|
|
||||||||


*
Department of Clinical Chemistry, Microbiology and Immunology, University of Ghent, University Hospital of Ghent, Ghent, Belgium; and
Ludwig Institute for Cancer Research, Brussels Branch and Experimental Medicine Unit, Catholic University of Louvain, Brussels, Belgium
| Abstract |
|---|
|
|
|---|
-chain of the IL-9 receptor (IL-9R
) in
early human T cell development. We report that addition of the mAb
AH9R7, which recognizes and blocks selectively the human high affinity
-chain of the IL-9R, results in a profound reduction of the number
of human thymocytes. Analysis of lymphoid subpopulations indicates that
a highly reduced number of cells undergo maturation from
CD34+ precursor cells toward
CD4+CD3-CD8-CD1+
progenitor cells and subsequently toward
CD4+CD8+ double positive (DP) thymocytes.
Addition of IL-9 to the FTOC resulted in an increase in cell number,
without disturbing the frequencies of the different subsets. These data
suggest that IL-9R
signaling is critical in early T lymphoid
development. | Introduction |
|---|
|
|
|---|
-chain
(
c)(2). In these patients, there
is a combined inability to respond to IL-2, IL-4, IL-7, IL-9, and IL-15
since the receptors for those cytokines include the
c-chain as a functional component (3, 4). Analysis of gene-disrupted mice for those cytokines led to
the conclusion that their importance in terms of T cell development is
different. Based on the dramatically diminished T cell development in
IL-7-deficient (5) or IL-7R
-deficient mice
(6), yet normal T cell development in mice deficient in
either IL-2R
(7), IL-2Rß (8), IL-2
(9), IL-4 (10, 11), or both IL-2 and IL-4
(12), it seems likely that most of the defect in T cell
development in patients with X-SCID is due to defective IL-7 signaling
(13). Recently, it was shown that mice deficient in
IL-15R
had
25% fewer cells in the thymus than the control
littermates, indicating that the role of IL-15
may partially
contribute to, but is dispensable for, the development of thymocytes
(14). Mice deficient in IL-9 are not available at this
time. Another way to address the relative importance of the cytokines
in human T cell development is the human-mouse fetal thymus organ
culture (FTOC) model. We have shown that human
CD34+ fetal liver hemopoietic precursor cells are
able to differentiate in a mouse thymic microenvironment (15, 16). This chimeric human-mouse FTOC provides us with a tool to
examine the critical factors involved in the human T cell
differentiation process. In a previous study, we have reported that
IL-7 plays an essential role in the differentiation of human T cells
(17). This was shown by either blocking IL-7 activity with
neutralizing Abs against IL-7 or by blocking the IL-7R
. A direct
evidence for the essential role of IL-7 has now been given by coming
across upon patients with a defective IL-7R
expression, who suffer
from a
T-B+NK+
SCID (18). To date, humans or mice lacking IL-9 or
IL-9R
have not been reported. However, the analysis of such defect
will be of interest, in view of the possibility that IL-9 might
partially contribute to thymic development, given the responsiveness of
fetal thymocytes to IL-9 (19) and the development of
thymic lymphomas in IL-9 transgenic mice (20).
IL-9 was originally described as a murine T cell growth factor
(21). Human and murine IL-9 are 126 amino acids long
(21, 22). IL-9 is produced by activated T cells and
supports the growth of Th clones but not cytolytic clones (23, 24). In the mouse, IL-9 has been reported to exert effects on
erythroid progenitors, B cells, mast cells, and fetal thymocytes
(19). Regarding mast cells, IL-9 has been shown to be
identical to mast cell growth-enhancing activity, a factor present in
conditioned medium derived from splenocytes (25). IL-9
also can synergize with IL-3 for maximal proliferation of mast cells
(24). The action of IL-9 on thymocytes in vitro is
interesting in view of the development of thymic lymphomas in IL-9
transgenic mice coupled to the observation that IL-9 is a major
anti-apoptotic factor for thymic lymphomas (26).
Although murine IL-9 is active on human cells, human IL-9 is not
biologically active on murine cells. IL-9 binds to the 64-kDa IL-9R
binding protein, which is similar in size to
c
(27). The functional IL-9 receptor, which binds IL-9 with
a Kd of 100 pM, consists of IL-9R
plus
c (28, 29).
