| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Division of Rheumatology, Department of Medicine, Washington University School of Medicine, St. Louis, MO 63110; and
Division of Rheumatology, Departments of Medicine and Pathology, Howard Hughes Medical Institute, St. Louis, MO 63110
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
MV infection of primary human monocyte cultures down-regulates IL-12 production (20), providing an explanation for the inhibition of cellular immunity associated with this disease (21). Additionally, exposure of the ME-180 human epithelial cell line to Neisserial pili caused a calcium flux (22). These and other studies (see Discussion) point to important signal transduction events mediated through MCP.
Beginning at its amino terminus, the extracellular portion of MCP consists of four modules known as complement control protein repeats (CCPs). This area is followed by an alternatively spliced serine, threonine, proline-rich (STP) region (23, 24) that assists in cytoprotection (25, 26). Commonly expressed isoforms contain the segments STP-BC (29 aa) or -C (14 aa). Rarer isoforms have been noted (23, 24). CCP 2, CCP 3, and CCP 4 are important for ligand binding and complement regulatory function (27, 28), whereas the CCP 1 and CCP 2 domains are critical for MV binding (28, 29, 30, 31). The two cytoplasmic domains of MCP arise by alternatively splicing producing two tails of 16 (CYT-1) and 23 (CYT-2) amino acids (23). MCP isoforms are named on the basis of their STP and tail domains (i.e., BC1, BC2, C1, and C2). While most cells in a given individual express the same ratio of MCP isoforms, one prominent exception is the brain, where MCP bearing CYT-2 is preferentially expressed (32, 33).
MCP bearing tail 1 was processed from its precursor to mature form three to four times faster than with tail 2 (34, 35). The 4 aa (Phe-Thr-Ser-Leu; FTSL) at the carboxyl terminus of CYT-1 are responsible for this rapid transport (36). In addition, MCP isoforms bearing either tail were directed to the basolateral surface of polarized epithelial cells (37). A deletion mutant lacking the cytoplasmic tail was transported in a nonpolarized fashion, indicating that the targeting signal for the basolateral transport is located in the cytoplasmic domain. Mutational analysis established that the basolateral targeting signal of CYT-1 is tyrosine independent (37).
The cytoplasmic tails of MCP encode putative signals for protein kinase C, casein kinase 2, and src kinases (35). The ability of these cytoplasmic sequences to couple with intracellular signaling pathways is likely to determine the nature of the cellular response to its natural ligands and to the three pathogens that bind MCP. In this study, tyrosine phosphorylation of MCP bearing CYT-2 but not CYT-1 was induced in several human cell lines by cross-linking with anti-MCP mAbs. In contrast with the tyrosine phosphorylation of MCP observed in the Jurkat T cell line, tyrosine phosphorylation of MCP was markedly reduced in a Lck-deficient T cell line (JCaM1.6). The latter taken together with data that an MCP peptide of CYT-2 could be in vitro phosphorylated by p60c-src implicates this family of kinases in the signaling pathway of MCP.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cloned Chinese hamster ovary (CHO) cell lines expressing each of the four isoforms of MCP have been previously described (25). These cells were grown in Ham’s F12 medium supplemented with 10% FBS, 0.5 mg/ml geneticin, and 1 mM L-glutamine. We also used a T cell leukemia cell line, Jurkat (American Type Culture Collection, Manassas, VA), and three mutant Jurkat cell lines. The latter are P116 (deficient in ZAP-70 kinase; Ref. 38), JCaM1.6 (deficient in Lck kinase; Ref. 39), and J45.01 (deficient in CD45 phosphatase; Ref. 40). Both parental and mutant cell lines were grown in RPMI 1640 supplemented with 10% FBS, L-glutamine, and antibiotics. The human cervical epithelial cell line ME-180 (American Type Culture Collection) was maintained in McCOY’S 5A medium supplemented with 10% FBS, L-glutamine, and antibiotics. Tissue culture reagents were obtained from the Tissue Culture Support Center at Washington University School of Medicine.
Abs
Two mAbs against MCP were employed. TRA-2–10, a gift of P. W. Andrews, binds to an epitope in CCP 1 and does not block complement regulatory function (29, 41). GB24, a gift from B. L. Hsi, binds to an epitope in CCP 3/4 and does block function (27, 42). The anti-MCP rabbit polyclonal antiserum was produced by CytoMed (Cambridge, MA). Two anti-phosphotyrosine (anti-pTyr) mAb preparations were employed (both from Transduction Laboratories, Lexington, KY): PY20 with and without a HRP label. The control mAb was MOPC-21 (Sigma, St. Louis, MO).
MCP peptide-binding ELISA
Four peptides, MCP CYT-1 (TYLTDETHREVKFTSL), CYT-2 (KADGGAEYATYQTKSTTPAE), C-UN (KPPVSNYPGYPKPEEGTLDS), and CCP 3 (KIKNGKHTFSEVE) were used for the cell-free phosphorylation experiments. The peptides were coated overnight at 4°C on microtiter wells (Nunc modules, Fisher Scientific, St. Louis, MO) at 80 µg/ml in PBS. Wells were blocked with 1% BSA in 0.01% Tween 20 in PBS for 1 h at 37°C. A polyclonal rabbit anti-MCP Ab was used to establish that the peptides had been adsorbed onto the solid phase in equivalent amounts. Wells were rinsed with kinase reaction buffer (50 mM HEPES, pH 7.5, 0.1 mM EDTA, 0.015% Brij-35, 50 µg/ml BSA, 0.075% 2-ME, 0.05 mM ATP, 10 mM MgCl2) followed by incubation with the kinase p60c-src (Oncogene Science, Uniondale, NY) for 2 h at 30°C (p60c-src diluted in kinase reaction buffer; the U/ml were as specified). After washing in buffer (10 mM Tris, pH 7.2, 150 mM NaCl, 0.05% Tween 20), rabbit anti-pTyr Ab diluted 1:1000 in wash buffer was incubated for 90 min at 37°C. After washing as described above, HRP-conjugated donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories, West Grove, PA) was added (at 1:5000) for 1 h at 37°C. Following washing, detection was by substrate 3,3',5,5'-tetramethylbenzidine (Pierce, Rockford, IL). OD (630 nm) was measured in an ELISA reader.
Flow cytometry
The Jurkat and Jurkat lines (1 x 105 cells), P116, JCaM1.6, and J45.01, were incubated on ice for 30 min with mAb GB24. After washing twice with PBS, FITC-conjugated anti-mouse IgG (Sigma) was added on ice for 30 min. The cells were then suspended in 0.5% paraformaldehyde and analyzed by FACScan.
Cell stimulation and lysis
Pervanadate (Sigma Chemical Co.) was freshly prepared by mixing 12.5 µl of 500 mM sodium orthovanadate solution with 75 µl of hydrogen peroxide (H2O2) in 500 µl PBS and incubating at room temperature for 10 min to generate activated 10 mM pervanadate. The 10 mM pervanadate solution was added to cells in 1% BSA/PBS (10 µl/ml) and incubated for 10 min at room temperature. Then cells were lysed with 1% Nonidet P-40, 0.05% SDS, 2 mM PMSF, 0.1 mM sodium orthovanadate in TBS (10 mM Tris, pH 7.4, 150 mM sodium chloride) for 15 min at 4°C. Following centrifugation in a microcentrifuge at 12,000 x g for 10 min, supernatants were collected and stored in aliquots at -70°C. In addition, in some instances Jurkat, P116, JCaM1.6, and J45.01 cells were preincubated with 50 µg/ml of anti-MCP mAb (GB24 or TRA 2–10) for various time at 37°C and then lysed as described above.
Immunoprecipitations and Western blotting
Cell lysates were immunoprecipitated with mAb GB24 (anti-MCP mAb), PY20 (anti-pTyr mAb), or MOPC-21 (isotype control mAb) for 1 h at 4°C. Dynabeads M-450 goat anti-mouse IgG (Dynal, Oslo, Norway) (20 µl) was added to the lysates, and then the mixture was rotated at 4°C overnight. This preparation was washed three times in lysis buffer before being boiled for 5 min in nonreducing or reducing buffer before SDS-PAGE.
For Western blotting, samples were electrophoresed on 10% SDS-polyacrylamide gel and then transferred to nitrocellulose membranes employing a buffer consisting of 25 mM Tris, 192 mM glycine, 20% methanol, pH 8.3, with a NOVEX transfer system for 1 h at 25 V. For Western blots of MCP, membranes were blocked overnight at 4°C with 5% nonfat dry milk in TBS and 0.05% Tween (TBST) before immunoblotting with rabbit polyclonal antiserum to MCP diluted 1:7000 in TBST for 30 min at 37°C. Blots were washed three times for 5 min each in TBST, incubated with HRP-conjugated donkey anti-rabbit IgG secondary Ab (Sigma) diluted 1:3000 in TBST for 1 h at room temperature, and washed for 5 min three times in TBST. Immunoreactivity was enhanced employing the enhanced chemiluminescence kit (per manufacturer’s directions) (Amersham, Arlington Heights, IL). For anti-pTyr blots, membranes were blocked with 1% BSA/TBST overnight at 4°C before being incubated with HRP-conjugated PY20 (anti-pTyr) diluted 1:2500 in blocking buffer for 1 h at room temperature. After washing as described above, blots were again developed using the enhanced chemiluminescence kit.
RT-PCR
Total RNA was isolated using the RNeasy mini protocol (Qiagen, Valencia, CA). Isolated RNA was quantitated by OD and was checked with a 1% agarose gel. Both cDNA synthesis and PCR were performed in a single test tube from RNA using gene-specific primers and Superscript One-Step RT-PCR system (Applied Biosystems with Perkin-Elmer GeneAmp PCR System 9600, Foster City, CA). The sequence of the 5' MCP-CCP 4 primer was GTGGTCAAATGTCGATTTCCAGTAGTCG and the 3' untranslated primer was CAAGCCACATTGCAATATTAGCTAAGCCACA. These primers allow MCP isoforms, which arise through alternative splicing, to be distinguished (23). RNA in a total volume of 50 µl (1 µl of 1 µg/µl RNA; 25 µl of 2x reaction mix; 1 µl of 1 µg/µl sense and anti-sense primers, respectively; 1 µl of reverse transcriptase/Taq mix; 21 µl of distilled water) was incubated at 50°C for 30 min to prepare cDNA. The PCR amplification was an initial denaturation at 94°C for 2 min followed by 40 cycles of 94°C for 15 s, 55°C for 30 s, and then 70°C for 1 min. At the completion of the cycling reactions, a final extension was performed at 72°C for 10 min. The PCR products were analyzed on a 3% agarose gel. This semiquantitative PCR is linear at least within 25–45 cycles (Ref. 23 and our unpublished observations).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The structure of MCP isoforms, the amino acid sequence of the two
tails, and putative signals for phosphorylation by src kinase, protein
kinase C, and casein kinase 2 are shown in Fig. 1
, A and B. CYT-1
has one tyrosine residue, and CYT-2 possesses two. To examine if the
cytoplasmic tails of MCP are phosphorylated, CYT-1 and CYT-2 peptides
containing these tyrosines were assessed in a cell-free system
for tyrosine phosphorylation by p60c-src. The
ELISA results indicated that CYT-2 but not CYT-1 can serve as a
substrate for p60c-src kinase (Fig. 2). CYT-2 peptide was phosphorylated by
p60c-src in a dose-dependent fashion (Fig. 2A). Two other MCP-derived peptides, one possessing two
tyrosine residues (C-UN) and one without (CCP 3), were not
phosphorylated (Fig. 2B).
|
|
Treatment of cells with pervanadate inhibits tyrosine phosphatases
and mimics receptor engagement in T, B, and NK cells. Therefore, we
asked if pervanadate treatment promoted phosphorylation of MCP on
Jurkat, ME-180, and CHO cells (Figs. 3
and 4). Cell lysates derived from treated
cells were immunoprecipitated with GB24 (anti-MCP), PY20
(anti-pTyr), or MOPC-21. The precipitates were solubilized and
electrophoresed on SDS-polyacrylamide gels and then transferred and
blotted with a rabbit polyclonal anti-MCP antiserum (Figs. 3 and 4A) or with anti-pTyr (Fig. 4B). As shown in
Fig. 3, the CHO cell lines expressing BC2 or C2 MCP isoforms
(lanes 8 and 14) were tyrosine
phosphorylated. These phosphorylated bands aligned with MCP in
lanes 7 and 13. Based on scanning of the gels,
5–30% of the MCP of BC2 and C2 isoforms was phosphorylated. There was
no detectable tyrosine phosphorylation of BC1 or C1 (lanes
5 and 11). Under the same experimental conditions, Fig. 4A demonstrates that Jurkat and ME-180 cells are also
tyrosine phosphorylated (lanes 2 and 5)
and that these phosphorylated proteins align with MCP as expressed by
these two cell lines. In these two cell lines, 50–80% of the MCP was
phosphorylated. In addition, blotting with anti-pTyr on Jurkat and
ME-180 cells (Fig. 4B, lanes 1 and 5)
indicated that MCP was phosphorylated, consistent with the results
shown in Fig. 4A. Protein tyrosine phosphorylation was not
detected in unstimulated cells (Fig. 4B, lanes 3
and 7) or in cells immunoprecipitated with a control mAb
(lanes 2 and 6).
|
|
. First, for both cell lines MCP migrated identically
following precipitation by either anti-MCP or anti-pTyr mAbs
(compare lanes 1 and 2 and lanes 4 and
5). Second, upon reduction and separation by SDS-PAGE
(compare Fig. 4, A and B), protein bands
characteristically focused more narrowly and migrated more slowly (
5
kDa greater in molecular mass). The latter is due to the disruption of
the two disulfide bonds in each of four CCP modules. Third, the
difference in Mr between the upper
bands in Jurkat and ME-180 is secondary to variations in glycosylation
(see next section). MCP isoforms expressed by Jurkat and ME-180 cells
The previous data (Fig. 4) establishes that MCP was tyrosine
phosphorylated on Jurkat and ME-180 cell lines. Because most human
cells and cell lines express four isoforms of MCP, we next undertook
the identification of the specific isoforms in these cell lines that
were phosphorylated. To do this, we used a semiquantitative RT-PCR,
previously developed in our laboratory (23), which allows
for easy separation of the product coding for each isoform. We then
compared these results to that of the protein data of Fig. 4.
The RT-PCR was performed in parallel with the two cell lines and with
MCP-transfected CHO cells expressing a single isoform (Fig. 5). The PCR bands derived from Jurkat and
ME-180 mRNA were identical in mobility with those obtained from the
four CHO cells lines. For Jurkat cells, BC2 was predominant,
representing 50%, while BC1 represented 15%, C2 20%, and C1 5%. For
ME-180, the BC2 isoform also was predominant, representing 50%, while
C2 represented 30%, BC1 15%, and C1 5%. Thus, for both Jurkat and
ME-180, CYT-2-containing isoforms were the major species (70 and 80%,
respectively), with the majority of the protein being BC2. Taken
together with data presented in Figs. 2 and 3 and the fact that 50% or
greater of MCP was phosphorylated in these two cell lines, we conclude
that isoforms bearing CYT-2, but not CYT-1, likely undergo tyrosine
phosphorylation.
|
.
Both Jurkat and ME-180 express a predominant upper band phenotypic MCP
pattern. In a survey of normal individuals, the quantity of upper bands
(BC1 and BC2) expressed versus that of the lower band forms (C1 and C2)
is an inherited trait, with 65% of the population expressing
predominantly the upper band forms, 29% equal quantities, and 6%
predominantly the lower band (23, 43). Thus, the Jurkat
cell line is derived from an individual with the most common upper band
phenotype (the lower molecular mass is visible upon longer exposures).
This upper band of Jurkat migrates faster than that of ME-180. MCP
displays a characteristic microheterogeneity of
Mr due to variations in glycosylation
among cell types (34, 44), and most epithelial-derived
cells are a few kDa larger than peripheral blood cells or cell lines.
Thus, the RT-PCR results in Fig. 5 and the protein data of Fig. 4
strongly suggest that the BC2 isoform is the dominant isoform tyrosine
phosphorylated in Jurkat. Similarly for ME-180, we conclude that both
BC2 and C2 are phosphorylated. Cross-linking of cell-surface MCP induces rapid tyrosine phosphorylation
MCP on Jurkat cells was cross-linked with GB24 and evidence for
tyrosine phosphorylation was sought. Jurkat cells were incubated with
GB24 at 37°C for 1–30 min. The anti-MCP immunocomplexes were
electrophoresed on SDS-polyacrylamide gels, transferred, and then
immunoblotted with anti-pTyr mAb (Fig. 6). MCP was rapidly tyrosine
phosphorylated, with the peak occurring between 1 and 2 min, which was
followed by a steady decrease for the next 10 min. The Jurkat cells
were also incubated over the same time periods with GB24, but this time
at 4°C. Similar results were observed, although the staining was less
intense (not shown). In addition, the Jurkat cells were stimulated with
pervanadate for 10 min after incubation with GB24. In this case, there
was also rapid tyrosine phosphorylation (not shown) in the presence of
a phosphatase inhibitor, although as expected it persisted for up to at
least 30 min.
|
To further characterize the tyrosine phosphorylation of MCP,
mutant Jurkat cell lines deficient in a kinase or phosphatase were
employed. The Jurkat (parental), P116 (deficient in ZAP-70 kinase),
JCaM1.6 (deficient in Lck kinase), and J45.01 (deficient in CD45
phosphatase) expressed similar quantities of MCP (Fig. 7). MCP on these cells was cross-linked
with GB24 (Fig. 8A) or
TRA-2–10 (Fig. 8B) at 37°C for 2 or 20 min. The lysates
were immunoprecipitated with these same mAbs. Following electrophoresis
and transfer, the gels were immunoblotted with anti-pTyr mAb
(top panels) or anti-MCP polyclonal Ab
(bottom panels). The parental Jurkat, P116, and J45.01 cell
lines demonstrated tyrosine phosphorylation of MCP at 2 min, which was
abrogated by 20 min. However, this phosphorylation at 2 min was absent
or markedly reduced (on longer exposures a faint band could be seen) in
JCaM1.6 cells. Similar results were obtained with both mAbs. These data
indicate a requirement for Lck kinase to phosphorylate MCP in Jurkat
cells.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
A second reason for suspecting an important role for MCP in cell signaling relates to its cytoplasmic structure. A surprise in the molecular analysis of MCP was the identification of two cytoplasmic tails that arise by alternative splicing (23, 24). Analysis by RT-PCR indicated that both tails were expressed by most cells and that both carried motifs for interactions with kinases (23, 35).
A third reason relates to tissue-specific isoform expression, most noteworthy in the brain, where cytoplasmic tail 2 is expressed predominantly, if not exclusively, on neural tissue (32, 33). Also, some cell lines, such as the ME-180 cells used in this study, express predominantly one tail or the other.
The fourth reason for pursuing signaling activity mediated by MCP is
the recently published experiments on biological effects of microbes
that interact with MCP. Karp et al. demonstrated that IL-12 production
was down-regulated in primary human monocyte cultures following
exposure to MV (20). Because MCP is a receptor for MV
hemagglutinin (4, 5, 6), the likely interpretation of these
results is that hemagglutinin on the viral envelope cross-links MCP to
initiate a signaling event causing reduced synthesis of IL-12.
