregate suggest that IL-7 (and/or the IL-7R) may have somewhat
different functions in B cell and T cell development.
In this study we have conducted phenotypic, cell cycle, and IgH gene
rearrangement studies on BM cells from IL-7 KO mice as well as from
c and Jak3 KO mice to more precisely define the role of IL-7 in
early B cell development. The results indicate that IL-7 is required
for both the proliferation and differentiation of early pre-B cells,
but not for the proliferation or phenotypic differentiation of
pre-pro-B cells to pro-B cells or for IgH gene rearrangement.
Nonetheless, the results clearly indicate that both IL-7 and its
receptor complex are essential to up-regulate the expression of
IL-7R, TdT, and cµ at the early and/or late pro-B cell stages.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Breeding pairs of IL-7 KO, c KO, and Jak3 KO mice (6, 29, 30, 31, 32, 33) were provided by Drs. Richard Murray (DNAX Research
Institute of Molecular and Cellular Biology, Palo Alto, CA), Warren
Leonard (Laboratory of Molecular Immunology, National Heart, Lung, and
Blood Institute, National Institutes of Health, Bethesda, MD), and
James Ihle (Department of Biochemistry, St. Jude Children’s Research
Hospital, Memphis, TN), respectively. RAG-1 KO mice and 5 KO mice
were generous gifts from Dr. Michel Nussenzweig (Laboratory of
Molecular Immunology, Rockefeller University, New York, NY). Male and
female progeny were raised in an isolated microenvironment in our
animal care facility and were used at 5–9 wk of age.
IL-7+/+ mice were used as controls in most
experiments, as were wild-type C57BL/6 and BALB/C mice (National Cancer
Institute, Charles River, MD). No significant differences were observed
between the IL-7+/+ and wild-type animals.
Antibodies
FITC-, PE-, or biotin-conjugated rat mAbs against mouse B220
(RA3-6B2), HSA (M1/69), CD43 (S7), BP-1, CD5 (53-7.3), c (TUGm2),
and CD25 (7D4) Ags were purchased from PharMingen (San Diego, CA).
Tricolor-conjugated rat anti-mouse B220 mAb (RA3-6B2) was purchased
from Caltag (Burlingame, CA). Polyclonal rabbit anti-TdT and
FITC-conjugated goat anti-rabbit IgG were purchased from Supertechs
(Bethesda, MD). Biotin-conjugated and FITC-conjugated polyclonal rat
anti-mouse IgM(µ) were purchased from Serotec (Kidlington,
Oxford, U.K.). A7R34 (anti-IL-7R) mAb was provided by Dr.
Shin-Ichi Nishikawa (Department of Molecular Genetics, Faculty of
Medicine, Kyoto University, Japan). Streptavidin-Red 670 was purchased
from Life Technologies (Grand Island, NY).
Flow immunocytometric analysis (FCM) and cell sorting
Femoral BM cells were collected by flushing with ice-cold RPMI 1640 (Life Technologies). Red blood cells were lysed with 0.165 M NH4Cl for 2 min at room temperature. Samples were washed and suspended with staining medium (PBS plus 1% BSA and 0.1% NaN3). Single-cell suspensions were made by pipetting and filtering through a nylon cloth.
One million cells per well were incubated with 20 µl of pretitrated
Abs in 96-well plates (Costar, Cambridge, MA) for 30 min at 4°C. For
two- or three-color staining, cells were incubated with Abs
sequentially and washed twice with staining medium after each
incubation. Biotin-conjugated Abs were developed by incubation with
streptavidin-Red 670. Samples applied to a FACScan or FACScaliber flow
cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA) were
activated with a single argon ion laser (488 nm). The instrument was
calibrated with dye-conjugated beads, and each channel was compensated
with single-color cell samples before acquisition. Dead cells and
debris were excluded, and lymphocytes were gated on the basis of
forward and side scatter. A total of 40,000 events for each sample were
acquired and analyzed with CellQuest (Becton Dickinson Immunocytometry
Systems). Isotype-matched rat mAbs of unknown specificity were used as
negative controls for IL-7R and c staining, and PBS was used as a
negative control for autofluorescence.
For cµ staining, cells were fixed with 2% paraformaldehyde for 30 min at 4°C followed by permeabilization with 0.2% Tween-20 for 30 min at room temperature in the dark. Cells were then stained with FITC-anti-IgM(µ) for 30 min at 4°C. TdT staining was conducted at 4°C. Cells were fixed with 1% paraformaldehyde for 5 min, permeabilized with 70% methanol for 30 min, blocked with normal goat serum for 30 min, and incubated with rabbit anti-TdT and FITC-goat anti-rabbit IgG as previously described (34).