In this study we addressed the role of IL-9 by comparing intrathymic
human T cell development of
CD34+CD38-Lin-
hemopoietic progenitors from fetal liver or
CD34+CD38+Lin-
cord blood in FTOC that were treated with mAbs that block IL-9R
. Our
data indicate that blocking this receptor severely affects human T cell
differentiation and is consistent with the notion that signaling
through IL-7R
and
c is not sufficient for
normal T cell development in man.
| Materials and Methods |
|---|
|
|
|---|
C.B.-17 SCID mice were obtained from our own specific pathogen-free breeding facility. For timed pregnancies, females were housed separately from the males until mating. The appearance of vaginal plugs after overnight mating was labeled as day 0 of pregnancy. Fourteen- to 15-day pregnant mice were sacrificed to obtain the embryos for preparation of the thymic lobes.
Antibodies
The mAb used were rat anti-mouse CD45 (CD45-cychrome, 30F1
1.1, PharMingen, San Diego, CA), and the following mouse anti-human
mAb from Becton Dickinson Immunocytometry Systems (Mountain View, CA):
CD3 (Leu-4 FITC or APC), CD4 (Leu-3a FITC, or APC), CD7 (Leu-9-FITC),
CD8 (Leu2a FITC), CD19 (Leu-12), CD34 (HPCA-2 PE or APC), CD45 (HLe-1
FITC), and HLA-DR (PE). The following mAbs were from Ortho (Raritan,
NJ): CD38 (OKT10 FITC or PE). The following were from Coulter (Miami,
Fl): CD1a, (T6 RD1), and TCR Pan
ß (BMA031, PE). Monoclonal Abs to
the human IL-9 receptor were obtained from DBA/2 mice immunized with
P815 mastocytoma cells transfected with a pEF-BOS plasmid encoding the
human IL-9 receptor. The Abs used in the present work included AH9R2
(IgG2a), AH9R4 (IgG2a), and AH9R7 (IgG2b). All specifically bind to the
human IL-9 receptor but have different inhibitory activities. AH9R4
shows little or no inhibition whereas AH9R2 and AH9R7 have weak and
strong inhibitory activities, respectively. Half-maximal inhibition of
100 pg/ml human IL-9 in a TS1H9RA3 assay (30) requires 10
µg/ml AH9R2 and only 0.05 µg/ml AH9R7 (30). In this
assay, the murine helper T cell line TS1 (30) has been
transfected with human IL-9 receptor
and cultured (3000 cells/100
µl) in the presence of 100 pg/ml human IL-9 with or without the
indicated Abs. Cell growth was evaluated by measuring hexosaminidase
activity after 3 days. IgG2b, mouse mAb (IgG2b MOPC 195/
MOPC141/
) a mixture of Igs from two different tumor sources was used
as IgG2b control (ICN, Biomedicals, Irvine, CA)
Preparation of human fetal liver cells, cord blood cells, or thymocytes
Human fetal liver tissues from spontaneous termination of pregnancy or cord blood and human thymus tissue from children undergoing cardiac surgery were obtained and used following the guidelines of the Medical Ethical Commission of the University Hospital of Ghent. Human fetal liver cells were isolated by gentle disruption of the tissue in complete medium (IMDM medium/10% FCS, Life Technologies, Paisley, Scotland), followed by density gradient centrifugation over Lymphoprep (Nyegaard, Oslo, Norway). Umbilical cord blood was obtained from full-term, healthy newborns and used within 24 h after collection for isolation of mononuclear cells as described before (31). Cells were washed and resuspended in 90% FCS/10% DMSO and cryopreserved in liquid nitrogen until use. For the preparation of thymocytes, the thymic tissue was cut into small pieces of 0.5 cm x 0.5 cm. One piece was extensively teased apart with cataract knives in serum-free RPMI 1640 at 4°C, and the freed cells were washed and either used for further purification or washed in serum-free RPMI 1640 medium (400 x g for 5 min at 4°C) and finally resuspended in 1 ml Trizol (Life Technologies) for PCR analysis.
