HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Alsayed, Y. Articles by Platanias, L. C. Search for Related Content PubMed PubMed Citation Articles by Alsayed, Y. Articles by Platanias, L. C.

IFN- Activates the C3G/Rap1 Signaling Pathway¹

Yazan Alsayed^*, Shahab Uddin^*, Sarfraz Ahmad^*, Beata Majchrzak, Brian J. Druker, Eleanor N. Fish and Leonidas C. Platanias^2,*

^* Section of Hematology-Oncology, University of Illinois at Chicago and West Side Veterans Affairs Medical Center, Chicago, IL 60607; Department of Medical Genetics and Microbiology, University of Toronto, Toronto, Ontario, Canada; and Division of Hematology and Medical Oncology, Oregon Health Sciences University, Portland, OR 97201

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
IFN- transduces signals by activating the IFN- receptor-associated Jak-1 and Jak-2 kinases and by inducing tyrosine phosphorylation and activation of the Stat-1 transcriptional activator. We report that IFN- activates a distinct signaling cascade involving the c-cbl protooncogene product, CrkL adapter, and small G protein Rap1. During treatment of NB-4 human cells with IFN-, c-cbl protooncogene product is rapidly phosphorylated on tyrosine and provides a docking site for the src homology 2 domain of CrkL, which also undergoes IFN--dependent tyrosine phosphorylation. CrkL then regulates activation of the guanine exchange factor C3G, with which it interacts constitutively via its N terminus src homology 3 domain. This results in the IFN--dependent activation of Rap1, a protein known to exhibit tumor suppressor activity and mediate growth inhibitory responses. In a similar manner, Rap1 is also activated in response to treatment of cells with type I IFNs (IFN-, IFN-ß), which also engage CrkL in their signaling pathways. On the other hand, IFN- does not induce formation of nuclear CrkL-Stat5 DNA-binding complexes, which are induced by IFN- and IFN-ß, indicating that pathways downstream of CrkL are differentially regulated by different IFN subtypes. Taken altogether, our data demonstrate that, in addition to activating the Stat pathway, IFN- activates a distinct signaling cascade that may play an important role in the generation of its growth inhibitory effects on target cells.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Interferon- exhibits multiple biological effects, including antiviral, antiproliferative, and immunomodulatory activities on normal and neoplastic cells (1). Although the precise mechanisms by which the various biological effects of IFN- are elicited remain unknown, several of the early signaling events that occur after engagement of the type II IFN (IFN-) receptor have been elucidated. Two kinases of the Janus family, Jak-1 and Jak-2, are constitutively associated with the type II IFNR and are activated during IFN- stimulation (reviewed in Ref. 2). Activation of these Jak kinases regulates tyrosine phosphorylation and homodimerization of the transcriptional activator Stat1 and translocation of this homodimer to the nucleus. There, Stat1 binds to the IFN- activation site element present in the promoters of IFN--regulated response genes to initiate gene transcription (2).

The discovery of the Jak-Stat pathway has significantly advanced our knowledge of the mechanisms of IFN- signaling. The molecular mechanisms regulating other IFN--signaling pathways, however, are not as well characterized. In the case of type I IFNs (IFN-, IFN-ß, IFN-) that bind to a different receptor (type I IFNR) and induce activation of the Tyk-2 and Jak-1 kinases (reviewed in Ref. 3), several non-Stat pathways have been described, including the IRS-PI3K pathway (4, 5, 6, 7), the CrkL pathway (8, 9), as well as a pathway involving activation of the Raf kinase (10). We have previously shown that IFN- does not induce tyrosine phosphorylation of IRS proteins in cells of hematopoietic origin, suggesting that IRS-1 and IRS-2 do not participate in the generation of IFN- responses (5). In the present study, we provide evidence that IFN- engages a distinct signaling cascade involving activation of the c-cbl protooncogene product (CBL)³ and downstream engagement of the CrkL adapter protein. The engagement of CrkL in IFN- signaling regulates the ability of the guanine exchange factor C3G (11, 12, 13, 14, 15) to activate Rap1, a small G protein that exhibits tumor suppressor activity (16, 17, 18), providing a possible mechanism for the generation of the growth inhibitory effects of IFN- in target cells.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cells and reagents

The NB-4 human acute promyelocytic leukemia cell line was grown in RPMI 1640 (BioWhittaker), 10% FCS (v/v), and antibiotics. The Daudi lymphoblastoid cell line was grown in RPMI 1640-10% FBS serum and antibiotics. Human recombinant IFN- and IFN- were provided by Hoffmann-LaRoche (Nutley, NJ). Human recombinant IFN-ß was provided by Biogen (Cambridge, MA). The anti-phosphotyrosine mAb (4G-10) was obtained from Upstate Biotechnology (Lake Placid, NY). The anti-CrkL and anti-CBL polyclonal Abs were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). An Ab against Stat5b, that recognizes both forms of Stat-5, was also obtained from Santa Cruz Biotechnology. mAbs against CBL and Rap1 were obtained from Transduction Laboratories (Lexington, KY) and were used for immunoblotting.

Immunoprecipitations and immunoblotting

Cells were stimulated with 0.5–1 x 10⁴ U/ml of the indicated IFNs for the indicated times, unless otherwise stated. After stimulation, the cells were lysed as described previously (19, 20). Immunoprecipitations and immunoblotting using the enhanced chemiluminescence method were performed essentially as described previously (19, 20).

Preparation of GST fusion proteins and binding studies

The construction of the pGEX-CrkL-N-SH3, pGEX-CrkL-C-SH3, and pGEX-CrkLSH2 vectors has been described elsewhere (21). Production of GST fusion proteins and binding experiments were performed as described previously (4).

Genomic DNA affinity chromatography and mobility shift assays

Preparation of nuclear extracts, genomic DNA affinity chromatography, mobility shift assays, and supershifts with the appropriate Abs were performed using the same methodologies as in previous studies (9). The double-stranded oligodeoxynucleotide specific for Stat5 binding that was synthesized and used (AGATTTCTAGGAATTCAAATC) corresponds to a sequence derived from the ß-casein promoter (9).

Rap1 activation assays

The activation state of Rap1 was determined essentially as described previously, with minor modifications (22, 23, 24). The pGEX construct for the production of a GST-Ral GDS-RBD fusion protein was kindly provided by Dr. Johannes Bos (Utrecht University, Utrecht, The Netherlands). Briefly, after incubation in the presence or absence of IFN- for the indicated times, cells were lysed in phosphorylation lysis buffer and the cell lysates were incubated with the GST-Ral GDS-RBD fusion protein that had been precoupled to glutathione-Sepharose beads. In some experiments, incubation of cell lysates with GST alone was used as a negative control, as indicated. After incubation with the GST-Ral GDS-RBD fusion protein, the bound proteins were analyzed by SDS-PAGE. The proteins were transferred to immobilon membranes and the activated/GTP-bound form of Rap1 was detected by immunoblotting with a monoclonal anti-Rap1 Ab (Transduction Laboratories) using the enhanced chemiluminescence method.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
We initially sought to determine whether treatment of cells with IFN- induces tyrosine phosphorylation of CBL in cells of hematopoietic origin. NB-4 acute promyelocytic leukemia cells, that are sensitive to the growth inhibitory effects of IFN- (25), were incubated at 37°C in the presence or absence of IFN-, and after cell lysis, cell lysates were immunoprecipitated with an anti-CBL Ab and immunoblotted with antiphosphotyrosine. As shown in Fig. 1A, a 120-kDa tyrosine-phosphorylated protein, corresponding to CBL, was clearly detectable in immunoprecipitates from lysates of IFN--stimulated cells. Stripping and reprobing the same blot with the anti-CBL Ab demonstrated that equal amounts of CBL were present before and after IFN- stimulation (Fig. 1B). The tyrosine phosphorylation of the protein was also dose dependent, with the signal being clearly detectable after treatment with 100 U/ml of IFN- and exhibiting maximum intensity at 1000 U/ml (Fig. 2, A and B). When the kinetics of the IFN--dependent phosphorylation of CBL was determined, we found that the tyrosine phosphorylation of the protein was rapid and transient, occurring within 1 min of IFN- treatment and returning to baseline after 90 min of IFN- treatment (Fig. 2, C and D).

View larger version (28K): [in this window] [in a new window]   FIGURE 1. IFN- induces tyrosine of CBL. A, NB-4 cells were treated with IFN- for 5 min as indicated at 37°C. Cell lysates were immunoprecipitated with either control normal rabbit IgG (RIgG) or an Ab against CBL as indicated. Immunoprecipitated proteins were analyzed by SDS-PAGE and immunoblotted with an anti-phosphotyrosine Ab. B, The blot shown in A was stripped and reprobed with an Ab against CBL to control for equal loading.

View larger version (33K): [in this window] [in a new window]   FIGURE 2. Kinetics and dose dependence of the IFN--dependent tyrosine phosphorylation of CBL. A, NB-4 cells were treated with the indicated doses of IFN- for 15 min at 37°C. The cells were lysed and lysates were immunoprecipitated with an Ab against CBL (lanes 2–5) or control rabbit IgG (RIgG). The proteins were subsequently resolved by SDS-PAGE and immunoblotted with an anti-phosphotyrosine Ab. B, The blot shown in A was stripped and reprobed with an Ab against CBL. C, NB-4 cells were treated with IFN- for the indicated times and cell lysates were immunoprecipitated with either with an Ab against CBL or normal rabbit IgG (RIgG) as indicated. Immunoprecipitated proteins were resolved by SDS-PAGE and immunoblotted with an anti-phosphotyrosine Ab. D, The blot shown in C was stripped and reprobed with an anti-CBL Ab to control for loading.

View larger version (34K): [in this window] [in a new window]   FIGURE 3. IFN--dependent tyrosine phosphorylation of CrkL in NB-4 cells. A, NB-4 cells were incubated for 5 min at 37°C in the presence or absence of IFN- as indicated. Cell lysates were immunoprecipitated with either control normal rabbit Ig (RIgG) or an Ab against CrkL as indicated. Immunoprecipitated proteins were resolved by SDS-PAGE and immunoblotted with an anti-phosphotyrosine Ab. B, The blot shown in A was stripped and reprobed with the Ab against CrkL to control for equal loading.

View larger version (33K): [in this window] [in a new window]   FIGURE 4. CrkL associates with CBL in an IFN--dependent manner in vivo. A, NB-4 cells were incubated at 37°C for 5 min in the presence or absence of IFN- as indicated. Cell lysates were immunoprecipitated with an anti-CrkL Ab, analyzed by SDS-PAGE, and immunoblotted with a mAb against CBL. B, The blot shown in A was stripped and reprobed with the anti-CrkL Ab to control for equal loading.

View larger version (25K): [in this window] [in a new window]   FIGURE 5. The SH2 and N-SH3 domains of CrkL mediate the association of CrkL with CBL. A, NB-4 cells were incubated at 37°C for 5 min in the presence or absence of IFN- as indicated. Cell lysates were incubated with either control GST alone or a GST-CrkLSH2 fusion protein as indicated. Bound proteins were analyzed by SDS-PAGE and immunoblotted with an anti-phosphotyrosine Ab. B, NB-4 cells were treated with IFN- for 5 min at 37°C. Cell lysates were incubated with either control GST alone or a GST-CrkLSH2 fusion protein as indicated. Bound proteins were analyzed by SDS-PAGE and immunoblotted with a mAb against CBL. C, NB-4 cells were incubated at 37°C for 5 min in the presence or absence of IFN- as indicated. Cell lysates were incubated with either control GST alone or the indicated GST fusion proteins for the different domains in CrkL. Bound proteins were resolved by SDS-PAGE and immunoblotted with a mAb against CBL.

View larger version (17K): [in this window] [in a new window]   FIGURE 6. CrkL interacts via its N terminus SH3 domain with the guanine exchange factor C3G in NB-4 cells. A, NB-4 cells were incubated for 5 min at 37°C in the presence or absence of IFN- as indicated. Cell lysates were immunoprecipitated with either control normal rabbit Ig (RIgG), or an Ab against CrkL, or an Ab against C3G as indicated. Immunoprecipitated proteins were analyzed by SDS-PAGE and immunoblotted with an anti-C3G Ab. B, NB-4 cells were incubated at 37°C for 10 min in the presence or absence of IFN- as indicated. Cell lysates were incubated with either control GST alone, or a GST-CrkL-NSH3 fusion protein, or a GST-CrkL-CSH3 fusion protein, or a GST-CrkLSH2 fusion protein as indicated. Bound proteins were analyzed by SDS-PAGE and immunoblotted with the anti-C3G Ab.

View larger version (26K): [in this window] [in a new window]   FIGURE 7. IFN-dependent activation of the small G protein Rap1. A, NB-4 cells were treated with IFN- for the indicated times at 37°C. Cell lysates were bound to either control GST alone (lane 1) or to a GST-RalGDS-RBD fusion protein (lanes 2–7). Bound proteins were analyzed by SDS-PAGE and immunoblotted with an Ab against Rap1. The GTP-bound form of Rap1 is indicated. B (left panel), Daudi cells were incubated at 37°C in the presence or absence of IFN- for 10 min. The cells were lysed and cell lysates were bound to a GST-RalGDS-RBD fusion protein or GST alone (control) as indicated. Bound proteins were analyzed by SDS-PAGE and immunoblotted with an Ab against Rap1. The GTP-bound form of Rap-1 is indicated. Right panel, Daudi cells were incubated at 37°C in the presence or absence of IFN-ß for 5 min. The cells were lysed and cell lysates were bound to a GST-RalGDS-RBD fusion protein. Bound proteins were analyzed by SDS-PAGE and immunoblotted with an Ab against Rap1. The GTP-bound form of Rap1 is indicated.

We have recently shown a novel function of CrkL, translocating to the nucleus and acting as a nuclear adapter for Stat5 to mediate signals for type I IFNs (9). We sought to determine whether, during its activation by the type II (IFN-) receptor, CrkL also functions as a nuclear adapter for Stat5. We first determined whether in NB-4 cells Stat5 is tyrosine-phosphorylated/activated by IFN- treatment. Cells were treated with IFN-, and lysates were immunoprecipitated with an anti-Stat5 Ab and immunoblotted with antiphosphotyrosine. Stat5 was rapidly phosphorylated on tyrosine in an IFN--dependent manner (Fig. 8), establishing that this Stat protein is activated by IFN- in this cell line. We then performed analyses of IFN--induced nuclear extracts by gel shift assays, employing an oligonucleotide specific for Stat5 binding derived from the ß-casein promoter. As shown in Fig. 9, IFN- treatment of these cells resulted in the induction of DNA-binding complexes (Fig. 9, left panel). However, the mobilities of these complexes were not affected by inclusion of anti-CrkL Abs (Fig. 9, left panel). On the other hand, using IFN-ß-treated Daudi cells as positive controls, we clearly observed formation of IFN-ß-dependent induced CrkL-Stat5 complexes, which is consistent with our original report (9). Similar results were obtained with U-937 cells (data not shown) in which Stat5 has been previously shown to be activated and bind DNA (28) were studied. These studies demonstrate that CrkL does not associate with Stat5 to form DNA-binding complexes during engagement of the IFN- receptor. Consistent with these results, when extracts from NB-4 cells were subjected to genomic DNA affinity chromatography and immunoblotted for CrkL, there was no nuclear translocation and DNA binding of CrkL in response to IFN- (E. N. Fish, Y. Alsayed, and L. C. Platanias, unpublished observations). Taken altogether, these studies strongly suggest that Rap1 is a common element downstream of CrkL in both type I and type II IFN signaling, whereas the formation of CrkL-Stat5 complexes occurs selectively during engagement of CrkL by the type I, but not the type II, IFNR.

View larger version (20K): [in this window] [in a new window]   FIGURE 8. IFN--dependent tyrosine phosphorylation/activation of Stat5 in NB-4 cells. A, NB-4 cells were treated with IFN- for 5 min, as indicated, at 37°C. Cell lysates were immunoprecipitated with either control normal rabbit IgG (RIgG) or an Ab against Stat5 as indicated. Immunoprecipitated proteins were analyzed by SDS-PAGE and immunoblotted with an anti-phosphotyrosine Ab. B, The blot shown in A was stripped and reprobed with an Ab against Stat5 to control for equal loading.

View larger version (28K): [in this window] [in a new window]   FIGURE 9. Lack of induction of CrkL-Stat5 signaling complexes by IFN-. Left panel, Actively growing NB-4 cells were treated with IFN- for the indicated times. Nuclear extracts were prepared, incubated with or without an anti-CrkL Ab or non-immune rabbit immunoglobulin, as indicated, and reacted with 32P-labeled oligonucleotide, specific for Stat5 binding (AGATTTCTAGGAATTCAAATC), derived from the ß-casein promoter. The resultant complexes were resolved using 4.5% native PAGE and visualized by autoradiography. Right panel, Daudi cells treated with IFN-ß for 10 min were analyzed as a positive control. Nuclear extracts were prepared, incubated with or without an anti-CrkL Ab, and reacted with the same 32P-labeled oligonucleotide. The resultant complexes were resolved using 4.5% native PAGE and visualized by autoradiography.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

Our data also demonstrate that the CrkL adapter interacts with tyrosine-phosphorylated CBL in IFN--signaling and engagement of CrkL in IFN- signaling appears to regulate activation of the guanine exchange factor C3G and downstream activation of Rap1. However, we cannot exclude the possibility that the CrkL-C3G complexes play a different role in IFN- signaling and that another guanine exchange factor, distinct from C3G, is activated by IFN- to regulate Rap1 activation. Rap1 is a GTPase that shares similarities in its structure with Ras and Ral (reviewed in Ref. 41). This GTPase is activated in response to various different stimuli (22, 23, 24, 41, 42, 43) and has an effector domain similar to Ras (41), suggesting the existence of some common downstream targets between Rap1 and Ras (41).

The activation of the C3G-Rap1 signaling cascade by IFN- suggests the existence of a mechanism for the generation of the antiproliferative effects of IFN-. Previous studies have demonstrated that expression of Rap1 in Ras-transformed cells reverses the malignant phenotype (44), strongly suggesting that Rap1 mediates growth inhibitory responses, possibly via inhibition of the Ras pathway. Indeed, other studies have shown that the C3G-Rap1 pathway mediates growth inhibitory signals in anergic T cells (43). Thus, IFN-mediated growth inhibition may be regulated by Rap1. However, the growth inhibitory effects of Rap1 in the IFN system may not result from blocking of activation of components of the Ras-signaling cascade, as a recent study demonstrated that extracellular signal-regulated Rap1 activation does not interfere with Ras effector signaling (45). Thus, it is likely that Rap1-specific downstream effectors are activated by IFNs, and possibly other growth inhibitory cytokines, to mediate antiproliferative signals. Such a hypothesis for a growth inhibitory role of the Rap1 pathway in IFN signaling is also consistent with our recent data demonstrating that Crk proteins are tyrosine phosphorylated by IFNs in primary hematopoietic progenitors and that inhibition of CrkL and CrkII protein expression reverses the growth inhibitory effects of both type I and II IFNs in normal bone marrow progenitor colony formation (46). However, other alternative pathways, distinct from Rap1, may also participate in the inhibition of hematopoietic progenitor cell growth, as CrkII does not appear to interact with C3G in vivo (46), despite the fact that its SH3 domain binds the protein in vitro.

The relationship of the CBL-CrkL pathway with other pathways that may be involved in the generation of the growth inhibitory effects of IFN- is unknown at this time. Recent studies have suggested that Stat1 may play a role in the induction of the antiproliferative effects of IFNs (47, 48). We have been unable to demonstrate an interaction of CrkL with Stat1 in response to treatment with IFN-, suggesting that the CrkL pathway operates distinctively from the Jak-Stat1 pathway in IFN- signaling. This, however, needs to be further addressed in future studies. It also remains to be determined whether the CrkL-C3G-Rap1 pathway plays a role in the activation of the Raf-1 kinase by IFN-. It has recently been established that IFN- activates Raf-1 and that such an activation is Ras independent (49), but the biological relevance of engagement of this kinase in IFN- signaling is not known. Interestingly, most factors that activate Rap1 also appear to activate Raf-1 (41). Although there is no direct evidence that Rap1 plays a role in the activation of Raf-1, a recent study demonstrated that activation of Rap1 by C3G regulates activation of MEK-1 and B-Raf (50). It is conceivable, therefore, that Raf-1 may also be activated by Rap1 and the previously reported activation of Raf-1 by IFN- may be downstream of the CrkL-C3G-Rap1 pathway. It would be also important to determine whether other recently identified downstream effectors of the Rap1 pathway, such as Rlf, Rgl, RalGDS, and Krit1 (41, 51, 52, 53, 54, 55), are also engaged in IFN signaling and participate in the generation of certain of the biological functions of these pleiotropic cytokines.

	Acknowledgments

 
We thank Dr. Johannes Bos for providing us with the pGEX construct for the production of the GST-Ral GDS-RBD fusion protein.

	Footnotes

 
¹ This work was supported in part by National Institutes of Health Grants CA77816 and CA73381 (to L.C.P.) and by Medical Research Council of Canada Grant MT15094 (to E.N.F.).

² Address correspondence and reprint requests to Dr. Leonidas C. Platanias, Section of Hematology-Oncology, University of Illinois, Chicago, Molecular Biology Research Building, MC-734, Room 3150, 900 South Ashland Avenue, Chicago, IL 60607-7173. E-mail address:

³ Abbreviations used in this paper: CBL, c-cbl protooncogene product; SH, src homology.

Received for publication September 22, 1999. Accepted for publication December 6, 1999.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Petska, S., J. A. Langer, K. C. Zoon K. C., and C. E. 1987. Interferons and their actions. Annu. Rev. Biochem. 56:727.
2. Darnell, J. E., I. M. Kerr, G. R. Stark. 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular proteins. Science 264:1415.[Abstract/Free Full Text]
3. Stark, G. R., I. M. Kerr, B. R. G. Williams, R. H. Silverman, R. D. Schreiber. 1998. How cells respond to interferons. Annu. Rev. Biochem. 67:227.[Medline]
4. Uddin, S., L. Yenush, X.-J. Sun, M. E. Sweet, M. F. White, L. C. Platanias. 1995. Interferon engages the insulin receptor substrate-1 to associate with the phosphatidylinositol 3'-kinase. J. Biol. Chem. 270:15938.[Abstract/Free Full Text]
5. Platanias, L. C., S. Uddin, A. Yetter, X.-J. Sun, M. F. White. 1996. The type I interferon receptor mediates tyrosine phosphorylation of insulin receptor substrate-2. J. Biol. Chem. 271:278.[Abstract/Free Full Text]
6. Uddin, S., E. N. Fish, D. Sher, C. Gardziola, M. F. White, L. C. Platanias. 1997. Activation of the phosphatidylinositol 3'-kinase serine kinase by interferon . J. Immunol. 158:2390.[Abstract]
7. Uddin, S., E. N. Fish, D. Sher, C. Gardziola, O. R. Colamonici, M. Kellum, P. M. Pitha, M. F. White, L. C. Platanias. 1997. The IRS-pathway operates distinctively from the Stat-pathway in hematopoietic cells and transduces common and distinct signals during engagement of the insulin or interferon receptors. Blood 90:2574.[Abstract/Free Full Text]
8. Ahmad, S., Y. Alsayed, B. J. Druker, L. C. Platanias. 1997. The type I interferon receptor mediates tyrosine phosphorylation of the CrkL adaptor protein. J. Biol. Chem. 272:29991.[Abstract/Free Full Text]
9. Fish, E. N., S. Uddin, M. Korkmaz, B. Majchrzak, B. J. Druker, L. C. Platanias. 1999. Activation of a CrkL-Stat5 signaling complex by type I interferons. J. Biol. Chem. 274:571.[Abstract/Free Full Text]
10. Stancato, L. F., M. Sakatsume, M. David, P. Dent, F. Domg, E. F. Petricoin, J. J. Krolewski, O. Silvennoinen, P. Saharinen, et al 1997. ß-Interferon and oncostatin M activate Raf-1 and mitogen-activated protein kinase through a JAK1-dependent pathway. Mol. Cell. Biol. 17:3833.[Abstract]
11. Ingham, R. J., D. L. Krebs, S. M. Barbazuk, C. W. Turck, H. Hirai, M. Matsuda, M. R. Gold. 1996. B cell antigen receptor signaling induces the formation of complexes containing the Crk adapter proteins. J. Biol. Chem. 271:32306.[Abstract/Free Full Text]
12. Sawasdikosol, S., K. S. Ravichandran, K. Kay Lee, J.-H. Chang, S. J. Burakoff. 1995. Crk interacts with tyrosine-phosphorylated p116 upon T cell activation. J. Biol. Chem. 270:2893.[Abstract/Free Full Text]
13. Reedquist, K. A., T. Fukazawa, G. Panchamoorthy, W. Y. Langdom, S. E. Shoelson, B. J. Druker, H. Band. 1996. Stimulation through the T cell receptor induces Cbl association with Crk proteins and the guanine exchange protein C3G. J. Biol. Chem. 271:8435.[Abstract/Free Full Text]
14. Smit, L., G. Van De Horst, J. Borst. 1996. Sos, Vav, and C3G participate in B cell receptor-induced signaling pathways and differentially associate with Shc-Grb2, Crk, and CrkL adaptor. J. Biol. Chem. 271:8564.[Abstract/Free Full Text]
15. Gotoh, T., S. Hattori, S. Nakamura, H. Kitayama, M. Noda, Y. Takai, K. Kaibuchi, H. Matsui, O. Hatase, H. Takahashi, et al 1995. Identification of Rap1 as a target for the Crk SH3 domain-binding guanine nucleotide releasing factor C3G. Mol. Cell. Biol. 15:6746.[Abstract]
16. Cook, S., B. Rubinfeld, I. Albert, F. McCormick. 1993. RapV12 antagonizes Ras-dependent activation of ERK1 and ERK2 by LPA and EGF in Rat-1 fibroblasts. EMBO J. 12:3475.[Medline]
17. Kitayama, H., Y. Sugimoto, T. Matsuzaki, Y. Ikawa, M. Noda. 1989. A ras-related gene with transformation suppressor activity. Cell 56:77.[Medline]
18. Kitayama, H., T. Matsuzaki, Y. Ikawa, M. Noda. 1990. Genetic analysis of the Kirsten-ras-revertant 1 gene: potentiation of its tumor suppressor activity by specific point mutations. Proc. Natl. Acad. Sci. USA 87:4284.[Abstract/Free Full Text]
19. Uddin, S., A. Chamdin, L. C. Platanias. 1995. Interaction of the transcriptional activator Stat-2 with the type I interferon receptor. J. Biol. Chem. 270:24627.[Abstract/Free Full Text]
20. Yetter, A., S. Uddin, J. J. Krolewski, H. Jiao, T. Yi, L. C. Platanias. 1995. Association of the interferon-dependent tyrosine kinase Tyk-2 with the hematopoietic cell phosphatase. J. Biol. Chem. 270:18179.[Abstract/Free Full Text]
21. Heaney, C., K. Kolibaba, A. Bhat, T. Oda, S. Ohno, S. Fanning, B. J. Druker. 1997. Direct binding of CRKL to BCR-ABL is not required for BCR-ABL transformation. Blood 89:297.[Abstract/Free Full Text]
22. Franke, B., J. W. Akkerman, J. L. Bos. 1997. Rapid Ca2⁺-mediated activation of Rap1 in human platelets. EMBO J. 16:252.[Medline]
23. Reedquist, K. A., J. L. Bos. 1998. Costimulation through CD28 suppresses T cell receptor-dependent activation of the Ras-like small GTPase Rap1 in human T lymphocytes. J. Biol. Chem. 273:4494.
24. M’Rabet, L., P. Coffer, F. Zwartkruis, B. Franke, A. W. Segal, L. Keonderman, J. L. Bos. 1998. Activation of the small GTPase rap1 in human neutrophils. Blood 92:2133.[Abstract/Free Full Text]
25. Nason-Burchenal, K., D. Gandini, M. Botto, J. Allopenna, J. R. C. Seale, N. C. P. Cross, J. M. Goldman, E. Dmitrovsky, P. P. Pandolfi. 1996. Interferon augments PML and PML/RAR expression in normal myeloid and acute promyelocytic cells and cooperates with all-trans retinoic acid to induce maturation of a retinoid-resistant promyelocytic cell line. Blood 88:3926.[Abstract/Free Full Text]
26. Andoniou, C. E., C. B. F. Thien, W. Y. Langdon. 1996. The two major sites of cbl tyrosine phosphorylation in abl-transformed cells select the crkL SH2 domain. Oncogene 12:1981.[Medline]
27. Koval, P., M. Karas, Y. Zick, D. LeRoith. 1998. Interplay of the proto-oncogene proteins CrkL and CrkII in insulin-like growth factor-I receptor-mediated signal transduction. J. Biol. Chem. 273:14780.[Abstract/Free Full Text]
28. Meinke, A., F. Barahmand-Pour, S. Wohrl, D. Stoiber, T. Decker. 1996. Activation of different Stat5 isoforms contributes to cell-type-restricted signaling in response to interferons. Mol. Cell. Biol. 16:6937.[Abstract]
29. Blake, T. J., M. Shapiro, H. C. Morse, W. Y. Langdon. 1991. The sequences of the human and mouse c-cbl proto-oncogenes show v-cbl was generated by a large truncation encompassing a proline-rich domain and a leucine zipper-like motif. Oncogene 6:653.[Medline]
30. Blake, T. J., K. G. Heath, W. Y. Langdon. 1993. The truncation that generated the v-cbl oncogene reveals an ability for nuclear transport, DNA binding and acute transformation. EMBO J. 12:2017.[Medline]
31. Wang, Y., Y. Yeung, W. Langdon, E. R. Stanley. 1995. c-Cbl is transiently tyrosine- phosphorylated, ubiquinated and membrane-targeted following CSF-1 stimulation of macrophages. J. Biol. Chem. 271:17.[Abstract/Free Full Text]
32. Odai, H., K. Sasaki, A. Iwamatsu, Y. Hanazono, T. Tanaka, K. Mitani, Y. Yazaki, H. Hirai. 1995. The protooncogene product c-Cbl becomes tyrosine phosphorylated by stimulation with GM-CSF or Epo and constitutively binds to the SH3 domain of Grb2/Ash in human hematopoietic cells. J. Biol. Chem. 270:10800.[Abstract/Free Full Text]
33. Rivero-Lezcano, O. M., J. H. Sameshima, A. Marcilla, K. C. Robbins. 1994. Physical association between Src homology 3 elements and the protein product of the c-cbl proto-oncogene. J. Biol. Chem. 269:17363.[Abstract/Free Full Text]
34. Panchamoorthy, G., T. Fukazawa, S. Miyake, S. Soltoff, K. Reedquist, B. Druker, S. Shoelson, L. Cantley, H. Band. 1996. p120^cbl is a major substrate of tyrosine phosphorylation upon B cell antigen receptor stimulation and interacts in vivo with Fyn and Syk tyrosine kinases, Grb2 and Shc adaptors, and the p85 subunit of phosphatidyl-inositol 3- kinase. J. Biol. Chem. 271:3187.[Abstract/Free Full Text]
35. Sattler, M., R. Salgia, G. Shrikhande, S. Verma, N. Uemura, S. F. Law, E. A. Golemis, J. D. Griffin. 1997. Differential signaling after beta1 integrin ligation is mediated through binding of CRKL to p120(CBL) and p110(HEF1). J. Biol. Chem. 272:14320.[Abstract/Free Full Text]
36. Meisner, H., M. P. Czech. 1995. Coupling of the proto-oncogene product c-Cbl to the epidermal growth factor receptor. J. Biol. Chem. 270:25332.[Abstract/Free Full Text]
37. Soltoff, S. P., L. C. Cantley. 1996. p120^cbl is a cytosolic adapter protein that associates with phosphoinositide 3-kinase in response to epidermal growth factor in PC12 and other cells. J. Biol. Chem. 271:563.[Abstract/Free Full Text]
38. Tanaka, S., L. Neff, R. Baron, J. B. Levy. 1995. Tyrosine phosphorylation and translocation of the c-Cbl protein after activation of tyrosine kinase signaling pathways. J. Biol. Chem. 270:14347.[Abstract/Free Full Text]
39. Donovan, J. A., R. L. Wange, W. Y. Langdon, L. E. Samelson. 1994. The protein product of the c-cbl protooncogene is the 120 kDa tyrosine phosphorylated protein in Jurkat cells activated via the T cell antigen receptor. J. Biol. Chem. 269:22921.[Abstract/Free Full Text]
40. Meisner, H., B. R. Conway, D. Hartley, M. P. Czech. 1995. Interactions of Cbl with Grb-2 and phosphatidylinositol 3'- kinase in activated Jurkat cells. J. Biol. Chem. 15:3571.
41. Bos, J. L.. 1998. All in the family? New insights and questions regarding interconnectivity of Ras, Rap1 and Ral. EMBO J. 17:6776.[Medline]
42. Mcleod, S. J., R. J. Ingham, J. L. Bos, T. Kurosaki, M. R. Gold. 1998. Activation of the Rap1 GTPase by the B cell antigen receptor. J. Biol. Chem. 273:29218.[Abstract/Free Full Text]
43. Boussiotis, V. A., G. J. Freeman, A. Berezovskaya, D. L. Barber, L. M. Nadler. 1997. Maintenance of human T cell anergy: blocking of IL-2 gene transcription by activated Rap1. Science 278:124.[Abstract/Free Full Text]
44. Kitayama, H., Y. Sugimoto, T. Matsuzaki, Y. Ikawa, M. Noda. 1989. A ras-related gene with transformation suppressor activity. Cell 56:77.
45. Zwartkruis, F. J., R. M. F. Wolthuis, N. M. J. M. Nabben, B. Franke, J. L. Bos. 1998. Extracellular signal-regulated activation of Rap1 fails to interfere in Ras effector signalling. EMBO J. 17:5905.[Medline]
46. Platanias, L. C., S. Uddin, E. Bruno, M. Korkmaz, S. Ahmad, Y. Alsayed, D. Van Den Berg, B. J. Druker, A. Wickrema, R. Hoffman. 1999. CrkL and CrkII participate in the generation of the growth inhibitory effects of interferons on primary hematopoietic progenitors. Exp. Hematol. 27:1315.[Medline]
47. Chin, Y. E., M. Kitagawa, W. C. Su, Z. H. You, Y. Iwamoto, X.-Y. Fu. 1996. Cell growth arrest and induction of cyclin-dependent kinase inhibitor p21 WAF1/CIP1 mediated by STAT1. Science 272:719.[Abstract]
48. Bromberg, J. F., C. M. Horvath, Z. Wen, R. D. Schreiber, Jr J. E. Darnell. 1996. Transcriptionally active Stat1 is required for the antiproliferative effects of both interferon- and interferon-. Proc. Natl. Acad. Sci. USA 93:7673.[Abstract/Free Full Text]
49. Sakatsume, M., L. F. Stancato, M. David, O. Silvennoinen, P. Saharinen, J. Pierce, A. C. Larner, D. S. Finbloom. 1998. Interferon- activation of Raf-1 is Jak1-dependent and p21ras-independent. J. Biol. Chem. 273:3021.[Abstract/Free Full Text]
50. York, R. D., H. Tao, T. Dillon, C. L. Ellig, S. P. Eckert, E. W. McCleskey, P. J. S. Stock. 1998. Rap1 mediates sustained MAP kinase activation induced by nerve growth factor. Nature 392:622.[Medline]
51. Spaargaren, M., J. R. Bischoff. 1994. Identification of the guanine nucleotide dissociation stimulator for Ral as a putative effector molecule pf R-ras, H-ras, K-ras and Rap. Proc. Natl. Acad. Sci. USA 91:12609.[Abstract/Free Full Text]
52. Kishida, S., S. Koyama, K. Matsubara, M. Kishida, Y. Matsuura, A. Kikuchi. 1997. Colocalization of Ras and Ral on the membrane is required for Ras-dependent ral activation through RalGDP dissociation stimulator. Oncogene 15:2899.[Medline]
53. Wolthuis, R. M. F., B. Bauer, L. J. vant’ Veerm, A. M. de Vries-Smits, R. H. Cool, M. Spaargen, A. Wittinghofer, B. M. Burgering, J. L. Bos. 1996. RalGDS-like factor (Rlf) is a novel Ras and Rap1A-associating protein. Oncogene 13:353.[Medline]
54. Wolthuis, R. M. F., N. D. de Ruiter, R. H. Cool, J. L. Bos. 1997. Stimulation of gene induction and growth by the Ras effector Rlf. EMBO J. 16:6748.[Medline]
55. Serebriskii, I., J. Estojak, G. Sonoda, J. R. Testa, E. A. Golemis. 1997. Association of Krev-rap1a with krit1, a novel ankyrin repeat-containing protein encoded by gene mapping to 7q21–22. Oncogene 15:1043.[Medline]

This article has been cited by other articles:

				Y. Bai, U. Ahmad, Y. Wang, J. H. Li, J. C. Choy, R. W. Kim, N. Kirkiles-Smith, S. E. Maher, J. G. Karras, C. F. Bennett, et al. Interferon-{gamma} Induces X-linked Inhibitor of Apoptosis-associated Factor-1 and Noxa Expression and Potentiates Human Vascular Smooth Muscle Cell Apoptosis by STAT3 Activation J. Biol. Chem., March 14, 2008; 283(11): 6832 - 6842. [Abstract] [Full Text] [PDF]

				D. J. Gough, K. Sabapathy, E. Y.-N. Ko, H. A. Arthur, R. D. Schreiber, J. A. Trapani, C. J. P. Clarke, and R. W. Johnstone A Novel c-Jun-dependent Signal Transduction Pathway Necessary for the Transcriptional Activation of Interferon {gamma} Response Genes J. Biol. Chem., January 12, 2007; 282(2): 938 - 946. [Abstract] [Full Text] [PDF]

				P. J. S. Stork and T. J. Dillon Multiple roles of Rap1 in hematopoietic cells: complementary versus antagonistic functions Blood, November 1, 2005; 106(9): 2952 - 2961. [Abstract] [Full Text] [PDF]

				R. Pawliczak, C. Logun, P. Madara, J. Barb, A. F. Suffredini, P. J. Munson, R. L. Danner, and J. H. Shelhamer Influence of IFN-{gamma} on gene expression in normal human bronchial epithelial cells: modulation of IFN-{gamma} effects by dexamethasone Physiol Genomics, September 21, 2005; 23(1): 28 - 45. [Abstract] [Full Text] [PDF]

				Y. Li, S. Batra, A. Sassano, B. Majchrzak, D. E. Levy, M. Gaestel, E. N. Fish, R. J. Davis, and L. C. Platanias Activation of Mitogen-activated Protein Kinase Kinase (MKK) 3 and MKK6 by Type I Interferons J. Biol. Chem., March 18, 2005; 280(11): 10001 - 10010. [Abstract] [Full Text] [PDF]

				K. K. Srivastava, S. Batra, A. Sassano, Y. Li, B. Majchrzak, H. Kiyokawa, A. Altman, E. N. Fish, and L. C. Platanias Engagement of Protein Kinase C-{theta} in Interferon Signaling in T-cells J. Biol. Chem., July 16, 2004; 279(29): 29911 - 29920. [Abstract] [Full Text] [PDF]

				Y. Li, A. Sassano, B. Majchrzak, D. K. Deb, D. E. Levy, M. Gaestel, A. R. Nebreda, E. N. Fish, and L. C. Platanias Role of p38{alpha} Map Kinase in Type I Interferon Signaling J. Biol. Chem., January 9, 2004; 279(2): 970 - 979. [Abstract] [Full Text] [PDF]

				D. K. Deb, A. Sassano, F. Lekmine, B. Majchrzak, A. Verma, S. Kambhampati, S. Uddin, A. Rahman, E. N. Fish, and L. C. Platanias Activation of Protein Kinase C{delta} by IFN-{gamma} J. Immunol., July 1, 2003; 171(1): 267 - 273. [Abstract] [Full Text] [PDF]

				A. Navarro, B. Anand-Apte, Y. Tanabe, G. Feldman, and A. C. Larner A PI-3 kinase-dependent, Stat1-independent signaling pathway regulates interferon-stimulated monocyte adhesion J. Leukoc. Biol., April 1, 2003; 73(4): 540 - 545. [Abstract] [Full Text] [PDF]

				A. K. Voss, P. Gruss, and T. Thomas The guanine nucleotide exchange factor C3G is necessary for the formation of focal adhesions and vascular maturation Development, March 2, 2003; 130(2): 355 - 367. [Abstract] [Full Text] [PDF]

				S. Uddin, A. Sassano, D. K. Deb, A. Verma, B. Majchrzak, A. Rahman, A. B. Malik, E. N. Fish, and L. C. Platanias Protein Kinase C-delta (PKC-delta ) Is Activated by Type I Interferons and Mediates Phosphorylation of Stat1 on Serine 727 J. Biol. Chem., April 19, 2002; 277(17): 14408 - 14416. [Abstract] [Full Text] [PDF]

				A. Verma, D. K. Deb, A. Sassano, S. Uddin, J. Varga, A. Wickrema, and L. C. Platanias Activation of the p38 Mitogen-activated Protein Kinase Mediates the Suppressive Effects of Type I Interferons and Transforming Growth Factor-beta on Normal Hematopoiesis J. Biol. Chem., March 1, 2002; 277(10): 7726 - 7735. [Abstract] [Full Text] [PDF]

				J. Du, Y. M. Alsayed, F. Xin, S. J. Ackerman, and L. C. Platanias Engagement of the CrkL Adapter in Interleukin-5 Signaling in Eosinophils J. Biol. Chem., October 13, 2000; 275(42): 33167 - 33175. [Abstract] [Full Text] [PDF]

				A. Arai, Y. Nosaka, E. Kanda, K. Yamamoto, N. Miyasaka, and O. Miura Rap1 Is Activated by Erythropoietin or Interleukin-3 and Is Involved in Regulation of beta 1 Integrin-mediated Hematopoietic Cell Adhesion J. Biol. Chem., March 23, 2001; 276(13): 10453 - 10462. [Abstract] [Full Text] [PDF]

This Article