To sort early B-lineage cells, 2–3 x 107 BM cells stained with FITC-B220 and PE-CD43 Abs were applied to a FACStar Plus cell sorter (Becton Dickinson Immunocytometry Systems) at 4°C. Reanalysis of sorted cells showed purities of >95% for B220+CD43+ cells from both IL-7 KO and wild-type mice, with <0.5% contamination with CD43- B cells.
Immunomagnetic cell separation (IMS)
BM cells from IL-7 KO and wild-type mice were stained with biotin-anti- IgM(µ) Ab, and 1 x 108 cells in 900 µl of PBS plus 0.1% NaN3 were incubated for 15 min at 4°C with 100 µl of streptavidin microbeads (Miltenyi Biotec, Sunnyvale, CA). The cell suspension was then applied to a prefilled and washed MACS magnetic column. A 25-gauge needle was used to control the flow speed. The cells in the effluent and subsequent 3 ml of medium wash, collected as the sIgM- fraction, were stained for B220 and CD43, and phenotyped by FCM analysis. The sIgM+ B cells were completely depleted by this procedure, whereas, cµ+ pre-B cells were not affected.
Phenotypic classification of B-lineage cells
Three-color FCM analysis of BM B-lineage cell fraction was
performed according to the definition given by Hardy et al.
(8). Briefly, BM cells were stained for B220 and CD43.
Double-positive cells were further stained for HSA. Fr. A, B-C, and C'
cells were identified as HSA-,
HSAlow, and HSAhigh,
respectively. To determine Fr. C cells, the
B220+CD43+ fraction was
further stained for BP-1. Fr. A-B and C-C' were defined as
BP-1- and BP-1+
respectively. Thus, as shown in Table I
,
Fr. C was calculated by subtraction of Fr. C' from Fr. C-C', and Fr. B
was calculated by subtraction of Fr. C from Fr. B-C. To determine Fr.
D-F, B220+CD43- cells were
stained for sIgM. Fr. D was defined as sIgM-,
while Fr. E and F were defined as sIgM+. Fr. F
was separated from Fr. E by its higher expression of B220.
|
For total DNA staining, BM cells were first incubated with FITC-B220 and PE-CD43 Abs and fixed overnight at 4°C with 1 ml of 70% ethanol added drop by drop to 100 µl of cell suspension while vortexing. The cells were then incubated with 25 µg of 7-aminoactinomycin D (35) (Molecular Probes, Eugene, OR) in 1 ml of medium for 4 h at room temperature, and analyzed by FCM immediately after washing, using a doublet discrimination module. Cell cycle analysis was performed using the ModFit LT program (Becton Dickinson Immunocytometry Systems).
PCR analysis of IgH rearrangements
PCR conditions and primers were adapted from published procedures (36, 37, 38). Briefly 2 x 105 purified B220+CD43+ BM cells pooled from five mice were pelleted, washed, and resuspended in 100 µl of PCR buffer (10 mM Tris-HCl (pH 8.3 at 25°C), 50 mM KCl, 2.5 mM MgCl2, and 100 µg/ml gelatin). Samples were digested with proteinase K (40 µg/ml; Roche, Indianapolis, IN) at 50°C for 2 h and subsequently, at 90°C for 10 min. The PCR reaction was performed in a total volume of 50 µl containing 5 µl of sample cells, 200 µM each of four deoxynucleotide triphosphates, 15 pmol of primers, and 5 U of Taq polymerase (Life Technologies). PCR was run on a Programmable Thermal Controller PTC-100 (MJ Research, Watertown, MA). Cycles consisting of 1 min at 95°C, 1 min at 65°C, and 2.5 min at 72°C were repeated 26 times. After the last cycle, samples were incubated for an additional 10 min at 72°C. Primers used for PCR were as follows: 5'-Thy-1-CCATCCAGCATGAGTTCAGC, 3'-Thy-1-CTTGACCAGCTTGTCTGTGG; 5'-DH-ACAAGCTTCAAAGCACAATGCCTGGCT, 3'-JH4-CTCTCAGCCGGCTCCCTCAGGG; 5'-VH7183-GCAGCTGGTGGAGTCTGG; 5'-VHQ52-TCCAGACTGAGCATCAGCAA; and 5'-VHJ558-CAGGTCCAACTGCAGCAG.