Purification of CD34+ fetal liver, cord blood stem cells, and human thymocyte subsets
After thawing and washing the cells, fetal liver cells were labeled with glycophorin A and CD19 and immunofluorescently labeled with CD1, CD3, CD4, CD7, CD8, and CD38; cord blood cells were labeled with glycophorin A or CD19, and FITC-labeled CD7. Freshly prepared thymocytes were labeled with FITC-labeled CD3 and CD8. For immunomagnetic depletion, the cells were resuspended in 0.5 ml cold PBS/2% FCS and mixed with 0.5 ml prewashed (to remove the preservative) sheep anti-mouse Ig-coated Dynabeads (Dynal, Oslo, Norway) to obtain a ratio of cells/Dynabeads of 1:5. After 30 min at 4°C, the suspension was diluted by carefully adding 5 ml PBS/2% FCS, and the rosettes of cells with Dynabeads were removed by placing the tube on a magnetic particle concentrator (Dynal). The supernatant containing the unlabeled and weakly stained cells was removed and centrifuged (500 x g, 6 min). The cells from fetal liver or cord blood were resuspended in 0.5 ml PBS/2% FCS, labeled respectively with CD34-PE or with FITC-labeled CD1, CD3, CD4, CD8, and PE-labeled CD34. Finally, cells were sorted for, respectively, CD34+CD38-Lin- fetal liver or CD34+Lin- cord blood stem cells on a FACS Vantage (Becton Dickinson). The human thymocytes were labeled with either CD4-PE and CD34-APC to allow FACS sorting of CD4 immature single positive or with CD34-APC and CD1-PE to allow sorting of CD34+CD1+ and CD34+CD1- thymocytes. Sorted cells were checked for purity, which was always at least 99.0%.
Fetal thymic organ cultures
Thymic lobes were isolated from fetal day 1415 SCID mice.
Hanging drops were prepared in Terasaki plates by adding in each well
25 µl of complete medium containing 10,000 sorted
CD34+CD38-Lin-
fetal liver stem cells or
CD34+Lin- cord blood stem
cells or sorted CD4 immature single positive or
CD34+CD1+ or
CD34+CD1- thymocytes to
one thymic lobe. The plates were immediately inverted to form hanging
drops and incubated during 48 h in a humidified incubator (7.5%
CO2 in air, 37°C) (32). After
incubation, the lobes were removed from the hanging drop, washed, and
put on a nuclepore filter (Nuclepore, Costar, Cambridge, MA) resting on
a Gelfoam sponge (Upjohn, Kalamazoo, MI). mAbs reacting with IL-9R
were used at a concentration of 50 µg/ml. The Abs were given from the
start of the hanging drop culture throughout the FTOC.
Flow cytometry
Before labeling, cells were recovered from thymic lobes,
suspended in PBS/1% BSA-0.1% NaN3, and the Fc
receptors of the mouse thymocytes were blocked by preincubation for 15
min with saturating amounts of anti-F
RII/III mAb (clone 2.4.G2)
(33) to avoid the aspecific binding of Abs by the murine
thymocytes. Subsequently, the cells were stained with a panel of mAb,
as indicated. All mAbs against human Ags were checked for negative
staining on SCID thymocytes after blocking with 2.4G2 mAb. Isotype
controls were also included in most staining series and were found to
be negative. The cells were analyzed on a FACScalibur (Becton
Dickinson) with an argon-ion laser tuned at 488 nm and red-diode laser
at 635 nm. Forward light scattering, orthogonal scattering, and four
fluorescence signals were determined on 1020,000 cells and stored in
list mode data files. Data acquisition and analysis were done with
CellQuest software (Becton Dickinson). Viable human cells were gated by
exclusion of mouse CD45-cychrome-positive cells and propidium iodide
(PI)-positive cells.
RT-PCR and Southern blotting
Trizol (Life Technologies) was added to sorted cells or tissue
fragments, and RNA was extracted according to the manufacturers
instructions. cDNA was synthesized with oligo(dT) as a primer using the
Superscript kit (Life Technologies). Oligonucleotides used for RT-PCR
and hybridization were as follows: for human IL-9 primary
PCR, AAGTGCCACTGCAGTGCTAATGTGAC (sense primer),
TGCATGGCTGTTCACAGGAAAAATAT (antisense primer); and for the
nested IL-9 PCR, CTTGTTGTTCTTTAGTACTTCAACTG (antisense primer) and
TGTTTGGGCATTCCCTCTGACA (sense primer); for hIL-9R PCR,
ACCTGCCTCACCAACAACATTCTCA (sense primer) and
ACGCTCCTCCTCTACCACATCATCC (antisense primer); and for hypoxanthin
phosphoribosyltransferase (HPRT), AATTATGGACAGGACTGAACGT (sense primer)
and TCAAATCCAACAAAGTCTGGCTTA (antisense primer). PCR amplification
was performed using a 96-well thermocycler (Omnigene,
Hybaid Teddington, U.K.) with 1 cycle at 94°C for 2 min,
35 cycles of 94°C for 0.5 min, 55°C for 0.5 min, and 72°C for 1
min for IL-9 and HPRT and with 1 cycle at 94°C for 2 min, 35 cycles
of 94°C for 0.5 min, 61°C for 0.5 min, and 72°C for 1 min for
IL-9R
. All primer pairs amplified human cDNA only. For
semiquantitative RT-PCR, three 4-fold dilutions of each cDNA sample
were amplified.
| Results |
|---|
|
|
|---|
results in a drastic reduction in the
cellularity in chimeric human-mouse FTOC
To establish the role of IL-9R
in human T cell development, we
investigated whether mAbs that bind to the human IL-9R
are able to
inhibit the proliferation and/or differentiation of human thymocytes in
chimeric human-mouse FTOC. These Abs were added to the SCID thymic lobi
when these were seeded with highly purified CD34+
precursor cells as well as during the FTOC thereafter. Addition of
AH9R7 resulted in a dramatic decrease in the cell recovery from the
thymus seeded with fetal liver stem cells (Table I
). By 1416 days of FTOC, at least a
90% reduction in human cellularity was observed. The drop was at least
70% by day 28. The reduction in cellularity of the human cells was at
least 85% by day 17 and 96% by day 27 in FTOC initiated with cord
blood stem cells.
|
binding
capacity.
|
results in a developmental block of the human
hemopoietic precursor cells in chimeric human-mouse FTOC
As shown in Fig. 2
A in
the anti-IL-9R
-treated FTOC, the frequency of
CD34+ precursor cells is similar to that of the
control culture and the frequency of the immature
CD4+ progenitor cells is reduced. At that time
point of the culture, all the CD4+ cells are
CD3- and belong to the
CD4+ immature single positive subset (15, 16). As the absolute number of human cells is dramatically
reduced (Table I
), the net result is that both populations are reduced
in absolute numbers in the anti-IL-9R
-treated FTOC. However, the
reduction is more pronounced for the CD4+ cell
population. This indicates that especially the early steps of
differentiation are affected by blocking IL-9. The block is not
complete as a small proportion of the cells undergoes similar
phenotypic changes as the control culture. Therefore, these data
suggest that IL-9 plays a role in the maintenance and expansion of
early T cell precursors at a stage between the transition of
CD34+ cells toward CD4+
cells.
|
ß, which defines thymocytes at a further stage of
differentiation, were decreased. Taken together with the reduction in
absolute numbers, these data show that a reduced number of cells is
able to differentiate, when the IL-9R
is blocked. Nevertheless,
since precursor cells were able to differentiate, the block is not
complete.
Additional evidence for an early block in the T cell developmental
process was found by studying the influence of neutralizing
anti-IL-9R
Abs on the differentiation of different starting
populations. Therefore, three populations were sorted from human thymus
that are known to present successive steps in differentiation :
CD34+CD1-,
CD34+CD1+, and
CD34-CD4+CD3-
cells. As shown in Fig. 3
, the first two
populations were strongly inhibited (>80%) by the treatment of the
FTOC with the mAb, whereas this reduction was only 40% for the
CD4+CD3- population. This
shows again that the cells in early phases of differentiation are more
dependent on IL-9R
signaling. The differences in cell number between
these populations are a consequence of the more rapid kinetic of
differentiation of the
CD34-CD4+CD3-
population, because these cells are already at a later stage of
differentiation and differentiate more rapidly into
CD4+CD8+ cells, which is
accompanied with a significant cell increase. Finally, we addressed
whether the addition of anti-IL9R
-inhibiting mAbs is required
during the full length of culture time of the FTOC, or only during part
of the experimental procedure. The inhibition was less pronounced in
the FTOC that were treated only in the hanging drop. Treatment after
hanging drop resulted in a drastically reduced cell number and T cell
development and was comparable to the inhibition that was obtained
after continuous treatment during hanging drop and the FTOC afterwards
(Table II
).
|
|
To verify whether IL-9 was able to counteract the inhibition
mediated by anti-IL-9R mAb, both reagents were added simultaneously
to the FTOC. The mAb was used in different concentrations, and IL-9 was
added at 10 ng/ml in the FTOC. As shown in Fig. 4
, IL-9 prevented the inhibitory activity
of AH9R7. These data argue in favor of an effect mediated by inhibition
of the IL-9R
and strongly argue against a nonspecific mechanism
affecting the cell viability by the treatment with the mAbs.
|
Since the block of the IL-9R
receptor inhibits early thymocyte
generation, we investigated whether addition of exogenous Il-9 would
increase cellularity in FTOC. Addition of human recombinant IL-9 (10
ng/ml) resulted in a significant increase in cell number without
clearly affecting the frequencies of the cell populations (Table III
). In addition, the influence of IL-9
was studied on the differentiation of three populations from human
thymus that are known to present successive steps in differentiation:
CD34+CD1-,
CD34+CD1+, and
CD34-CD4+CD3-
cells. The three populations were increased in cell number by the
treatment of the FTOC with IL-9 (data not shown). This effect was most
pronounced with the
CD34+CD1+ population with
an increase of 165%. This shows that the cells in early phases of
differentiation are responsive to IL-9.
|
mRNA is present in human stem cells and IL-9 mRNA is
produced intrathymically
The ability of the SCID thymic lobes to support human T cell
differentiation, which can be blocked by neutralizing anti-IL-9R
Abs, raises the question about the source of IL-9. Previously, presence
of IL-9 in mouse thymus was shown by in situ hybridization
(34). Because both murine and human IL-9 interact with the
human IL-9R
(35), IL-9 could be produced in our model
either by human thymocyte precursors or by murine stromal cells. We
looked whether IL-9 is produced in human thymus by a sensitive and
specific RT-PCR for detection of RNA message for human IL-9. As shown
in Fig. 5
, mRNA was detected in the human
thymus. Finally, we were able to demonstrate that mRNA for IL-9R
is
present on CD34+ thymocytes (Fig. 5
).
|
| Discussion |
|---|
|
|
|---|
signaling is important for T cell development. Four
types of experiments indicate that IL-9R
is critical for early T
cell development.
First, treating the FTOC with a mouse mAb blocking human IL-9R
decreased the number of human cells that develop in the mouse SCID
thymus when seeded with CD34+ hemopoietic
precursor cells from fetal liver. The inhibition appeared to be at the
transition between CD34+ to
CD34-CD1+CD4+CD3-
immature thymocytes.
Second, the results of using different mouse mAbs that all bind to
human IL-9R
, but differ in their neutralizing capacity, nicely fit
with their effect on the cell number when added in FTOC. This indicates
that the mAbs do not exert cytopathic effects on IL-9R
-bearing cells
in vitro, but that the neutralization of the binding capacity of the
receptor is essential to interfere with the normal T cell developmental
process.
Third, the block that is mediated by the mAb can be overcome by exogenous IL-9. This finding argues strongly against a toxic effect of the mAb or an aspecific inhibition mediated by the mAb preparation.
Fourth, addition of exogenous IL-9 to the FTOC augments the cell number
of the human cells obtained in FTOC, which signifies that IL-9R
triggering favors either cell growth or cell survival.
A model to explain the essential role of IL-9R
signaling evolves
from the comparison with the results obtained with IL-7. We have
previously shown that in FTOC neutralizing IL-7R
resulted in a
similar inhibition.
Here, however, the means by which IL-9R
signals was not apparent
from blocking studies of IL-9. Neutralization of either mouse or human
IL-9 or both did not result in the inhibition of T cell development in
FTOC (data not shown). This quandary is compatible with the view that
the experimental approach, in which neutralizing mAbs or polyclonal Abs
against IL-9 were used, was not powerful enough to result in a
significant neutralization of the cytokine.
Cumulatively, our findings suggest that we must add IL-9R
as an
essential signaling receptor for T lymphocyte differentiation in
addition to IL-7R
, whereas we did not find direct evidence for IL-9
as the critical ligand. This opens the challenging perspective that
another ligand for IL-9R
might be critical.
Particularly seminal will be the study of mice in which the
IL-9 and more importantly the IL-9R
genes will be disrupted. Since mAbs that neutralize the mouse IL-9R
binding are not available, we are not able to address whether in mouse
this receptor is equally of importance in the development of
thymocytes. We could not demonstrate any effect on FTOC seeded with
mouse fetal liver precursor cells by blocking mouse IL-9 with
polyclonal Abs (data not shown). These observations fit with the data
of He et al. (36), who found that a mAb to IL-9 did not
exert inhibitory effects when administrated in vivo in chimeric mice
reconstituted with adult bone marrow. Lack of mAbs that block the
murine IL-9R
do not allow us to investigate the role of the IL-9R
in murine FTOC.
Cumulatively, our findings reported here strongly favor the hypothesis
that, in man, IL-9R
signaling is essential for optimal survival
and/or growth and/or differentiation during early steps of intrathymic
T cell development. We propose that IL-9R signaling is not critical for
the entry of CD34+ fetal liver precursor cells,
because we obtained a similar block when the anti-IL-9R
Abs were
not given in the hanging drop, when the cells enter the thymic lobe,
but only added in FTOC. The partial inhibition that was observed in the
experiment when the Ab was given during the hanging drop procedure
alone can be attributed to the fact that the Ab already binds to the
IL-9R
of the CD34+ fetal liver precursor cells
in hanging drop without interfering with the entry of the cells but
inhibiting the differentiation of the cells in FTOC. Another
possibility is that enough Ab is carried over in the FTOC to exert an
inhibitory function on T cell development.
Human and murine IL-9 is mainly produced by activated T cells
(37) raising questions regarding the cellular sources of
IL-9 in the thymus, because activated T cells are absent at the start
of FTOC. With RT-PCR, we were able to demonstrate IL-9 mRNA in human
thymus (Fig. 5
). We found that purifying stromal cells resulted in an
increased IL-9 mRNA content per cell (data not show). However, whether
IL-9 is autotrophic or heterotrophic for CD34 precursor cells and
whether stromal cells or fetal liver cell-derived cell components
(e.g., dendritic cells) are producers of IL-9 is at present unclear.
Techniques such as single cell assays for IL-9 mRNA expression or
studies at the IL-9 protein level with high sensitivity are needed to
allow a better insight in this matter.
Our findings allow us to propose a new mechanism of disease for SCID in
humans. A lack of signaling through function deletion mutations of
IL-2R
c chain in human SCID is sufficient to
cause the disease. The main function of the
c-chain is to recruit the tyrosine kinase
JAK-3. However, theoretically an impairment of the function of a
variety of cytokines such as IL-2, IL-4, IL-7, and IL-15, which all use
the IL-2R
c chain, could also cause the
disease. Pallard et al. (38) confirmed our observation
that Abs inhibiting IL-7R
impair human T cell differentiation in
FTOC. They extended these experiments by introducing chimeric receptors
in T cell precursors and studying their ability to overcome the
anti-IL-7R
inhibition in FTOC. These experiments revealed that
chimeric receptors containing the extracellular domain of the human
IL-4 receptor and the transdomain and intracellular domain of
hIL-7R
-chain enabled to rescue human T cell differentiation by IL-4,
despite the anti-IL-7R
inhibition. This was not the case when
chimeric receptors were overexpressed that are no longer able to
activate the PI-3K or the STAT5B pathway. IL-9R
is associated with
JAK-1 (30) as is the case for IL-7R
. The signal
transduction pathway triggered by IL-9R
is surprisingly similar with
that triggered by IL-7R
, including STAT5 and PI3K (for review, Ref.
37). These findings are compatible with a synergy of the
receptors resulting in a common signaling pathways and that a critical
minimal threshold must be achieved by triggering both receptors, so
that both receptors are not redundant but essential. Alternative
explanations include the activation of specific intracellular mediators
such as STAT1 and -3, which are activated by IL-9, or the possibility
that IL-7R
and IL-9R
are expressed at distinct stages during T
cell development. Unfortunately, lack of Abs against IL-9R
that are
capable to detect IL-9R
positive cells by immunofluorescence do not
allow us to test this hypothesis.
Cumulatively, our findings strongly suggest that it is important to
consider not only lack of
c-chain, IL-7, and
IL-7R
, but also IL-9R
to explain the human SCID pathology.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jean Plum, Department of Clinical Chemistry, Microbiology and Immunology, University of Ghent, University Hospital of Ghent, 4Blok A, De Pintelaan 185, B-9000 Ghent, Belgium. E-mail address: ![]()
3 Abbreviations used in this paper: X-SCID, X-linked SDID; FTOC, fetal thymus organ culture; DP, double positive;
c, common
-chain; PI, propidium iodide; HPRT, hypoxanthin phosphoribosyltransferase. ![]()
Received for publication August 25, 1999. Accepted for publication December 3, 1999.
| References |
|---|
|
|
|---|
chain mutation results in X-linked severe combined immunodeficiency in humans. Cell 73:147.[Medline]
chain in IL-2, IL-4, and IL-7 signalling. Mol. Cell. Biol. 14:5433.
chain regulates the size and content of the peripheral lymphoid compartment. Immunity 3:521.[Medline]
and P40 induce day 15 murine fetal thymocyte proliferation in combination with IL-2. J. Immunol. 144:1783.[Abstract]
chain with the functional IL-9 receptor complex. Int. Immunol. 7:115.
c chains with Jak1 and Jak3: implications for XSCID and XCID. Science 266:1042.
-chain of cytokine receptors regulates intrathymic T cell development at multiple stages. J. Immunol. 158:2592.[Abstract]
This article has been cited by other articles:
![]() |
Q. Jiang, J. Huang, W. Q. Li, T. Cavinato, J. R. Keller, and S. K. Durum Role of the Intracellular Domain of IL-7 Receptor in T Cell Development J. Immunol., January 1, 2007; 178(1): 228 - 234. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Qiu, R. Lai, Q. Lin, E. Lau, D. M. Thomazy, D. Calame, R. J. Ford, L. W. Kwak, R. A. Kirken, and H. M. Amin Autocrine release of interleukin-9 promotes Jak3-dependent survival of ALK+ anaplastic large-cell lymphoma cells Blood, October 1, 2006; 108(7): 2407 - 2415. [Abstract] [Full Text] [PDF] |
||||
![]() |
E Melen, H Gullsten, M Zucchelli, A Lindstedt, F Nyberg, M Wickman, G Pershagen, and J Kere Sex specific protective effects of interleukin-9 receptor haplotypes on childhood wheezing and sensitisation J. Med. Genet., December 1, 2004; 41(12): e123 - e123. [Full Text] [PDF] |
||||
![]() |
C. Gutierrez-Frias, R. Sacedon, C. Hernandez-Lopez, T. Cejalvo, T. Crompton, A. G. Zapata, A. Varas, and A. Vicente Sonic Hedgehog Regulates Early Human Thymocyte Differentiation by Counteracting the IL-7-Induced Development of CD34+ Precursor Cells J. Immunol., October 15, 2004; 173(8): 5046 - 5053. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Utsuyama, J. Shiraishi, H. Takahashi, M. Kasai, and K. Hirokawa Glia maturation factor produced by thymic epithelial cells plays a role in T cell differentiation in the thymic microenvironment Int. Immunol., May 1, 2003; 15(5): 557 - 564. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Stassen, C. Muller, M. Arnold, L. Hultner, S. Klein-Hessling, C. Neudorfl, T. Reineke, E. Serfling, and E. Schmitt IL-9 and IL-13 Production by Activated Mast Cells Is Strongly Enhanced in the Presence of Lipopolysaccharide: NF-{{kappa}}B Is Decisively Involved in the Expression of IL-9 J. Immunol., April 1, 2001; 166(7): 4391 - 4398. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |