The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, G.
Right arrow Articles by Atkinson, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, G.
Right arrow Articles by Atkinson, J. P.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*L-TYROSINE
The Journal of Immunology, 2000, 164: 1839-1846.
Copyright © 2000 by The American Association of Immunologists

Membrane Cofactor Protein (MCP; CD46): Isoform-Specific Tyrosine Phosphorylation1

Guixian Wang*, M. Kathryn Liszewski*, Andrew C. Chan{dagger} and John P. Atkinson2,*

* Division of Rheumatology, Department of Medicine, Washington University School of Medicine, St. Louis, MO 63110; and {dagger} Division of Rheumatology, Departments of Medicine and Pathology, Howard Hughes Medical Institute, St. Louis, MO 63110


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Membrane cofactor protein (MCP; CD46) is a widely expressed type 1 transmembrane glycoprotein that inhibits complement activation on host cells. It also is a receptor for several pathogens including measles virus, Streptococcus pyogenes, Neisseria gonorrhea, and Neisseria meningitidis. That MCP may have signaling capability was suggested by its microbial interactions. That is, binding of MCP on human monocytes by measles virus hemagglutinin or cross-linking by an anti-MCP Ab resulted in IL-12 down-regulation, while binding to MCP by Neisseria on epithelial cells produced a calcium flux. Through alternative splicing, MCP is expressed on most cells with two distinct cytoplasmic tails of 16 (CYT-1) or 23 (CYT-2) amino acids. These play pivotal roles in intracellular precursor processing and basolateral localization. We investigated the putative signal transduction pathway mediated by MCP and demonstrate that CYT-2, but not CYT-1, is phosphorylated on tyrosine. We examined MCP tail peptides and performed Ab cross-linking experiments on several human cell lines and MCP isoform transfectants. We found an MCP peptide of CYT-2 was phosphorylated by a src kinase system. Western blots of the cells lines demonstrated that cells bearing CYT-2 were also phosphorylated on tyrosine. Additionally, we provide genetic and biochemical evidence that the src family of kinases is responsible for the latter phosphorylation events. In particular, the src kinase, Lck, is required for phosphorylation of MCP in the Jurkat T cell line. Taken together, these studies suggest a src family-dependent pathway for signaling through MCP.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Membrane cofactor protein (MCP)3 is a widely expressed type 1 transmembrane regulatory glycoprotein that binds to the complement activation products C3b and C4b deposited on host cells. MCP then serves as a cofactor for their proteolytic cleavage by the plasma serine protease factor I (1, 2, 3), a process that irreversibly prevents convertase formation. MCP is also a receptor for three human pathogens including measles virus (MV) (4, 5, 6, 7), group A Streptococcus pyogenes (8), and pathogenic Neisseria (9). Abundant expression on the placental trophoblast (10, 11) and specific expression on the inner acrosomal membrane of spermatozoa (12, 13) imply a role for CD46 in reproductive biology (14, 15). MCP has been produced as a soluble recombinant hybrid (with decay accelerating factor) for use as a therapeutic agent (16), and transgenic expression of human MCP inhibits hyperacute organ rejection (17, 18, 19).

MV infection of primary human monocyte cultures down-regulates IL-12 production (20), providing an explanation for the inhibition of cellular immunity associated with this disease (21). Additionally, exposure of the ME-180 human epithelial cell line to Neisserial pili caused a calcium flux (22). These and other studies (see Discussion) point to important signal transduction events mediated through MCP.

Beginning at its amino terminus, the extracellular portion of MCP consists of four modules known as complement control protein repeats (CCPs). This area is followed by an alternatively spliced serine, threonine, proline-rich (STP) region (23, 24) that assists in cytoprotection (25, 26). Commonly expressed isoforms contain the segments STP-BC (29 aa) or -C (14 aa). Rarer isoforms have been noted (23, 24). CCP 2, CCP 3, and CCP 4 are important for ligand binding and complement regulatory function (27, 28), whereas the CCP 1 and CCP 2 domains are critical for MV binding (28, 29, 30, 31). The two cytoplasmic domains of MCP arise by alternatively splicing producing two tails of 16 (CYT-1) and 23 (CYT-2) amino acids (23). MCP isoforms are named on the basis of their STP and tail domains (i.e., BC1, BC2, C1, and C2). While most cells in a given individual express the same ratio of MCP isoforms, one prominent exception is the brain, where MCP bearing CYT-2 is preferentially expressed (32, 33).

MCP bearing tail 1 was processed from its precursor to mature form three to four times faster than with tail 2 (34, 35). The 4 aa (Phe-Thr-Ser-Leu; FTSL) at the carboxyl terminus of CYT-1 are responsible for this rapid transport (36). In addition, MCP isoforms bearing either tail were directed to the basolateral surface of polarized epithelial cells (37). A deletion mutant lacking the cytoplasmic tail was transported in a nonpolarized fashion, indicating that the targeting signal for the basolateral transport is located in the cytoplasmic domain. Mutational analysis established that the basolateral targeting signal of CYT-1 is tyrosine independent (37).

The cytoplasmic tails of MCP encode putative signals for protein kinase C, casein kinase 2, and src kinases (35). The ability of these cytoplasmic sequences to couple with intracellular signaling pathways is likely to determine the nature of the cellular response to its natural ligands and to the three pathogens that bind MCP. In this study, tyrosine phosphorylation of MCP bearing CYT-2 but not CYT-1 was induced in several human cell lines by cross-linking with anti-MCP mAbs. In contrast with the tyrosine phosphorylation of MCP observed in the Jurkat T cell line, tyrosine phosphorylation of MCP was markedly reduced in a Lck-deficient T cell line (JCaM1.6). The latter taken together with data that an MCP peptide of CYT-2 could be in vitro phosphorylated by p60c-src implicates this family of kinases in the signaling pathway of MCP.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines

Cloned Chinese hamster ovary (CHO) cell lines expressing each of the four isoforms of MCP have been previously described (25). These cells were grown in Ham’s F12 medium supplemented with 10% FBS, 0.5 mg/ml geneticin, and 1 mM L-glutamine. We also used a T cell leukemia cell line, Jurkat (American Type Culture Collection, Manassas, VA), and three mutant Jurkat cell lines. The latter are P116 (deficient in ZAP-70 kinase; Ref. 38), JCaM1.6 (deficient in Lck kinase; Ref. 39), and J45.01 (deficient in CD45 phosphatase; Ref. 40). Both parental and mutant cell lines were grown in RPMI 1640 supplemented with 10% FBS, L-glutamine, and antibiotics. The human cervical epithelial cell line ME-180 (American Type Culture Collection) was maintained in McCOY’S 5A medium supplemented with 10% FBS, L-glutamine, and antibiotics. Tissue culture reagents were obtained from the Tissue Culture Support Center at Washington University School of Medicine.

Abs

Two mAbs against MCP were employed. TRA-2–10, a gift of P. W. Andrews, binds to an epitope in CCP 1 and does not block complement regulatory function (29, 41). GB24, a gift from B. L. Hsi, binds to an epitope in CCP 3/4 and does block function (27, 42). The anti-MCP rabbit polyclonal antiserum was produced by CytoMed (Cambridge, MA). Two anti-phosphotyrosine (anti-pTyr) mAb preparations were employed (both from Transduction Laboratories, Lexington, KY): PY20 with and without a HRP label. The control mAb was MOPC-21 (Sigma, St. Louis, MO).

MCP peptide-binding ELISA

Four peptides, MCP CYT-1 (TYLTDETHREVKFTSL), CYT-2 (KADGGAEYATYQTKSTTPAE), C-UN (KPPVSNYPGYPKPEEGTLDS), and CCP 3 (KIKNGKHTFSEVE) were used for the cell-free phosphorylation experiments. The peptides were coated overnight at 4°C on microtiter wells (Nunc modules, Fisher Scientific, St. Louis, MO) at 80 µg/ml in PBS. Wells were blocked with 1% BSA in 0.01% Tween 20 in PBS for 1 h at 37°C. A polyclonal rabbit anti-MCP Ab was used to establish that the peptides had been adsorbed onto the solid phase in equivalent amounts. Wells were rinsed with kinase reaction buffer (50 mM HEPES, pH 7.5, 0.1 mM EDTA, 0.015% Brij-35, 50 µg/ml BSA, 0.075% 2-ME, 0.05 mM ATP, 10 mM MgCl2) followed by incubation with the kinase p60c-src (Oncogene Science, Uniondale, NY) for 2 h at 30°C (p60c-src diluted in kinase reaction buffer; the U/ml were as specified). After washing in buffer (10 mM Tris, pH 7.2, 150 mM NaCl, 0.05% Tween 20), rabbit anti-pTyr Ab diluted 1:1000 in wash buffer was incubated for 90 min at 37°C. After washing as described above, HRP-conjugated donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories, West Grove, PA) was added (at 1:5000) for 1 h at 37°C. Following washing, detection was by substrate 3,3',5,5'-tetramethylbenzidine (Pierce, Rockford, IL). OD (630 nm) was measured in an ELISA reader.

Flow cytometry

The Jurkat and Jurkat lines (1 x 105 cells), P116, JCaM1.6, and J45.01, were incubated on ice for 30 min with mAb GB24. After washing twice with PBS, FITC-conjugated anti-mouse IgG (Sigma) was added on ice for 30 min. The cells were then suspended in 0.5% paraformaldehyde and analyzed by FACScan.

Cell stimulation and lysis

Pervanadate (Sigma Chemical Co.) was freshly prepared by mixing 12.5 µl of 500 mM sodium orthovanadate solution with 75 µl of hydrogen peroxide (H2O2) in 500 µl PBS and incubating at room temperature for 10 min to generate activated 10 mM pervanadate. The 10 mM pervanadate solution was added to cells in 1% BSA/PBS (10 µl/ml) and incubated for 10 min at room temperature. Then cells were lysed with 1% Nonidet P-40, 0.05% SDS, 2 mM PMSF, 0.1 mM sodium orthovanadate in TBS (10 mM Tris, pH 7.4, 150 mM sodium chloride) for 15 min at 4°C. Following centrifugation in a microcentrifuge at 12,000 x g for 10 min, supernatants were collected and stored in aliquots at -70°C. In addition, in some instances Jurkat, P116, JCaM1.6, and J45.01 cells were preincubated with 50 µg/ml of anti-MCP mAb (GB24 or TRA 2–10) for various time at 37°C and then lysed as described above.

Immunoprecipitations and Western blotting

Cell lysates were immunoprecipitated with mAb GB24 (anti-MCP mAb), PY20 (anti-pTyr mAb), or MOPC-21 (isotype control mAb) for 1 h at 4°C. Dynabeads M-450 goat anti-mouse IgG (Dynal, Oslo, Norway) (20 µl) was added to the lysates, and then the mixture was rotated at 4°C overnight. This preparation was washed three times in lysis buffer before being boiled for 5 min in nonreducing or reducing buffer before SDS-PAGE.

For Western blotting, samples were electrophoresed on 10% SDS-polyacrylamide gel and then transferred to nitrocellulose membranes employing a buffer consisting of 25 mM Tris, 192 mM glycine, 20% methanol, pH 8.3, with a NOVEX transfer system for 1 h at 25 V. For Western blots of MCP, membranes were blocked overnight at 4°C with 5% nonfat dry milk in TBS and 0.05% Tween (TBST) before immunoblotting with rabbit polyclonal antiserum to MCP diluted 1:7000 in TBST for 30 min at 37°C. Blots were washed three times for 5 min each in TBST, incubated with HRP-conjugated donkey anti-rabbit IgG secondary Ab (Sigma) diluted 1:3000 in TBST for 1 h at room temperature, and washed for 5 min three times in TBST. Immunoreactivity was enhanced employing the enhanced chemiluminescence kit (per manufacturer’s directions) (Amersham, Arlington Heights, IL). For anti-pTyr blots, membranes were blocked with 1% BSA/TBST overnight at 4°C before being incubated with HRP-conjugated PY20 (anti-pTyr) diluted 1:2500 in blocking buffer for 1 h at room temperature. After washing as described above, blots were again developed using the enhanced chemiluminescence kit.

RT-PCR

Total RNA was isolated using the RNeasy mini protocol (Qiagen, Valencia, CA). Isolated RNA was quantitated by OD and was checked with a 1% agarose gel. Both cDNA synthesis and PCR were performed in a single test tube from RNA using gene-specific primers and Superscript One-Step RT-PCR system (Applied Biosystems with Perkin-Elmer GeneAmp PCR System 9600, Foster City, CA). The sequence of the 5' MCP-CCP 4 primer was GTGGTCAAATGTCGATTTCCAGTAGTCG and the 3' untranslated primer was CAAGCCACATTGCAATATTAGCTAAGCCACA. These primers allow MCP isoforms, which arise through alternative splicing, to be distinguished (23). RNA in a total volume of 50 µl (1 µl of 1 µg/µl RNA; 25 µl of 2x reaction mix; 1 µl of 1 µg/µl sense and anti-sense primers, respectively; 1 µl of reverse transcriptase/Taq mix; 21 µl of distilled water) was incubated at 50°C for 30 min to prepare cDNA. The PCR amplification was an initial denaturation at 94°C for 2 min followed by 40 cycles of 94°C for 15 s, 55°C for 30 s, and then 70°C for 1 min. At the completion of the cycling reactions, a final extension was performed at 72°C for 10 min. The PCR products were analyzed on a 3% agarose gel. This semiquantitative PCR is linear at least within 25–45 cycles (Ref. 23 and our unpublished observations).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CYT-2 peptide serves as a substrate for p60c-src