For Southern blotting, PCR products were separated by 1.5% agarose gel electrophoresis and blotted onto a Gene Screen transfer membrane (DuPont, Boston, MA). Filters were UV cross-linked for 2 min, prehybridized for 1 h, and then hybridized overnight at 60°C. Membranes were washed twice for 30 min each time in 1x SSC at 60°C and imaged on x-ray film (Eastman Kodak, Rochester, NY). The following 32P-labeled oligonucleotides were used for identification of PCR products on Southern blots: JH4 oligo (detection of D-JH and V-DJH rearrangements), CCTGAGGAGACGGTGACTGAGGTTCCTTG; and Thy-1 oligo, CGAGAGAAGAGGAAGCACGTGCTCTCAGG.
To quantify D-JH and V-DJH rearrangements, serial 2-fold dilutions of digested cells were used for PCR reactions. PCR products were then slot blotted onto membranes, and the intensity of amplification was determined by PhosphorImager (Molecular Dynamics, Sunnyvale, CA). The intensities of D-JH and V-DJH amplifications were then plotted against the intensity of Thy-1 amplification.
RT-PCR assay
mRNA was purified with the QuickPrep Micro mRNA Purification Kit
(Pharmacia, Piscataway, NJ) in 200 µl of elution buffer according to
the protocol provided by the manufacturer. Twenty microliters of the
mRNA was reverse transcribed to single-stranded cDNA in 40 µl using
the RT system (Promega, Madison, WI) at 42°C for 1 h. Initially,
mRNA was isolated from 1 x 105 purified
B220+CD43+ BM cells.
However, due to the low efficiency of mRNA recovery and gene
expression, subsequent RT PCR was not successful even with BM from
wild-type mice. Therefore, mRNA purified from 1 x
107 unsorted BM cells pooled from five mice was
used for RT-PCR analysis of RAG-1, RAG-2, TdT, VpreB, and 5 genes.
To detect the transcripts for Igµ in BM, immunomagnetic beads were
used to deplete sIgM+ B cells. The amplification
of ß-actin was used as an internal control for the amount of mRNA in
each PCR reaction. The level of expression of each gene was estimated
by determining the intensity of amplification (data not shown). Serial
2-fold dilutions of purified mRNA were used to ensure that the
amplification was in the linear range (data not shown).
RT-PCR conditions and primers were adapted from the literature
(37). Briefly, 5 µl of the cDNA was added to the PCR
reaction, as before. PCR cycles consisting of 30 s at 95°C,
30 s at 53°C (for RAG-1) or 55°C (for VpreB and 5) or
65°C (for cµ), and 45 s at 72°C were repeated 30 times. PCR
cycles used for actin, TdT, and RAG-2 were as follows: 30 s at
95°C, 30 s at 62°C (for the first five cycles) or 58°C (for
the final 25 cycles), and 45 s at 72°C. After the last cycle,
the reactions were held at 72°C for another 10 min. The primers used
were as follows: actin, 5'- CCTAAGGCCAACCGTGAAAAG,
3'-TCTTCATGGTGCTAGGAGCCA; TdT, 5'- GAAGATGGGAACAACTCGAAGAG,
3'-CAGGTGCTGGAACATTCTGGGAG; 5, 5'-CTTGAGGGTCAATGAAGCTCAGA,
3'-CTTGGGCTGACCTAGGATTG; VpreB, 5'-CGTCTGTCCTGCTCATGCT,
3'-ACGGCACAGTAATACACAGCC; RAG-1, 5'-TGCAGACATTCTAGCACTCTGG,
3'-ACATCTGCCTTCACGTCGAT; and RAG-2, 5'-CACATCCACAAGCAGGAAGTACAC,
3'-TCCCTCGACTATACACCACGTCAA.
For Igµ transcripts, the same 5'-oligos for V-DJH rearrangement were
used, whereas the 3'-oligo used was CGAGGGGGAAGACATTTGGGAAGGA. The
following 32P-labeled oligonucleotides probes
were used to identify the specificity of the PCR reactions: actin,
oligo-TCTGGTGGTACCACCATGTAC; RAG-1, oligo-CTCATTGCCAGGATTTTCCG;
TdT, oligo-TGAATAGAAACTCCTCCCCGAGT,
RAG-2-oligo-AGATGTCCCTGAACCCAGATACGG; 5,
oligo-TGGTATGTCTTTGGTGGTGG; and VpreB, oligo-GCATCTCTGAACTGCAGCCT.