Moreover, in the same experimental system, dimeric C3b and a mAb to MCP
mimicked the effects of viral infection on IL-12 production, providing
more evidence for MCP being critical to this response. Neisseria
gonorrhea and meningitidis have also been shown to use
MCP as a receptor (9). Kallstrom and colleagues
demonstrated that an MCP-dependent cell signaling event (induction of
Ca2+ flux) occurred upon exposure of human
epithelial cells to the purified pili of these pathogenic
Neisseria (22). Additionally, employing a mouse
macrophage cell line transfected with human MCP, Hirano et al. observed
changes in NO production following stimulation with IFN-
that were
related to which tail of MCP was expressed (46). Finally,
intracellular domains were a critical factor for effective virus-cell
fusion and subsequent MV replication (47, 48), again
suggesting the possibility of a signal transducing event mediated
by MCP.
CYT-1 possesses potential phosphorylation sites for protein kinases C and casein kinase 2, while CYT-2 possesses potential phosphorylation sites for src kinases and casein kinase 2 (35). To define a mechanism by which MCP could mediate signal transduction events, we analyzed if CYT-1 or CYT-2 was phosphorylated on tyrosine. After our initial studies indicated that a peptide derived from CYT-2 of MCP could be tyrosine phosphorylated by a src kinase, we sought to extend these results by asking if MCP expressed on a human T leukemia cell line (Jurkat), a cervical epithelial cell line (ME-180), and MCP-transfected CHO cells was also tyrosine phosphorylated. Treatment of cells with pervanadate or Ab cross-linking of MCP resulted in tyrosine phosphorylation of CYT-2 but not CYT-1. This reversible phosphorylation event occurred rapidly and was dependent in Jurkat cells on the src family kinase Lck but not ZAP-70 or CD45. Our working hypothesis is that the tyrosine in the peptide AEYAT, because of its homology to a src phosphorylation motif, is the site of phosphorylation by src kinases such as Lck.
While there are no published studies on tyrosine phosphorylation of the
cytoplasmic tails of MCP, Wong et al. showed that the intracellular
domains of human MCP were associated with kinases in a transfected
mouse macrophage cell line stimulated with IFN- (49).
In the case of CYT-1, the association was dependent on a sequence motif
proximal to the tail. However, kinase activity remained upon deletion
of this same region when CYT-2 was present. It may be that this
"residual kinase" activity associated with CYT-2 reflects what we
have observed in this study.
Many src family protein tyrosine kinases have been associated with membrane proteins involved in cell activation including Lck, Fyn, ZAP-70, syk, and others (50). Lck is found predominantly in T cells (51, 52, 53, 54, 55), where it has been shown to play a critical role during T cell activation (51, 56, 57). Lck is a 56-kDa src-related protein tyrosine kinase that is attached to the inner face of the plasma membrane via amino-terminal myristylation and palmitylation (58). Lck has a dicysteine motif at this N terminus that mediates its association with CD4 and CD8 T cell-surface Ags. As with other related src kinases, the remaining amino-half consists of Src homology domains 3 and 2 while the carboxyl end consists primarily of the kinase domain. Cross-linking of CD4 or stimulation of the TCR by Ag leads to a rapid increase of intracellular tyrosine phosphorylation (59, 60). Lck is felt, in turn, to be responsible for the phosphorylation of several proteins engaged in TCR activation. More recently, a role for Lck in TCR function in downstream events also has been proposed (57).
The extensive data relating to a role for src kinases in general and Lck in particular in TCR activation can be used to facilitate interpretation of our studies of MCP. First, as shown in this report, MCP demonstrated differential tyrosine phosphorylation of its tails following cross-linking by Ab in the Jurkat T cell line. As noted, others have recently reported IL-12 down-regulation (20), Ca2+ fluxes (22), and NO (46) changes in association with experimental procedures that cross-link MCP. Src kinases are known to play a role in these types of signaling events as they do in T cell activation, which is accompanied by a calcium flux (50, 52, 61). Second, in Jurkat T cell lines, Lck, but not ZAP-70 or CD45, was required for tyrosine phosphorylation of MCP. The straightforward explanation is that Lck directly phosphorylates CYT-2 or that it is required for the downstream mediators of this phosphorylation. Lck is unlikely to be the only src kinase involved because it is not expressed in ME-180 cells or CHO cells (51, 60). Because T cell activation requires Lck, ZAP-70, and CD45, the signaling by MCP likely involves a distinct, albeit partially shared, signal transducing pathway. Thus, a comparison of these two pathways in a T cell line such as Jurkat could be informative relative to how this cell mediates signal transducing events from different effectors.
Two other widely expressed complement regulatory proteins, CD55 and CD59, are GPI linked and upon cell activation can associate with src family tyrosine kinases in specialized coated pits in the membrane (58, 62, 63). Signal transducing events leading to cell activation or, more commonly, the enhancement of other activating agents has been demonstrated for T lymphocytes, PBMC, granulocytes, and other cell types. Of interest, then, is our observation of a signaling event that also uses src kinase(s) and involves a transmembrane complement regulatory protein.
These studies raise many intriguing questions relative to the potential role of physiologic and pathologic ligands in mediating MCP signaling and the identification of the intracellular pathways involved in these responses. For example, the penchant for two of three MCP-reacting pathogens (MV and Neisseria) to induce a cellular signal may parallel native ligands such as C4b and C3b. The finding that neuronal tissue primarily expresses CYT-2 suggests physiologic relevance. Finally, other possible signaling events mediated by CYT-1 and CYT-2 remain to be discerned. In the future, we plan to determine the kinase(s) involved in other cell lines, to define the site of phosphorylation, and to connect the phosphorylation event(s) to a biologic response such as a calcium flux. We plan to focus initially on T cells and T cell lines where much information and potentially informative reagents are available to dissect a tyrosine phosphorylation event mediated by src kinases.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. John P. Atkinson, Division of Rheumatology, Department of Medicine, Washington University School of Medicine, 660 S. Euclid Avenue, Box 8045, St. Louis, MO 63110. E-mail address:
3 Abbreviations used in this paper: MCP, membrane cofactor protein; MCP CYT-1, MCP bearing cytoplasmic tail one; MCP CYT-2, MCP bearing cytoplasmic tail two; MV, measles virus; CHO, Chinese hamster ovary cell line; GB24 and TRA-2–10, anti-MCP mAbs; anti-pTyr, anti-phosphotyrosine; PY20, anti-pTyr with or without HRP mAb; MOPC-21, IgG1 mAb of unknown antigenic specificity; CCP, complement control protein.
Received for publication September 7, 1999. Accepted for publication December 9, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
interferon: dependence on the CD46 cytoplasmic domains. J. Virol. 73:4776.This article has been cited by other articles:
|
|
 |
|
  P. M Johnson, L. E Clift, P. Andrlikova, M. Jursova, B. F Flanagan, J. A Cummerson, P. Stopka, and K. Dvorakova-Hortova Rapid sperm acrosome reaction in the absence of acrosomal CD46 expression in promiscuous field mice (Apodemus) Reproduction, December 1, 2007; 134(6): 739 - 747. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Hakulinen and J. Keski-Oja ADAM10-mediated Release of Complement Membrane Cofactor Protein during Apoptosis of Epithelial Cells J. Biol. Chem., July 28, 2006; 281(30): 21369 - 21376. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. J. Weyand, S. W. Lee, D. L. Higashi, D. Cawley, P. Yoshihara, and M. So Monoclonal Antibody Detection of CD46 Clustering beneath Neisseria gonorrhoeae Microcolonies Infect. Immun., April 1, 2006; 74(4): 2428 - 2435. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Elward, M. Griffiths, M. Mizuno, C. L. Harris, J. W. Neal, B. P. Morgan, and P. Gasque CD46 Plays a Key Role in Tailoring Innate Immune Recognition of Apoptotic and Necrotic Cells J. Biol. Chem., October 28, 2005; 280(43): 36342 - 36354. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Iacobelli-Martinez, R. R. Nepomuceno, J. Connolly, and G. R. Nemerow CD46-Utilizing Adenoviruses Inhibit C/EBP{beta}-Dependent Expression of Proinflammatory Cytokines J. Virol., September 1, 2005; 79(17): 11259 - 11268. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Price, J. Schaumburg, C. Sandin, J. P. Atkinson, G. Lindahl, and C. Kemper Induction of a Regulatory Phenotype in Human CD4+ T Cells by Streptococcal M Protein J. Immunol., July 15, 2005; 175(2): 677 - 684. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Wu, S. A. Trauger, L. Pache, T.-M. Mullen, D. J. Von Seggern, G. Siuzdak, and G. R. Nemerow Membrane Cofactor Protein Is a Receptor for Adenoviruses Associated with Epidemic Keratoconjunctivitis J. Virol., April 15, 2004; 78(8): 3897 - 3905. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Crimeen-Irwin, S. Ellis, D. Christiansen, M. J. Ludford-Menting, J. Milland, M. Lanteri, B. E. Loveland, D. Gerlier, and S. M. Russell Ligand Binding Determines Whether CD46 Is Internalized by Clathrin-coated Pits or Macropinocytosis J. Biol. Chem., November 21, 2003; 278(47): 46927 - 46937. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. B. Gill, M. Koomey, J. G. Cannon, and J. P. Atkinson Down-regulation of CD46 by Piliated Neisseria gonorrhoeae J. Exp. Med., November 3, 2003; 198(9): 1313 - 1322. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Richards, E. J. Kemp, M. K. Liszewski, J. A. Goodship, A. K. Lampe, R. Decorte, M. H. Muslumanogglu, S. Kavukcu, G. Filler, Y. Pirson, et al. Mutations in human complement regulator, membrane cofactor protein (CD46), predispose to development of familial hemolytic uremic syndrome PNAS, October 28, 2003; 100(22): 12966 - 12971. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Smith, F. Santoro, G. Di Lullo, L. Dagna, A. Verani, and P. Lusso Selective suppression of IL-12 production by human herpesvirus 6 Blood, October 15, 2003; 102(8): 2877 - 2884. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T Inoue, M Yamakawa, and T Takahashi Expression of complement regulating factors in gastric cancer cells Mol. Pathol., June 1, 2002; 55(3): 193 - 199. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. W. Lee, R. A. Bonnah, D. L. Higashi, J. P. Atkinson, S. L. Milgram, and M. So CD46 is phosphorylated at tyrosine 354 upon infection of epithelial cells by Neisseria gonorrhoeae J. Cell Biol., March 18, 2002; 156(6): 951 - 957. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zaffran, O. Destaing, A. Roux, S. Ory, T. Nheu, P. Jurdic, C. Rabourdin-Combe, and A. L. Astier CD46/CD3 Costimulation Induces Morphological Changes of Human T Cells and Activation of Vav, Rac, and Extracellular Signal-Regulated Kinase Mitogen-Activated Protein Kinase J. Immunol., December 15, 2001; 167(12): 6780 - 6785. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. Tobiason and H. S. Seifert Inverse relationship between pilus-mediated gonococcal adherence and surface expression of the pilus receptor, CD46 Microbiology, August 1, 2001; 147(8): 2333 - 2340. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Ludford-Menting, S. J. Thomas, B. Crimeen, L. J. Harris, B. E. Loveland, M. Bills, S. Ellis, and S. M. Russell A Functional Interaction between CD46 and DLG4. A ROLE FOR DLG4 IN EPITHELIAL POLARIZATION J. Biol. Chem., February 1, 2002; 277(6): 4477 - 4484. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