The structure of MCP isoforms, the amino acid sequence of the two tails, and putative signals for phosphorylation by src kinase, protein kinase C, and casein kinase 2 are shown in Fig. 1Go, A and B. CYT-1 has one tyrosine residue, and CYT-2 possesses two. To examine if the cytoplasmic tails of MCP are phosphorylated, CYT-1 and CYT-2 peptides containing these tyrosines were assessed in a cell-free system for tyrosine phosphorylation by p60c-src. The ELISA results indicated that CYT-2 but not CYT-1 can serve as a substrate for p60c-src kinase (Fig. 2Go). CYT-2 peptide was phosphorylated by p60c-src in a dose-dependent fashion (Fig. 2GoA). Two other MCP-derived peptides, one possessing two tyrosine residues (C-UN) and one without (CCP 3), were not phosphorylated (Fig. 2GoB).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 1. A, Schematic diagram of the four regularly expressed isoforms of MCP. Common to all isoforms at the extramembranous amino terminus are four cysteine-rich, independently folding, ~60-aa modules called complement control protein repeats (CCPs). The ligand binding and regulatory function of MCP reside in these domains. They contain three used sites for N-linked glycosylation in CCPs 1, 2, and 4. Next comes the alternatively spliced region, designated B and C, which is enriched in serines, threonines, and prolines (STP) and is a site for O- glycosylation. Thereafter is a 12-aa juxtamembranous segment, encoded by a separate exon, of unknown functional significance (designated as "U"). The hydrophobic membrane-spanning segment contains a charged intracellular anchor and is followed by either cytoplasmic tail one or two, designated CYT-1 or CYT-2, at the carboxyl terminus. B, Cytoplasmic domains of MCP. CYT-1 consists of 16 aa and possesses putative signals for phosphorylation by casein kinase 2 (CK-2) and protein kinase C (PKC). CYT-2 consists of 23 aa and possesses putative signals for phosphorylation by src kinases and CK-2.

 


View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 2. Phosphorylation of MCP CYT-2 by p60c-src. A, MCP CYT-1 and CYT-2 peptides were incubated with the indicated U/ml of p60c-src in kinase reaction buffer for 2 h. Detection was with a polyclonal anti-pTyr Ab. B. Two additional peptides with Tyr (C-UN) and without Tyr (CCP 3) were used. For this reaction, p60c-src (30 U/ml) was used; otherwise, conditions were as in A.

 
Tyrosine phosphorylation of MCP is induced in three cell lines by pervanadate

Treatment of cells with pervanadate inhibits tyrosine phosphatases and mimics receptor engagement in T, B, and NK cells. Therefore, we asked if pervanadate treatment promoted phosphorylation of MCP on Jurkat, ME-180, and CHO cells (Figs. 3Go and 4). Cell lysates derived from treated cells were immunoprecipitated with GB24 (anti-MCP), PY20 (anti-pTyr), or MOPC-21. The precipitates were solubilized and electrophoresed on SDS-polyacrylamide gels and then transferred and blotted with a rabbit polyclonal anti-MCP antiserum (Figs. 3Go and 4GoA) or with anti-pTyr (Fig. 4GoB). As shown in Fig. 3Go, the CHO cell lines expressing BC2 or C2 MCP isoforms (lanes 8 and 14) were tyrosine phosphorylated. These phosphorylated bands aligned with MCP in lanes 7 and 13. Based on scanning of the gels, 5–30% of the MCP of BC2 and C2 isoforms was phosphorylated. There was no detectable tyrosine phosphorylation of BC1 or C1 (lanes 5 and 11). Under the same experimental conditions, Fig. 4GoA demonstrates that Jurkat and ME-180 cells are also tyrosine phosphorylated (lanes 2 and 5) and that these phosphorylated proteins align with MCP as expressed by these two cell lines. In these two cell lines, 50–80% of the MCP was phosphorylated. In addition, blotting with anti-pTyr on Jurkat and ME-180 cells (Fig. 4GoB, lanes 1 and 5) indicated that MCP was phosphorylated, consistent with the results shown in Fig. 4GoA. Protein tyrosine phosphorylation was not detected in unstimulated cells (Fig. 4GoB, lanes 3 and 7) or in cells immunoprecipitated with a control mAb (lanes 2 and 6).



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 3. Western blot analysis of MCP isoforms treated with pervanadate. CHO cells were incubated with pervanadate for 10 min at room temperature. The cells (4 x 106) were then lysed and immunoprecipitated with GB24 (mAb to MCP), PY20 (mAb to pTyr), or MOPC-21 (control mAb). The solubilized precipitates were electrophoresed under nonreducing conditions. Following transfer, immunoblotting was performed with a polyclonal rabbit anti-MCP antiserum. The heavy bands in each lane with an Mr of ~160 kDa represent a cross-reaction between the Ab used for immunoprecipitation and the Ab used for detection.

 


View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4. Tyrosine phosphorylation of MCP expressed by Jurkat and ME-180 cells. General design of the experiment was as described in Fig. 3Go. Cells (1 x 106) were lysed, and the lysates were immunoprecipitated employing the Ab noted. A, Electrophoresis was performed under nonreducing conditions, and immunoblotting was done with a polyclonal rabbit anti-MCP antiserum. GB24, mAb to MCP; PY20, mAb to pTyr; MOPC-21, mAb of unknown specificity. B. Electrophoresis was performed under reducing conditions, and immunoblotting was performed with HRP-PY20 (anti-pTyr) mAb. The band at 50 kDa in lane 5 is unidentified. "Stim" refers to conditions where the cells were or were not incubated with pervanadate. Under reducing conditions, MCP migrates slower in gels and the major bands focus less broadly (3 ).

 
Three additional points facilitate the identification of the protein bands in Fig. 4Go. First, for both cell lines MCP migrated identically following precipitation by either anti-MCP or anti-pTyr mAbs (compare lanes 1 and 2 and lanes 4 and 5). Second, upon reduction and separation by SDS-PAGE (compare Fig. 4Go, A and B), protein bands characteristically focused more narrowly and migrated more slowly (~5 kDa greater in molecular mass). The latter is due to the disruption of the two disulfide bonds in each of four CCP modules. Third, the difference in Mr between the upper bands in Jurkat and ME-180 is secondary to variations in glycosylation (see next section).

MCP isoforms expressed by Jurkat and ME-180 cells

The previous data (Fig. 4Go) establishes that MCP was tyrosine phosphorylated on Jurkat and ME-180 cell lines. Because most human cells and cell lines express four isoforms of MCP, we next undertook the identification of the specific isoforms in these cell lines that were phosphorylated. To do this, we used a semiquantitative RT-PCR, previously developed in our laboratory (23), which allows for easy separation of the product coding for each isoform. We then compared these results to that of the protein data of Fig. 4Go.

The RT-PCR was performed in parallel with the two cell lines and with MCP-transfected CHO cells expressing a single isoform (Fig. 5Go). The PCR bands derived from Jurkat and ME-180 mRNA were identical in mobility with those obtained from the four CHO cells lines. For Jurkat cells, BC2 was predominant, representing 50%, while BC1 represented 15%, C2 20%, and C1 5%. For ME-180, the BC2 isoform also was predominant, representing 50%, while C2 represented 30%, BC1 15%, and C1 5%. Thus, for both Jurkat and ME-180, CYT-2-containing isoforms were the major species (70 and 80%, respectively), with the majority of the protein being BC2. Taken together with data presented in Figs. 2Go and 3Go and the fact that 50% or greater of MCP was phosphorylated in these two cell lines, we conclude that isoforms bearing CYT-2, but not CYT-1, likely undergo tyrosine phosphorylation.



View larger version (67K):
[in this window]
[in a new window]
 
FIGURE 5. RT-PCR analysis of MCP-expressing cell lines. Jurkat (JK), ME-180, and four CHO cell lines were analyzed. C2, BC2, C1, and BC1 represent the four regularly expressed isoforms of MCP transfected in CHO cells. For PCR amplification, primers from CCP 4 and the 3' untranslated region of MCP were used (see Materials and Methods).

 
We next compared these data to that of the Western blots in Fig. 4Go. Both Jurkat and ME-180 express a predominant upper band phenotypic MCP pattern. In a survey of normal individuals, the quantity of upper bands (BC1 and BC2) expressed versus that of the lower band forms (C1 and C2) is an inherited trait, with 65% of the population expressing predominantly the upper band forms, 29% equal quantities, and 6% predominantly the lower band (23, 43). Thus, the Jurkat cell line is derived from an individual with the most common upper band phenotype (the lower molecular mass is visible upon longer exposures). This upper band of Jurkat migrates faster than that of ME-180. MCP displays a characteristic microheterogeneity of Mr due to variations in glycosylation among cell types (34, 44), and most epithelial-derived cells are a few kDa larger than peripheral blood cells or cell lines. Thus, the RT-PCR results in Fig. 5Go and the protein data of Fig. 4Go strongly suggest that the BC2 isoform is the dominant isoform tyrosine phosphorylated in Jurkat. Similarly for ME-180, we conclude that both BC2 and C2 are phosphorylated.

Cross-linking of cell-surface MCP induces rapid tyrosine phosphorylation

MCP on Jurkat cells was cross-linked with GB24 and evidence for tyrosine phosphorylation was sought. Jurkat cells were incubated with GB24 at 37°C for 1–30 min. The anti-MCP immunocomplexes were electrophoresed on SDS-polyacrylamide gels, transferred, and then immunoblotted with anti-pTyr mAb (Fig. 6Go). MCP was rapidly tyrosine phosphorylated, with the peak occurring between 1 and 2 min, which was followed by a steady decrease for the next 10 min. The Jurkat cells were also incubated over the same time periods with GB24, but this time at 4°C. Similar results were observed, although the staining was less intense (not shown). In addition, the Jurkat cells were stimulated with pervanadate for 10 min after incubation with GB24. In this case, there was also rapid tyrosine phosphorylation (not shown) in the presence of a phosphatase inhibitor, although as expected it persisted for up to at least 30 min.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 6. Cross-linking by Ab of MCP on Jurkat cells leads to its tyrosine phosphorylation. Jurkat cells were incubated with GB24 for the times indicated at 37°C. The cells (2 x 107) were lysed, precipitated with GB24 followed be electrophoresis under reducing conditions, and Western blotted with HRP-PY20 (anti-pTyr) mAb (top panel). The bottom panel represents a portion of the same material that was electrophoresed under nonreducing conditions and, following transfer, blotted with polyclonal anti-MCP. C, Control, no lysates added.

 
Tyrosine phosphorylation of MCP is dependent upon Lck

To further characterize the tyrosine phosphorylation of MCP, mutant Jurkat cell lines deficient in a kinase or phosphatase were employed. The Jurkat (parental), P116 (deficient in ZAP-70 kinase), JCaM1.6 (deficient in Lck kinase), and J45.01 (deficient in CD45 phosphatase) expressed similar quantities of MCP (Fig. 7Go). MCP on these cells was cross-linked with GB24 (Fig. 8GoA) or TRA-2–10 (Fig. 8GoB) at 37°C for 2 or 20 min. The lysates were immunoprecipitated with these same mAbs. Following electrophoresis and transfer, the gels were immunoblotted with anti-pTyr mAb (top panels) or anti-MCP polyclonal Ab (bottom panels). The parental Jurkat, P116, and J45.01 cell lines demonstrated tyrosine phosphorylation of MCP at 2 min, which was abrogated by 20 min. However, this phosphorylation at 2 min was absent or markedly reduced (on longer exposures a faint band could be seen) in JCaM1.6 cells. Similar results were obtained with both mAbs. These data indicate a requirement for Lck kinase to phosphorylate MCP in Jurkat cells.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 7. MCP expression by kinase- or phosphatase-deficient Jurkat cell lines. Jurkat cells, P116 (deficient in ZAP-70 kinase), JCaM1.6 (deficient in Lck kinase), and J45.01 (deficient in CD45 phosphatase) were assessed for surface expression of MCP by flow cytometry using anti-MCP mAb GB24 followed by FITC-conjugated second Ab. Solid line, no first Ab added; dotted line, with first and second Ab.

 


View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 8. Lck is required for tyrosine phosphorylation of MCP in Jurkat cells. The same four cell lines (shown in Fig. 7Go) were incubated with mAbs to MCP GB24 (A) or TRA-2–10 (B) at 37°C for 2 or 20 min. Cell lysates (2 x 107) were immunoprecipitated with the same mAb, electrophoresed, and then blotted. The top panels were electrophoresed under reducing conditions and then blotted with anti-pTyr mAb. The bottom panels were electrophoresed under nonreducing conditions and then blotted with polyclonal Ab to MCP. The bottom panels are duplicate blots of the top panels presented to indicate that MCP was present in approximately similar amounts for each condition. In the lane marked "C," no lysates were added. MCP was not phosphorylated in the Lck-deficient cells. This experiment is representative of three such experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MCP regulates complement activation by serving as a membrane-bound cofactor for the plasma serine protease factor I to cleave C3b and C4b (reviewed in Refs. 2 , 3 , and 7). MCP binds these two ligands efficiently if they are attached to the same cell on which MCP itself is expressed (45). But MCP lacks receptor function. It inefficiently binds C3b- or C4b- bearing fluid-phase or cell-bound immune complexes (1, 45). Thus, MCP’s role is to transiently interact with either of these ligands bound to its "home" cell. This cofactor activity is an absolute requirement for cleavage by factor I of C3b to C3bi and C4b to C4c and C4d. The resulting C3bi or C4d cleavage fragments cannot form C3 or C5 convertases. This effectively halts further complement activation. In this scenario, there is no a priori reason why MCP is required to send a signal to the cell interior. On the other hand, C3b on a host cell is abnormal and potentially injurious. This does occur, for example, at a site of inflammation featuring complement activation. In this view, one function of MCP would be to provide a signal to the cell within this localized inflammatory process. The epithelial, endothelial, or blood cell in such a microenvironment would then respond by synthesizing proteins to protect its integrity and facilitate an inflammatory response. This line of reasoning provides a physiologic, sentry-like purpose for signaling through MCP.

A second reason for suspecting an important role for MCP in cell signaling relates to its cytoplasmic structure. A surprise in the molecular analysis of MCP was the identification of two cytoplasmic tails that arise by alternative splicing (23, 24). Analysis by RT-PCR indicated that both tails were expressed by most cells and that both carried motifs for interactions with kinases (23, 35).

A third reason relates to tissue-specific isoform expression, most noteworthy in the brain, where cytoplasmic tail 2 is expressed predominantly, if not exclusively, on neural tissue (32, 33). Also, some cell lines, such as the ME-180 cells used in this study, express predominantly one tail or the other.