JH4 oligo was used to identify Igµ transcripts. Southern blot
conditions were the same as those described above.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B cell development in BM of IL-7 KO mice has been shown to be
blocked at some point between the pro-B cell and pre-B cell stages
(6). To more precisely define the stage of maturation
arrest, individual fractions of
B220+CD43+ B-lineage cells
were analyzed by FCM according to the relative expression of HSA. The
results presented in Fig. 1 revealed
normal proportions of pre-pro-B cells (Fr. A) in BM of IL-7 KO mice, an
approximately 30% reduction of pro-B cells (Fr. B-C), and an almost
complete absence of cells in transition between pro-B cells and pre-B
cells (Fr. C'). Similar analyses for the expression of BP-1 and CD25
revealed normal proportions of pre-pro-B cells and early pro-B cells
(Fr. A-B), and a 2.2-fold decrease in late pro-B cells and transitional
cells (Fr. C-C') in IL-7 KO mice.
|
shows the absolute numbers of developing B-lineage cells per
femur in wild-type and IL-7 KO mice. Collectively, the number of
pre-pro-B cells (Fr. A) in BM of IL-7 KO mice is normal; early and late
pro-B cells (Fr. B-C) are reduced about 30%; transitional pro-B cells
(Fr. C'), pre-B cells (Fr. D), and immature B cells (Fr. E) are almost
absent; and mature B cells (Fr. F) are reduced approximately
7.5-fold. Proliferation of pre-pro-B and pro-B cells from IL-7 KO mice
To determine whether IL-7 is required to maintain the
proliferative fraction of pre-pro-B and/or pro-B cells, the percentages
of B220+CD43+ cells in S
and G2/M were determined by DNA analysis of BM from IL-7 KO mice. In
preliminary experiments the proportion of cycling cells was reduced
2-fold in IL-7 KO mice compared with that in wild-type controls, and
the proportion of apoptotic (subG1) cells was increased 6.3-fold (data
not shown). However, as shown in Fig. 2,
when Fr. C' was excluded from analysis, the percentages of pre-pro-B
cells (Fr. A) and pro-B cells (Fr. B-C) in S and G2/M did not differ
significantly between IL-7 KO and wild-type mice. In addition, the
proportions of apoptotic cells in Fr. A-C differed by only 2.7-fold
(3.2 vs 1.2%).
|
Despite the arrest in B cell development before the pre-B cell
stage, both D-JH and V-DJH rearrangements of the IgH gene were readily
detected by PCR among Fr. A-C BM cells from IL-7 KO mice (Fig. 3A). PCR for DJH
rearrangements generated four bands of about 1880, 1560, 1190, and 620
bp, representing DJH1, DJH2, DJH3, and DJH4, respectively. PCR for VDJH
rearrangements using three VH primers generated
eight bands, two each representing JH1, JH2, JH3, and JH4. Of these,
the 1720-, 1410-, 1030-, and 450-bp fragments represent rearrangements
of both VH7183 and VHJ558, whereas the 1540-, 1230-, 850-, and 265-bp
fragments represent rearrangements of VHQ52. To resolve the variability
in intensity of these bands, each VH family was
tested separately. The distal VHJ558 family was slightly reduced while
the proximal VH7183 and VHQ52 were normal in BM of IL-7 KO mice (data
not shown). Furthermore, when serially 2-fold diluted cells were used
for the PCR reaction, the frequency of D-JH rearrangement was only
slightly reduced in IL-7 KO mice, and the frequency of V-DJH
rearrangement appeared to be normal (Fig. 3B).
|
, Igµ mRNA expression
(VHJ558 and VHQ52, JH distal and proximal, respectively)
(39) was detected in both wild-type and IL-7 KO mice.
However, the mRNA expression level of Igµ in IL-7 KO mice was about
1/20th of that in wild-type mice. This appears to be explained by the
almost complete absence of Fr. C' and D cells and a 30% reduction in
Fr. B-C cells (Table I). Yet, despite the transcription of Igµ among
the remaining pro-B cells, their expression of cµ was abnormally low
(see below).
|
5 in pro-B
cells from IL-7 KO mice
It has been suggested that IL-7 affects the transcription of RAG-1
and RAG-2 genes (25), which are necessary for Ig gene
rearrangement. However, as shown in Fig. 5, the mRNA levels of RAG-1 and RAG-2,
like the associated IgH gene rearrangements, are only proportionately
reduced in IL-7 KO mice. Even more surprisingly, transcription of the
VpreB and 5 components of the surrogate light chain was found in
IL-7 KO mice, albeit at proportionately reduced mRNA levels.
Furthermore, the mRNA level of TdT, which induces junctional
diversification of the Ig gene, was normal (if not higher) in IL-7 KO
mice compared with that in wild-type mice. Nonetheless, as shown below,
the expression of TdT itself was abnormally low.
|
c KO,
and Jak3 KO mice
As reviewed previously (34, 40), some pro-B cells in
wild-type mice expressed readily detectable cµ (Fig. 6), sufficient to form functional pre-B
cell receptors (pre-BCR). However, despite the expression of mRNA for
Igµ, cµ expression among pro-B cells in IL-7 KO mice was markedly
decreased as both a proportion of total cells and an amount of cµ per
positive cell (Fig. 6). This is consistent with the 30% reduction in
the number of pro-B cells in IL-7 KO mice (Table I; Fr. B-C).
Similarly, the expression level of cµ among pro-B cells in c KO
and Jak3 KO mice was markedly reduced, suggesting that both IL-7 and
its receptor complex are essential for the expression of cµ. However,
cµ expression was normal in pro-B cells from 5 KO mice. Hence, the
arrest in the transition of pro-B cells to pre-B cells in IL-7 KO mice,
as in 5 KO mice, is presumably due to the inability to form a
functional pre-BCR.
|
c KO, and
Jak3 KO mice
For comparative purposes, the expression of TdT at various stages
of B-lineage development was determined by FCM analysis of normal mouse
BM. As shown in Fig. 7, about half of the
cells in the pre-pro-B cell (Fr. A) and pro-B cell (Fr. B-C) fractions
expressed TdT; the former was almost exclusively
TdTlow, and the latter was mostly
TdThigh. Conversely, the transitional cells in
Fr. C' appeared to be mostly TdTlow, and few, if
any, TdT-positive cells were present in Fr. D.-F.
|
), only TdTlow cells were
observed in Fr. A-C from IL-7 KO, c KO, and Jak3 KO mice (Fig. 8). However, the proportion of
TdT-positive cells in Fr. A-C from these mice was normal. Hence,
up-regulation of TdTlow to
TdThigh pro-B cells does not appear to occur in
these mice. This was not true in 5 and RAG-1 KO mice, indicating
that neither the expression of cµ nor the presence of a functional
pre-BCR is required to up-regulate TdT.
|
in pro-B cells from IL-7 KO, c
KO, and Jak3 KO mice
As the expression of receptor often increases upon stimulation by
its ligand (41), we determined the expression level of
IL-7R on pro-B cells from IL-7 KO mice by FCM analysis. For comparative
purposes, the expression of IL-7R at all stages of B cell
development in BM of wild-type mice was similarly determined. As shown
in Fig. 9, two IL-7R-positive
populations can be identified among normal B-lineage cells,
IL-7Rlow and IL-7Rhigh.
Slightly more than half of the pre-pro-B cells (Fr. A) were IL-7R
positive, of which 90% were IL-7Rlow, and almost
90% of pro-B cells (Fr. B-C; and probably of transitional cells in Fr.
C') were IL-7R positive, of which 50% were
IL-7Rhigh. Both the expression level of the
IL-7R (Fr. D) and the proportion of IL-7R-positive cells (Fr. E)
decreased thereafter, such that few mature B cells (Fr. F) were
IL-7R positive. In contrast, 40–70% of all stages of developing B
cells in BM of wild-type mice expressed relatively constant levels of
c, which could associate with the -chain of IL-7R to increase the
affinity of the IL-7R (42, 43).
|
(Fig. 10). However, the proportion of
IL-7Rhigh cells was markedly reduced. Similar
reductions in IL-7Rhigh cells were seen in c
KO and Jak3 KO mice. In contrast, the proportions of
IL-7Rhigh cells in Fr. A-C were markedly
increased in 5 KO and RAG-1 KO mice, mostly due to the accumulation
of pro-B cells in these animals. The only observed change in c
expression was the appearance of a major population of
chigh cells in Fr. A-C from Jak3 KO
mice.
|
in IL-7 KO
mice
To confirm that the above abnormalities in pro-B cell development
are, in fact, related to the absence of IL-7 signaling, IL-7 KO mice
were reconstituted with 40 ng of rIL-7 injected i.p. daily for 7 days.
As shown in Fig. 11, pro-B cells from
rIL-7-treated animals were induced to up-regulate the expression of
cµ, TdT, and IL-7R so as to resemble their counterparts in
IL-7+/+ mice (Figs. 6, 8, and 10). However, after
cessation of rIL-7 treatment, expression levels of these products
decreased to levels observed in noninjected IL-7 KO controls.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
However, despite the transcription of Igµ in pro-B cells of IL-7 KO
mice, cµ expression is severely reduced in Fr. B-C, and the absence
of a functional pre-BCR complex is indicated by the marked reduction of
cells expressing CD25 (34). Hence, the abrupt arrest of
early B-lineage development at Fr. C' in IL-7 KO mice and the selective
depletion of cµ+ cells among Fr. B and Fr. C
cells formally demonstrate that IL-7 is essential for regulating the
transition of pro-B cells to pre-B cells. Furthermore, the results of
cell cycle analyses suggest that, in addition to its critical role in
the survival of B cell progenitors (10, 46), IL-7 is
essential for the proliferation of early pre-B cells (including Fr.
C'). This may help to explain why, apparently unlike the situation in
early thymocyte development (21, 27, 28, 47), the
bcl-2 transgene does not rescue B lymphopoiesis in IL-7R
KO or c KO mice (20, 21).
Conversely, the presence of normal numbers of cµ- cells and normal cell cycle kinetics in Fr. B and Fr. C from IL-7 KO mice clearly argues against an essential role for IL-7 in the phenotypic differentiation and proliferation of early pro-B cells. These results are consistent with the observation that IL-3 can substitute for IL-7 in supporting pro-B cell production in vitro (13). Nonetheless, we cannot exclude the possibility that IL-7 normally functions to stimulate the proliferation of pre-pro-B cells and pro-B cells under physiological conditions, especially given our recent description of a heterodimeric form of IL-7 (PPBSF) that selectively induces proliferation of rat pre-pro-B cells in vitro (10, 11). Further support for this possibility is provided by the accumulation of pre-pro-B and pro-B cells in BM of bcl-2 transgenic RAG-1 KO mice in the presence, but not the absence, of a functional IL-7R (20, 48).
Similarly, IL-7 does not appear to be necessary for the induction of
D-JH and V-DJH gene rearrangements, which normally are observed in
early and late pro-B cells, respectively (40). Indeed,
despite the reduction in the number of Fr. B-C cells in IL-7 KO mice,
the frequency of V-DJH rearrangement in these cell fractions is normal.
This suggests that the proportion of pro-B cells that have completed
V-DJH rearrangement is actually higher in IL-7 KO than in wild-type
mice, presumably due to blockage of differentiation into early pre-B
cells. Furthermore, despite contrary findings in thymocytes
(25), IL-7 is not essential for RAG-1 or RAG-2 gene
expression in pro-B cells or for 5 and VpreB surrogate Ig light
chain gene expression for the pre-BCR (49, 50).
As IgH rearrangement appears to be normal in pro-B cells from IL-7 KO
mice, and transcription of Igµ is detectable, it is likely that IL-7
regulates the expression of Igµ post-transcriptionally. However, we
cannot exclude the possibility that IL-7 is essential for the expansion
of a minor subset of pre-BCR+ pro-B cells,
although such a trophic effect seems unlikely, as 5 KO mice generate
normal levels of cµ+ pro-B cells
(51) (Fig. 6). This interpretation is consistent with the
suggestion that the IL-7R -chain can transduce two separate
developmental signals, one for cell proliferation and the other for
cµ expression (18).
Although the results in the IL-7 KO mouse generally parallel those in
the IL-7R KO mouse (52), the marked differences in
usage of proximal and distal VH families observed
in IL-7R KO mice were not observed in IL-7 KO mice. This discrepancy
may reflect a more complete block in IL-7R KO mice of the activities
of other cytokines that can signal through the IL-7R (e.g., thymic
stromal-derived lymphopoietin) (53, 54). It also may
reflect different patterns of compensatory cytokines in the two animal
models. Nonetheless, a slight reduction in the use of the distal VHJ558
was observed in BM of IL-7 KO mice. One possible explanation is that
the decreased expression of TdT in adult IL-7 KO mice, as in wild-type
fetal and neonatal mice (55), may favor homologous
recombination and thus bias the VH
repertoire.
The increased expression of TdT observed during the progression of pre-pro-B cells to pro-B cells in wild-type mice is consistent with results from mRNA and immunofluorescence studies (56, 57). However, the failure of pro-B cells in IL-7 KO mice to express elevated levels of TdT (TdThigh) in the face of elevated mRNA expression requires explanation. Bentolila et al. (58) have identified two isoforms of TdT due to differential splicing: a smaller, active, form in the nucleus, and a larger, inactive, form in the cytoplasm. As the smaller isoform normally is dominant, it is possible that only the larger isoform is expressed in pro-B cells from IL-7 KO mice. If true, this would suggest that IL-7 influences the splicing of TdT, possibly by regulating the expression of one or more transcription factors that bind to the TdT gene (59, 60).
The expression of IL-7R also normally increases as BM cells progress
from the pre-pro-B cell (IL-7Rlow) through the
pro-B cell (IL-7Rhigh) stage. This may help to
explain why pre-pro-B cells from wild-type rat (10, 11)
and mouse (our unpublished observation) BM fail to proliferate in vitro
in response to rIL-7 unless they first are cultured in the presence of
an IL-7+/+ BM stromal cell layer or with rIL-7 in
the presence of an IL-7-/- stromal cell layer;
and why early pro-B cells respond only to superphysiologic levels of
IL-7 in vitro (61). It also may help to explain the
failure of pro-B cells from IL-7 KO mice (which lack
IL-7Rhigh) to proliferate in response to
monomeric rIL-7 in the absence of a stromal cell layer (our unpublished
observation), although the associated absence of a functional pre-BCR
may also contribute (61). We cannot exclude the
possibility that instead of (or in addition to) up-regulating the
IL-7R in wild-type mice, IL-7 selectively expands the
IL-7Rhigh population. Nonetheless, our recent
demonstration that PPBSF, a stromal cell-derived heterodimeric form of
IL-7, can prime pre-pro-B cells to respond to rIL-7 in vitro (10, 11) favors the possibility that physiological concentrations of
monomeric IL-7 are unable to transduce effectively a trophic signal in
IL-7Rlow cells. This hypothesis is further
supported by in vitro culture studies with rIL-7, which indicate that
up-regulation of the IL-R, as well as TdT and cµ, on pro-B cells
requires signaling by IL-7 in association with an additional stromal
cell-derived cofactor (C. Wei, L. Lai, and I. Goldschneider, manuscript
in preparation). The need for IL-7 itself is formally demonstrated here
by in vivo reconstitution studies in IL-7 KO mice.
The common abnormalities observed in IL-7 KO, c KO, and Jak3 KO mice
are consistent with current models for IL-7 signaling, which propose
that dimerization of IL-7R and c, induced by the binding of IL-7,
activates Jak1 and Jak3 of the Janus kinase family, respectively
(62, 63, 64). Subsequent phosphorylation of tyrosine residues
on the cytoplasmic domain of the IL-7R provides docking sites for
downstream signaling proteins (65, 66, 67, 68, 69). That these defects
do not result simply from the arrested development of Fr. C' cells, is
shown by the normal or elevated expression of cµ, TdT, and/or
IL-7R in 5 KO and RAG-1 KO mice, whose B cells also arrest
between Fr. C and Fr. C'. Our results therefore suggest that signaling
through the high affinity form of the IL-7R is required at the late
pre-pro-B/early pro-B cell stage of development despite the expression
of only low levels of IL-7R. However, it remains to be determined
whether up-regulation of the expression of IL-7R, cµ, and TdT by
pro-B cells as well as proliferation of early pre-B cells are regulated
separately by individual downstream signals and whether the factor that
initiates these events physiologically is the PPBSF heterodimer
(10, 11).
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Irving Goldschneider, Department of Pathology, School of Medicine, University of Connecticut Health Center, 263 Farmington Avenue, Farmington, CT 06030-3105. E-mail address:
3 Abbreviations used in this paper: KO, knockout; BM, bone marrow; B cell, B lymphocyte; cµ, cytoplasmic Ig µ heavy chain; c, receptor common -chain; FCM, flow immunocytometry; Fr, phenotypic B cell fraction; HSA, heat-stable Ag; IMS, immunomagnetic separation; Jak, Janus kinase; PPBSF, pre-pro-B cell growth-stimulating factor; RAG, recombinase-activating gene; R, receptor; pre-BCR, pre-B cell receptor; 5 and V pre-B, surrogate Ig light chain components for pre-BCR; sIg, surface immunoglobulin.
Received for publication August 9, 1999. Accepted for publication December 9, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
chain transmits distinct signals for proliferation and differentiation during B lymphopoiesis. EMBO J. 15:1924.[Medline]
gene rearrangement in interleukin-7 receptor knockout mice. Immunol. Lett. 57:9.[Medline]
genes is blocked in interleukin-7 receptor-deficient mice. J. Exp. Med. 184:2423. genes are rearranged but not transcribed in IL-7R -deficient mice. J. Immunol. 158:5744.[Abstract]
chain-deficient mice. Eur. J. Immunol. 27:100.[Medline]
chain in intrathymic and peripheral T cell selection. J. Exp. Med. 183:1111. chain. Immunity 2:223.[Medline]
chain. Proc. Natl. Acad. Sci. USA 92:377. chain induction. Immunity 7:691.[Medline]
chain: a functional component of the interleukin-7 receptor. Science 262:1877. chain in IL-7 receptor complexes. Science 263:1453.5 and VpreB) and the immunoglobulin µ chain form a complex that is transported onto the cell surface. J. Exp. Med. 172:973. 5 pre-B cell-specific genes can associate with each other and with µ heavy chain. J. Exp. Med. 172:969. chain. Leukemia 10:1317.[Medline]
This article has been cited by other articles:
|
|
 |
|
  V. I. Brown, J. Hulitt, J. Fish, C. Sheen, M. Bruno, Q. Xu, M. Carroll, J. Fang, D. Teachey, and S. A. Grupp Thymic Stromal-Derived Lymphopoietin Induces Proliferation of Pre-B Leukemia and Antagonizes mTOR Inhibitors, Suggesting a Role for Interleukin-7R{alpha} Signaling Cancer Res., October 15, 2007; 67(20): 9963 - 9970. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Feng, H. Wang, and H. C. Morse III Functional Deficiency in IL-7 Caused by an N-Ethyl-N-nitrosourea-Induced Point Mutation Genetics, February 1, 2007; 175(2): 545 - 551. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Wen, Y. Chen, L. Bai, G. Fu, J. Schuman, X. Dai, H. Zeng, C. Yang, R. P. Stephan, J. L. Cleveland, et al. Essential Role of Phospholipase C{gamma}2 in Early B-Cell Development and Myc-Mediated Lymphomagenesis Mol. Cell. Biol., December 15, 2006; 26(24): 9364 - 9376. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Fujimura, Y. Xing, M. Takeya, Y. Yamashita, K. Ohshima, K. Kuwahara, and N. Sakaguchi Increased Expression of Germinal Center-Associated Nuclear Protein RNA-Primase Is Associated with Lymphomagenesis Cancer Res., July 1, 2005; 65(13): 5925 - 5934. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Sakaguchi, T. Kimura, S. Matsushita, S. Fujimura, J. Shibata, M. Araki, T. Sakamoto, C. Minoda, and K. Kuwahara Generation of High-Affinity Antibody against T Cell-Dependent Antigen in the Ganp Gene-Transgenic Mouse J. Immunol., April 15, 2005; 174(8): 4485 - 4494. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. M. Oliver, M. Wang, Y. Zhu, J. White, J. Kappler, and P. Marrack Loss of Bim Allows Precursor B Cell Survival But Not Precursor B Cell Differentiation in the Absence of Interleukin 7 J. Exp. Med., November 1, 2004; 200(9): 1179 - 1187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. I. Brown, J. Fang, K. Alcorn, R. Barr, J. M. Kim, R. Wasserman, and S. A. Grupp Rapamycin is active against B-precursor leukemia in vitro and in vivo, an effect that is modulated by IL-7-mediated signaling PNAS, December 9, 2003; 100(25): 15113 - 15118. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Otero and R. C. Rickert CD19 Function in Early and Late B Cell Development. II. CD19 Facilitates the Pro-B/Pre-B Transition J. Immunol., December 1, 2003; 171(11): 5921 - 5930. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-K. Lee, J. F. Kalinowski, S. L. Jastrzebski, L. Puddington, and J. A. Lorenzo Interleukin-7 Is a Direct Inhibitor of in Vitro Osteoclastogenesis Endocrinology, August 1, 2003; 144(8): 3524 - 3531. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. R. Dillon and M. S. Schlissel Partial restoration of B cell development in Jak-3-/- mice achieved by co-expression of IgH and E{micro}-myc transgenes Int. Immunol., August 1, 2002; 14(8): 893 - 904. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Tsuruyama, T. Nakamura, G. Jin, M. Ozeki, Y. Yamada, and H. Hiai Constitutive activation of Stat5a by retrovirus integration in early pre-B lymphomas of SL/Kh strain mice PNAS, June 11, 2002; 99(12): 8253 - 8258. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. J. Fry and C. L. Mackall Interleukin-7: from bench to clinic Blood, May 13, 2002; 99(11): 3892 - 3904. [Full Text] [PDF]
|
|
|
|
|
|
T. L. Carvalho, T. Mota-Santos, A. Cumano, J. Demengeot, and P. Vieira Arrested B Lymphopoiesis and Persistence of Activated B Cells in Adult Interleukin 7-/- Mice J. Exp. Med., October 15, 2001; 194(8): 1141 - 1150. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Lai and I. Goldschneider Cutting Edge: Identification of a Hybrid Cytokine Consisting of IL-7 and the {beta}-Chain of the Hepatocyte Growth Factor/Scatter Factor J. Immunol., October 1, 2001; 167(7): 3550 - 3554. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Martinez-M., S. Minguet, P. Gonzalo, P. G. Soro, B. de Andres, A. Izcue, M. A. R. Marcos, and M.-L. Gaspar Long-lived polyclonal B-cell lines derived from midgestation mouse embryo lymphohematopoietic progenitors reconstitute adult immunodeficient mice Blood, September 15, 2001; 98(6): 1862 - 1871. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kouro, K. L. Medina, K. Oritani, and P. W. Kincade Characteristics of early murine B-lymphocyte precursors and their direct sensitivity to negative regulators Blood, May 1, 2001; 97(9): 2708 - 2715. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