The fourth reason for pursuing signaling activity mediated by MCP is the recently published experiments on biological effects of microbes that interact with MCP. Karp et al. demonstrated that IL-12 production was down-regulated in primary human monocyte cultures following exposure to MV (20). Because MCP is a receptor for MV hemagglutinin (4, 5, 6), the likely interpretation of these results is that hemagglutinin on the viral envelope cross-links MCP to initiate a signaling event causing reduced synthesis of IL-12. Moreover, in the same experimental system, dimeric C3b and a mAb to MCP mimicked the effects of viral infection on IL-12 production, providing more evidence for MCP being critical to this response. Neisseria gonorrhea and meningitidis have also been shown to use MCP as a receptor (9). Kallstrom and colleagues demonstrated that an MCP-dependent cell signaling event (induction of Ca2+ flux) occurred upon exposure of human epithelial cells to the purified pili of these pathogenic Neisseria (22). Additionally, employing a mouse macrophage cell line transfected with human MCP, Hirano et al. observed changes in NO production following stimulation with IFN-{gamma} that were related to which tail of MCP was expressed (46). Finally, intracellular domains were a critical factor for effective virus-cell fusion and subsequent MV replication (47, 48), again suggesting the possibility of a signal transducing event mediated by MCP.

CYT-1 possesses potential phosphorylation sites for protein kinases C and casein kinase 2, while CYT-2 possesses potential phosphorylation sites for src kinases and casein kinase 2 (35). To define a mechanism by which MCP could mediate signal transduction events, we analyzed if CYT-1 or CYT-2 was phosphorylated on tyrosine. After our initial studies indicated that a peptide derived from CYT-2 of MCP could be tyrosine phosphorylated by a src kinase, we sought to extend these results by asking if MCP expressed on a human T leukemia cell line (Jurkat), a cervical epithelial cell line (ME-180), and MCP-transfected CHO cells was also tyrosine phosphorylated. Treatment of cells with pervanadate or Ab cross-linking of MCP resulted in tyrosine phosphorylation of CYT-2 but not CYT-1. This reversible phosphorylation event occurred rapidly and was dependent in Jurkat cells on the src family kinase Lck but not ZAP-70 or CD45. Our working hypothesis is that the tyrosine in the peptide AEYAT, because of its homology to a src phosphorylation motif, is the site of phosphorylation by src kinases such as Lck.

While there are no published studies on tyrosine phosphorylation of the cytoplasmic tails of MCP, Wong et al. showed that the intracellular domains of human MCP were associated with kinases in a transfected mouse macrophage cell line stimulated with IFN-{gamma} (49). In the case of CYT-1, the association was dependent on a sequence motif proximal to the tail. However, kinase activity remained upon deletion of this same region when CYT-2 was present. It may be that this "residual kinase" activity associated with CYT-2 reflects what we have observed in this study.

Many src family protein tyrosine kinases have been associated with membrane proteins involved in cell activation including Lck, Fyn, ZAP-70, syk, and others (50). Lck is found predominantly in T cells (51, 52, 53, 54, 55), where it has been shown to play a critical role during T cell activation (51, 56, 57). Lck is a 56-kDa src-related protein tyrosine kinase that is attached to the inner face of the plasma membrane via amino-terminal myristylation and palmitylation (58). Lck has a dicysteine motif at this N terminus that mediates its association with CD4 and CD8 T cell-surface Ags. As with other related src kinases, the remaining amino-half consists of Src homology domains 3 and 2 while the carboxyl end consists primarily of the kinase domain. Cross-linking of CD4 or stimulation of the TCR by Ag leads to a rapid increase of intracellular tyrosine phosphorylation (59, 60). Lck is felt, in turn, to be responsible for the phosphorylation of several proteins engaged in TCR activation. More recently, a role for Lck in TCR function in downstream events also has been proposed (57).

The extensive data relating to a role for src kinases in general and Lck in particular in TCR activation can be used to facilitate interpretation of our studies of MCP. First, as shown in this report, MCP demonstrated differential tyrosine phosphorylation of its tails following cross-linking by Ab in the Jurkat T cell line. As noted, others have recently reported IL-12 down-regulation (20), Ca2+ fluxes (22), and NO (46) changes in association with experimental procedures that cross-link MCP. Src kinases are known to play a role in these types of signaling events as they do in T cell activation, which is accompanied by a calcium flux (50, 52, 61). Second, in Jurkat T cell lines, Lck, but not ZAP-70 or CD45, was required for tyrosine phosphorylation of MCP. The straightforward explanation is that Lck directly phosphorylates CYT-2 or that it is required for the downstream mediators of this phosphorylation. Lck is unlikely to be the only src kinase involved because it is not expressed in ME-180 cells or CHO cells (51, 60). Because T cell activation requires Lck, ZAP-70, and CD45, the signaling by MCP likely involves a distinct, albeit partially shared, signal transducing pathway. Thus, a comparison of these two pathways in a T cell line such as Jurkat could be informative relative to how this cell mediates signal transducing events from different effectors.

Two other widely expressed complement regulatory proteins, CD55 and CD59, are GPI linked and upon cell activation can associate with src family tyrosine kinases in specialized coated pits in the membrane (58, 62, 63). Signal transducing events leading to cell activation or, more commonly, the enhancement of other activating agents has been demonstrated for T lymphocytes, PBMC, granulocytes, and other cell types. Of interest, then, is our observation of a signaling event that also uses src kinase(s) and involves a transmembrane complement regulatory protein.

These studies raise many intriguing questions relative to the potential role of physiologic and pathologic ligands in mediating MCP signaling and the identification of the intracellular pathways involved in these responses. For example, the penchant for two of three MCP-reacting pathogens (MV and Neisseria) to induce a cellular signal may parallel native ligands such as C4b and C3b. The finding that neuronal tissue primarily expresses CYT-2 suggests physiologic relevance. Finally, other possible signaling events mediated by CYT-1 and CYT-2 remain to be discerned. In the future, we plan to determine the kinase(s) involved in other cell lines, to define the site of phosphorylation, and to connect the phosphorylation event(s) to a biologic response such as a calcium flux. We plan to focus initially on T cells and T cell lines where much information and potentially informative reagents are available to dissect a tyrosine phosphorylation event mediated by src kinases.


    Footnotes
 
1 This work was supported in part by funding from the National Institutes of Health (RO1 AI37618) and from CytoMed (Cambridge, MA). J.P.A., M.K.L., and Washington University have a financial interest in CytoMed. A.C.C. is a Pew Scholar in the Biomedical Sciences. Back

2 Address correspondence and reprint requests to Dr. John P. Atkinson, Division of Rheumatology, Department of Medicine, Washington University School of Medicine, 660 S. Euclid Avenue, Box 8045, St. Louis, MO 63110. E-mail address: Back

3 Abbreviations used in this paper: MCP, membrane cofactor protein; MCP CYT-1, MCP bearing cytoplasmic tail one; MCP CYT-2, MCP bearing cytoplasmic tail two; MV, measles virus; CHO, Chinese hamster ovary cell line; GB24 and TRA-2–10, anti-MCP mAbs; anti-pTyr, anti-phosphotyrosine; PY20, anti-pTyr with or without HRP mAb; MOPC-21, IgG1 mAb of unknown antigenic specificity; CCP, complement control protein. Back

Received for publication September 7, 1999. Accepted for publication December 9, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Seya, T., J. P. Atkinson. 1989. Functional properties of membrane cofactor protein of complement. Biochem. J. 264:581.[Medline]
  2. Liszewski, M. K., T. C. Farries, D. M. Lublin, I. A. Rooney, J. P. Atkinson. 1996. Control of the complement system. Adv. Immunol. 61:201.[Medline]
  3. Liszewski, M. K., T. W. Post, J. P. Atkinson. 1991. Membrane cofactor protein (MCP or CD46): newest member of the regulators of complement activation gene cluster. Annu. Rev. Immunol. 9:431.[Medline]
  4. Dorig, R. E., A. Marcil, A. Chopra, C. D. Richardson. 1993. The human CD46 molecule is a receptor for measles virus (Edmonston strain). Cell 75:295.[Medline]
  5. Naniche, D., G. Varior-Krishnan, F. Cervoni, T. F. Wild, B. Rossi, C. Rabourdin-Combe, D. Gerlier. 1993. Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus. J. Virol. 67:6025.[Abstract/Free Full Text]
  6. Manchester, M., M. K. Liszewski, J. P. Atkinson, M. B. A. Oldstone. 1994. Multiple isoforms of CD46 (membrane cofactor protein) serve as receptors for measles virus. Proc. Natl. Acad. Sci. USA 91:2161.[Abstract/Free Full Text]
  7. Dorig, R. E., A. Marcil, C. D. Richardson. 1994. CD46, a primate-specific receptor for measles virus. Trends Microbiol. 2:312.[Medline]
  8. Okada, N., M. K. Liszewski, J. P. Atkinson, M. Caparon. 1995. Membrane cofactor protein (MCP; CD46) is a keratinocyte receptor for the M protein of group A streptococcus. Proc. Natl. Acad. Sci. USA 92:2489.[Abstract/Free Full Text]
  9. Kallstrom, H., M. K. Liszewski, J. P. Atkinson, A.-B. Jonsson. 1997. Membrane cofactor protein (MCP or CD46) is a cellular pilus receptor for pathogenic Neisseria. Mol. Microbiol. 25:639.[Medline]
  10. Hsi, B. L., J. S. Hunt, J. P. Atkinson. 1991. Differential expression of complement regulatory proteins on subpopulations of human trophoblast cells. J. Reprod. Immunol. 19:209.[Medline]
  11. Holmes, C. H., K. L. Simpson, H. Okada, N. Okada, S. D. Wainwright, D. F. J. Purcell, J. M. Houlihan. 1992. Complement regulatory proteins at the feto-maternal interface during human placental development: distribution of CD59 by comparison with membrane cofactor protein (CD46) and decay accelerating factor (CD55). Eur. J. Immunol. 22:1579.[Medline]
  12. Simpson, K. L., C. H. Holmes. 1994. Differential expression of complement regulatory proteins decay-accelerating factor (CD55), membrane cofactor protein (CD46) and CD59 during human spermatogenesis. Immunology 81:452.[Medline]
  13. Cervoni, F., T. J. Oglesby, E. M. Adams, C. Milesi-Fluet, M. W. Nickells, P. Fenichel, J. P. Atkinson, B. L. Hsi. 1992. Identification and characterization of membrane cofactor protein (MCP) on human spermatozoa. J. Immunol. 148:1431.[Abstract]
  14. Taylor, C. T., M. M. Biljan, C. R. Kingsland, P. M. Johnson. 1994. Inhibition of human spermatozoon-oocyte interaction in vitro by monoclonal antibodies to CD46 (membrane cofactor protein). Hum. Reprod. 9:907.[Abstract/Free Full Text]
  15. Kitamura, M., K. Matsumiya, M. Yamanaka, S. Takahara, T. Hara, M. Matsumoto, M. Namiki, A. Okuyama, T. Seya. 1997. Possible association of infertility with sperm-specific abnormality of CD46. J. Reprod. Immunol. 33:83.[Medline]
  16. Higgins, P. J., J.-L. Ko, R. Lobell, C. Sardonini, M. K. Alexxi, C. G. Yeh. 1997. A soluble chimeric complement inhibitory protein that possesses both decay-accelerating and factor I cofactor activities. J. Immunol. 158:2872.[Abstract]
  17. Cozzi, E., D. J. G. White. 1995. The generation of transgenic pigs as potential organ donors for humans. Nat. Med. 1:964.[Medline]
  18. McCurry, K. R., L. E. Diamond, D. L. Kooyman, G. W. Byrne, M. J. Martin, J. S. Logan, J. L. Platt. 1996. Human complement regulatory proteins expressed in transgenic swine protect swine xenografts from humoral injury. Transplant Proc. 28:758.[Medline]
  19. Rooney, I. A., M. K. Liszewski, J. P. Atkinson. 1993. Using membrane-bound complement regulatory proteins to inhibit rejection. Xeno 1:29.
  20. Karp, C. L., M. Wysocka, L. M. Wahl, J. M. Ahearn, P. J. Cuomo, B. Sherry, G. Trinchieri, D. E. Griffin. 1996. Mechanism of suppression of cell-mediated immunity by measles virus. Science 273:228.[Abstract]
  21. Karp, C. L.. 1999. Measles: immunosuppression, IL-12, and complement receptors. Immunol Rev. 168:91.[Medline]
  22. Kallstrom, H., M. S. Islam, P. O. Berggren, A. B. Jonsson. 1998. Cell signaling by the type IV pili of pathogenic Neisseria. J. Biol. Chem. 273:21777.[Abstract/Free Full Text]
  23. Post, T. W., M. K. Liszewski, E. M. Adams, I. Tedja, E. A. Miller, J. P. Atkinson. 1991. Membrane cofactor protein of the complement system: alternative splicing of serine/threonine/proline-rich exons and cytoplasmic tails produces multiple isoforms which correlate with protein phenotype. J. Exp. Med. 174:93.[Abstract/Free Full Text]
  24. Russell, S. M., R. L. Sparrow, I. F. C. McKenzie, D. F. J. Purcell. 1992. Tissue-specific and allelic expression of the complement regulator CD46 is controlled by alternative splicing. Eur. J. Immunol. 22:1513.[Medline]
  25. Liszewski, M. K., J. P. Atkinson. 1996. Membrane cofactor protein (MCP; CD46): isoforms differ in protection against the classical pathway of complement. J. Immunol. 156:4415.[Abstract]
  26. Liszewski, M. K., M. K. Leung, J. P. Atkinson. 1998. Membrane cofactor protein (CD46): importance of N- and O-glycosylation for complement regulatory function. J. Immunol. 161:3711.[Abstract/Free Full Text]
  27. Adams, E. M., M. C. Brown, M. Nunge, M. Krych, J. P. Atkinson. 1991. Contribution of the repeating domains of membrane cofactor protein (CD46) of the complement system to ligand binding and cofactor activity. J. Immunol. 147:3005.[Abstract]
  28. Iwata, K., T. Seya, Y. Yanagi, J. M. Pesando, P. M. Johnson, M. Okabe, S. Ueda, H. Ariga, S. Nagasawa. 1995. Diversity of sites for measles virus binding and for inactivation of complement C3b and C4b on membrane cofactor protein CD46. J. Biol. Chem. 270:15148.[Abstract/Free Full Text]
  29. Manchester, M., A. Valsamakis, R. Kaufman, M. K. Liszewski, J. Alvarez, J. P. Atkinson, D. M. Lublin, M. B. A. Oldstone. 1995. Measles virus and C3 binding sites are distinct on membrane cofactor protein (MCP; CD46). Proc. Natl. Acad. Sci. USA 92:2303.[Abstract/Free Full Text]
  30. Manchester, M., J. E. Gairin, J. Alvarez, M. K. Liszewski, J. P. Atkinson, M. B. A. Oldstone. 1997. Measles virus recognizes its receptor, CD46, via two distinct binding domains within SCR1–2. Virology 233:174.[Medline]
  31. Buchholz, C. J., D. Koller, P. Devaux, C. Mumenthaler, J. Schneider-Schaulies, W. Braun, D. Gerlier, R. Cattaneo. 1997. Mapping of the primary binding site of measles virus to its receptor CD46. J. Biol. Chem. 272:22072.[Abstract/Free Full Text]
  32. Buchholz, C. J., D. Gerlier, A. Hu, T. Cathomen, M. K. Liszewski, J. P. Atkinson, R. Cattaneo. 1996. Selective expression of a subset of measles virus receptor competent CD46 isoforms in human brain. Virology 217:349.[Medline]
  33. Johnstone, R. W., S. M. Russell, B. E. Loveland, I. F. McKenzie. 1993. Polymorphic expression of CD46 protein isoforms due to tissue-specific RNA splicing. Mol. Immunol. 30:1231.[Medline]
  34. Ballard, L. L., N. S. Bora, G. H. Yu, J. P. Atkinson. 1988. Biochemical characterization of membrane cofactor protein of the complement system. J. Immunol. 141:3923.[Abstract]
  35. Liszewski, M. K., I. Tedja, J. P. Atkinson. 1994. Membrane cofactor protein (CD46) of complement: processing differences related to alternatively spliced cytoplasmic domains. J. Biol. Chem. 269:10776.[Abstract/Free Full Text]
  36. Maisner, A., G. Zimmer, M. K. Liszewski, D. M. Lublin, J. P. Atkinson, G. Herrler. 1997. Membrane cofactor protein (CD46) is a basolateral protein that is not endocytosed: importance of the tetrapeptide FTSL at the carboxy terminus. J. Biol. Chem. 272:20793.[Abstract/Free Full Text]
  37. Maisner, A., M. K. Liszewski, J. P. Atkinson, R. Schwartz-Albiez, G. Herrler. 1996. Two different cytoplasmic tails direct isoforms of the membrane cofactor protein (MCP; CD46) to the basolateral surface of Madin-Darby canine kidney (MDCK) cells. J. Biol. Chem. 271:18853.[Abstract/Free Full Text]
  38. Williams, B. L., K. L. Schreiber, W. Zhang, R. L. Wange, L. E. Samelson, P. J. Leibson, R. T. Abraham. 1998. Genetic evidence for differential coupling of Syk family kinases to the T-cell receptor: reconstitution studies in a ZAP-70-deficient Jurkat T-cell line. Mol. Cell Biol. 18:1388.[Abstract/Free Full Text]
  39. Straus, D. B., A. Weiss. 1992. Genetic evidence for the involvement of the Lck tyrosine kinase in signal transduction through the T cell antigen receptor. Cell 70:585.[Medline]
  40. Pingel, J. T., M. L. Thomas. 1989. Evidence that the leukocyte-common antigen is required for antigen-induced T lymphocyte proliferation. Cell 58:1055.[Medline]
  41. Andrews, P. W., B. B. Knowles, M. Parkar, B. Pym, K. Stanley, P. N. Goodfellow. 1985. A human cell-surface antigen defined by a monoclonal antibody and controlled by a gene on human chromosome 1. Ann. Hum. Genet. 49:31.[Medline]
  42. Hsi, B. L., C.-J. G. Yeh, P. Fenichel, M. Samson, C. Grivaux. 1988. Monoclonal antibody GB24 recognizes a trophoblast-lymphocyte cross-reactive antigen. Am. J. Reprod. Immunol. Microbiol. 18:21.[Medline]
  43. Ballard, L., T. Seya, J. Teckman, D. M. Lublin, J. P. Atkinson. 1987. A polymorphism of the complement regulatory protein MCP (membrane cofactor protein or gp 45–70). J. Immunol. 138:3850.[Abstract]
  44. Seya, T., L. L. Ballard, N. S. Bora, V. Kumar, W. Cui, J. P. Atkinson. 1988. Distribution of membrane cofactor protein (MCP) of complement on human peripheral blood cells: an altered form is found on granulocytes. Eur. J. Immunol. 18:1289.[Medline]
  45. Oglesby, T. J., C. J. Allen, M. K. Liszewski, D. J. G. White, J. P. Atkinson. 1992. Membrane cofactor protein (MCP;CD46) protects cells from complement-mediated attack by an intrinsic mechanism. J. Exp. Med. 175:1547.[Abstract/Free Full Text]
  46. Hirano, A., Z. Yang, Y. Katayama, J. Korte-Sarfaty, T. C. Wong. 1999. Human CD46 enhances nitric oxide production in mouse macrophages in response to measles virus infection in the presence of {gamma} interferon: dependence on the CD46 cytoplasmic domains. J. Virol. 73:4776.[Abstract/Free Full Text]
  47. Seya, T., M. Kurita, K. Iwata, Y. Yanagi, K. Tanaka, K. Shida, M. Hatanaka, M. Matsumoto, S. Jun, A. Hirano, S. Ueda, S. Nagasawa. 1997. The CD46 transmembrane domain is required for efficient formation of measles virus mediated syncytium. Biochem. J. 322:135.
  48. Yant, S., A. Hirano, T. C. Wong. 1997. Identification of a cytoplasmic Tyr-X-X-Leu motif essential for down regulation of the human cell receptor CD46 in persistent measles virus infection. J. Virol. 71:766.[Abstract]
  49. Wong, T. C., S. Yant, B. J. Harder, J. Korte-Sarfaty, A. Hirano. 1997. The cytoplasmic domains of complement regulatory protein CD46 interact with multiple kinases in macrophages. J. Leukocyte Biol. 62:892.[Abstract]
  50. Schillace, R. V., J. D. Scott. 1999. Organization of kinases, phosphatases, and receptor signaling complexes. J. Clin. Invest. 103:761.[Medline]
  51. Veillette, A., D. Davidson. 1992. Src-related protein tyrosine kinases and T-cell receptor signalling. Trends Genet. 8:61.[Medline]
  52. Clements, J. L., G. A. Koretzky. 1999. Recent developments in lymphocyte activation: linking kinases to downstream signaling events. J. Clin. Invest. 103:925.[Medline]
  53. Marth, J. D., R. Peet, E. G. Krebs, R. M. Perlmutter. 1985. Lymphocyte-specific protein-tyrosine kinase gene is rearranged and over expressed in the murine T cell lymphoma LSTRA. Cell 43:393.[Medline]
  54. Voronova, A. F., B. M. Sefton. 1986. Expression of a new tyrosine protein kinase is stimulated by retrovirus promoter insertion. Nature 319:682.[Medline]
  55. Amrein, K. E., B. M. Sefton. 1988. Mutation of a site of tyrosine phosphorylation in the lymphocyte-specific tyrosine protein kinase, p56lck, reveals its oncogenic potential in fibroblasts. Proc. Natl. Acad. Sci. USA 85:4247.[Abstract/Free Full Text]
  56. Mustelin, T., P. Burn. 1993. Regulation of src family tyrosine kinases in lymphocytes. Trends Biochem. Sci. 18:215.[Medline]
  57. Wong, J., D. Straus, A. C. Chan. 1998. Genetic evidence of a role for Lck in T-cell receptor function independent or downstream of ZAP-70/Syk protein tyrosine kinases. Mol. Cell Biol. 18:2855.[Abstract/Free Full Text]
  58. Shenoy-Scaria, A. M., L. K. Timson Gauen, J. Kwong, A. S. Shaw, D. M. Lublin. 1993. Palmitylation of an amino-terminal cysteine motif of protein tyrosine kinases p56lck and p59fyn mediates interaction with glycosyl-phosphatidylinositol-anchored proteins. Mol. Cell Biol. 13:6385.[Abstract/Free Full Text]
  59. Xu, H., D. R. Littman. 1993. A kinase-independent function of Lck in potentiating antigen-specific T cell activation. Cell 74:633.[Medline]
  60. Veillette, A., M. A. Bookman, E. M. Horak, J. B. Bolen. 1988. The CD4 and CD8 T cell surface antigens are associated with the internal membrane tyrosine-protein kinase p56lck. Cell 55:301.[Medline]
  61. Roach, T., S. Slater, M. Koval, L. White, E. C. McFarland, M. Okumura, M. Thomas, E. Brown. 1997. CD45 regulates Src family member kinase activity associated with macrophage integrin-mediated adhesion. Curr. Biol. 7:408.[Medline]
  62. Stefanova, I., V. Horejsi, I. J. Ansotegui, W. Knapp, H. Stockinger. 1991. GPI-anchored cell-surface molecules complexed to protein tyrosine kinases. Science 254:1016.[Abstract/Free Full Text]
  63. Shenoy-Scaria, A. M., J. Kwong, T. Fujita, M. W. Olszowy, A. S. Shaw, D. M. Lublin. 1992. Signal transduction through decay accelerating factor: interaction of GPI anchor and protein tyrosine kinases p56lck and p59fyn. J. Immunol. 149:3535.[Abstract]



This article has been cited by other articles:


Home page
ReproductionHome page
P. M Johnson, L. E Clift, P. Andrlikova, M. Jursova, B. F Flanagan, J. A Cummerson, P. Stopka, and K. Dvorakova-Hortova
Rapid sperm acrosome reaction in the absence of acrosomal CD46 expression in promiscuous field mice (Apodemus)
Reproduction, December 1, 2007; 134(6): 739 - 747.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Hakulinen and J. Keski-Oja
ADAM10-mediated Release of Complement Membrane Cofactor Protein during Apoptosis of Epithelial Cells
J. Biol. Chem., July 28, 2006; 281(30): 21369 - 21376.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
N. J. Weyand, S. W. Lee, D. L. Higashi, D. Cawley, P. Yoshihara, and M. So
Monoclonal Antibody Detection of CD46 Clustering beneath Neisseria gonorrhoeae Microcolonies
Infect. Immun., April 1, 2006; 74(4): 2428 - 2435.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Elward, M. Griffiths, M. Mizuno, C. L. Harris, J. W. Neal, B. P. Morgan, and P. Gasque
CD46 Plays a Key Role in Tailoring Innate Immune Recognition of Apoptotic and Necrotic Cells
J. Biol. Chem., October 28, 2005; 280(43): 36342 - 36354.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Iacobelli-Martinez, R. R. Nepomuceno, J. Connolly, and G. R. Nemerow
CD46-Utilizing Adenoviruses Inhibit C/EBP{beta}-Dependent Expression of Proinflammatory Cytokines
J. Virol., September 1, 2005; 79(17): 11259 - 11268.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. D. Price, J. Schaumburg, C. Sandin, J. P. Atkinson, G. Lindahl, and C. Kemper
Induction of a Regulatory Phenotype in Human CD4+ T Cells by Streptococcal M Protein
J. Immunol., July 15, 2005; 175(2): 677 - 684.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Wu, S. A. Trauger, L. Pache, T.-M. Mullen, D. J. Von Seggern, G. Siuzdak, and G. R. Nemerow
Membrane Cofactor Protein Is a Receptor for Adenoviruses Associated with Epidemic Keratoconjunctivitis
J. Virol., April 15, 2004; 78(8): 3897 - 3905.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Crimeen-Irwin, S. Ellis, D. Christiansen, M. J. Ludford-Menting, J. Milland, M. Lanteri, B. E. Loveland, D. Gerlier, and S. M. Russell
Ligand Binding Determines Whether CD46 Is Internalized by Clathrin-coated Pits or Macropinocytosis
J. Biol. Chem., November 21, 2003; 278(47): 46927 - 46937.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
D. B. Gill, M. Koomey, J. G. Cannon, and J. P. Atkinson
Down-regulation of CD46 by Piliated Neisseria gonorrhoeae
J. Exp. Med., November 3, 2003; 198(9): 1313 - 1322.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Richards, E. J. Kemp, M. K. Liszewski, J. A. Goodship, A. K. Lampe, R. Decorte, M. H. Muslumanogglu, S. Kavukcu, G. Filler, Y. Pirson, et al.
Mutations in human complement regulator, membrane cofactor protein (CD46), predispose to development of familial hemolytic uremic syndrome
PNAS, October 28, 2003; 100(22): 12966 - 12971.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Smith, F. Santoro, G. Di Lullo, L. Dagna, A. Verani, and P. Lusso
Selective suppression of IL-12 production by human herpesvirus 6
Blood, October 15, 2003; 102(8): 2877 - 2884.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
T Inoue, M Yamakawa, and T Takahashi
Expression of complement regulating factors in gastric cancer cells
Mol. Pathol., June 1, 2002; 55(3): 193 - 199.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. W. Lee, R. A. Bonnah, D. L. Higashi, J. P. Atkinson, S. L. Milgram, and M. So
CD46 is phosphorylated at tyrosine 354 upon infection of epithelial cells by Neisseria gonorrhoeae
J. Cell Biol., March 18, 2002; 156(6): 951 - 957.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Zaffran, O. Destaing, A. Roux, S. Ory, T. Nheu, P. Jurdic, C. Rabourdin-Combe, and A. L. Astier
CD46/CD3 Costimulation Induces Morphological Changes of Human T Cells and Activation of Vav, Rac, and Extracellular Signal-Regulated Kinase Mitogen-Activated Protein Kinase
J. Immunol., December 15, 2001; 167(12): 6780 - 6785.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
D. M. Tobiason and H. S. Seifert
Inverse relationship between pilus-mediated gonococcal adherence and surface expression of the pilus receptor, CD46
Microbiology, August 1, 2001; 147(8): 2333 - 2340.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. Ludford-Menting, S. J. Thomas, B. Crimeen, L. J. Harris, B. E. Loveland, M. Bills, S. Ellis, and S. M. Russell
A Functional Interaction between CD46 and DLG4. A ROLE FOR DLG4 IN EPITHELIAL POLARIZATION
J. Biol. Chem., February 1, 2002; 277(6): 4477 - 4484.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, G.
Right arrow Articles by Atkinson, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, G.
Right arrow Articles by Atkinson, J. P.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*L-TYROSINE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS