The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shin, E. K.
Right arrow Articles by Meek, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shin, E. K.
Right arrow Articles by Meek, K.
The Journal of Immunology, 2000, 164: 1416-1424.
Copyright © 2000 by The American Association of Immunologists

Analyses of TCRB Rearrangements Substantiate a Profound Deficit in Recombination Signal Sequence Joining in SCID Foals: Implications for the Role of DNA-Dependent Protein Kinase in V(D)J Recombination1

Euy Kyun Shin*, Tonnie Rijkers{dagger}, Albert Pastink{dagger} and Katheryn Meek2,*

* Harold C. Simmons Arthritis Research Center, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, TX 75235; and {dagger} Department of Radiation Genetics and Chemical Mutagenesis, MGC, Leiden University Medical Center, Leiden, The Netherlands


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
We reported previously that the genetic SCID disease observed in Arabian foals is explained by a defect in V(D)J recombination that profoundly affects both coding and signal end joining. As in C.B-17 SCID mice, the molecular defect in SCID foals is in the catalytic subunit of the DNA-dependent protein kinase (DNA-PKCS); however, in SCID mice, signal end resolution remains relatively intact. Moreover, recent reports indicate that mice that completely lack DNA-PKCS also generate signal joints at levels that are indistinguishable from those observed in C.B-17 SCID mice, eliminating the possibility that a partially active version of DNA-PKCS facilitates signal end resolution in SCID mice. We have analyzed TCRB rearrangements and find that signal joints are reduced by ~4 logs in equine SCID thymocytes as compared with normal horse thymocytes. A potential explanation for the differences between SCID mice and foals is that the mutant DNA-PKCS allele in SCID foals inhibits signal end resolution. We tested this hypothesis using DNA-PKCS expression vectors; in sum, we find no evidence of a dominant-negative effect by the mutant protein. These and other recent data are consistent with an emerging consensus: that in normal cells, DNA-PKCS participates in both coding and signal end resolution, but in the absence of DNA-PKCS an undefined end joining pathway (which is variably expressed in different species and cell types) can facilitate imperfect signal and coding end joining.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
V(D)J recombination is the molecular mechanism that generates a diverse repertoire of Ag-specific receptors in B and T lymphocytes (reviewed in Ref. 1). This process is initiated by a lymphocyte-specific endonuclease (the products of the recombination-activating genes I and II; RAG13 and RAG2) that recognizes and cleaves at target sequences adjacent to the immune receptor gene segments (2, 3, 4). The centrality of V(D)J recombination to the development of the vertebrate immune system is illustrated in situations in which the process is impaired; defective V(D)J recombination results in a block of B and T cell lymphopoiesis, and the disease SCID (5, 6, 7, 8, 9, 10, 11). The first example of this phenomenon was the description of defective V(D)J recombination in C.B-17 mice (12). In 1990, it was demonstrated that the defect in SCID mice not only impairs V(D)J recombination, but also affects the more general process of DNA double-strand break repair (DSBR) (13, 14). This observation was the first to link V(D)J recombination and DSBR.

In eukaryotes, two major mechanisms exist for the repair of double-strand DNA breaks (DSBs): 1) homologous recombination (HR), in which repair of the damaged DNA is directed by gene conversion; and 2) nonhomologous end joining (NHEJ), an error prone end to end joining pathway (reviewed in Ref. 15). In yeast, DSBs are generally repaired via HR, whereas NHEJ plays a very minor role. Higher eukaryotes are exactly opposite, depending heavily on NHEJ to repair DSBs, while HR plays a less significant role. At least five DNA repair factors are required for V(D)J recombination: XRCC4, Ku70 (XRCC5), Ku 86 (XRCC6), DNA-PKCS (XRCC7), and DNA ligase IV (6, 10, 11, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32); three of these are components of the DNA-dependent protein kinase (the Ku heterodimer), and DNA-PKCS (33, 34, 35, 36, 37).

The RAG endonuclease is targeted specifically to immune receptor gene segments by simple DNA sequence elements (recombination signal sequences, RSS) adjacent to V, D, and J gene segments, and involves two dsDNA cuts and subsequent religations (mediated by the NHEJ pathway). This results in the formation of two new DNA joints, coding joints that are generally modified by nucleotide additions and/or deletions and signal joints that contain the two RSS and are largely unmodified (38). It was initially recognized that the defect in C.B-17 SCID mice affected only coding joint resolution, leaving signal joint formation relatively intact (5), although more recent data demonstrate a modest defect in both the rate and fidelity of signal end resolution (39, 40, 41, 42). In 1994, the defect in SCID mice was first shown to be in DNA-PKCS (16).

In 1995, we demonstrated that the defective mechanism in SCID foals is V(D)J recombination (9); as with C.B-17 SCID mice, the mutant factor in SCID foals is DNA-PKCS (26). However, our analyses suggested that in SCID foals, both coding and signal end resolution are profoundly diminished. In fact, subsequent reports, in which two additional rodent cell lines with DNA-PKCS mutations were characterized, also support a role for DNA-PKCS in signal end joining (43, 44), although analyses of a human cell line with defective DNA-PKCS expression suggest that DNA-PKCS is not required for signal joining (45). The murine SCID mutation results in the deletion of only 83 amino acids from the C terminus of DNA-PKCS (46, 47), whereas substantially more of the protein (967 amino acids) is deleted by the equine SCID mutation (26). Thus, we hypothesized that some residual DNA-PKCS activity in SCID mice (possibly independent of kinase activity) might explain the observed difference in signal ligation. Recent reports demonstrating that mice with targeted deletions of DNA-PKCS also have relatively normal signal end resolution negate this hypothesis (39, 40, 41, 42). In sum, in recent years, no less than eight reports with considerably diverse conclusions have focused attention on the role of DNA-PKCS in signal end resolution. An emerging consensus is that (at least in rodents), in the absence of DNA-PKCS, there is a modest deficiency in both the rate and fidelity of signal end joining coupled with a much more substantial diminution of coding end resolution.

Our initial studies of endogenous Ig light chain rearrangements from SCID foals revealed two differences from SCID mice: 1) undetectable V{kappa}-J{kappa} signal joints in equine lymphocytes as compared with murine lymphocytes; and 2) a lack of leakiness when analyzing light chain coding joints from SCID foals as compared with SCID mice (9, 48). Since in our initial studies only Ig light chain rearrangements were analyzed (because of limited available sequence information of horse immune receptor genes), it might be argued that the lack of observed signal joints might actually reflect tighter temporal control of Ig gene rearrangement in equine vs murine lymphocytes. The requirement for successful heavy chain rearrangement before the initiation of light chain rearrangement might be more tightly enforced in equine lymphocytes than in murine lymphocytes. Thus, one possible explanation for the lack of V{kappa}-J{kappa} signal joints in SCID foals is that light chain rearrangement is not initiated. Although our conclusion (that signal end joining is impaired in SCID foals) was supported by analyses of rearrangements of extrachromosomal substrates in cell lines derived from SCID foals, these experiments were limited by the fact that these plasmid substrates do not replicate in equine cell lines, making quantitation difficult (9).

In this study, we establish that the capacity for both signal and coding end joining at a recombinationally active TCRB locus in equine SCID lymphocytes is ~4 logs lower than in normal lymphocytes. Additionally, we present data suggesting that the observed differences in end resolution are not because of the specific nature of the mutant DNA-PKCS allele in SCID foals, but more likely reflect differences between species in the ability to bypass the requirement for DNA-PKCS during certain types of end joining.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
DNA isolation

DNA was prepared from thymus collected from a 20-day-old SCID foal and from a normal foal ~2 mo old using commercially available DNA extraction buffer (Applied Biosystems, Foster City, CA). Similarly, DNA was isolated from the spleen of both SCID and normal animals.

Oligonucleotides

Sequences of oligonucleotides used in this study are as follows: 5'-DB, CCAACCTCTGCCACCTGTGCT; 5'-DB inner, CTGCCGCTGCCCAGTGGT; 3'-DB, CCATCCCAGAGCAGATTCCCG; 3'-DB inner, GCTGTGCGGGGTGTTTTC; 5'-JB, TGTCCAGATTACCATGTCCAG; 5'-JB inner, CTAATTCTGGAAATGGGAAG; 3'-JB, TAGCACAGTGAGCCGAGTCCC; 3'-JB inner, TGGCCCGAAGAACAGCTC; 5'-DB RSS, CCCCCAGTCCCCACAATGTTA; 3'-DB RSS, AAGCACCTCCTTTACCTG; 5'-VB, TTCTGGGCTTGGTGTTCTCGTCTCT; 5'-VB inner, GGTCAAATTTCCCATCAG; 5'-VB inner-2, AACATTTTCAACTCTGACAGTGA; 5'-DFL16.1, ACCAGAGACCATACTGGCCAGGGC; 3'-DFL16.1, CTCAAGAGTCTGCTGGGCACAATG; 5'-JH1, GGTGCCTTAAGGCAGGATATGGAGAGAGTT; 3'-JH1, GTTCTAGAATGGAATGTGCAGAAAGAAAAA.

Polymerase chain reactions

PCR reactions were conducted using the indicated amounts of DNA in 100 µl reactions. For the experiment depicted in Fig. 1Go, 40 cycles of amplification were performed using Elongase (Life Technologies, Gaithersburg, MD) and the following conditions: 94oC for 30 s, 59oC for 1.5 min, 68oC for 8 min. For the nested PCR experiments depicted in Figs. 2Go, B–D, and 3, A–C, Taq polymerase was utilized; initial amplification conditions were: 94oC for 1.5 min, 61oC for 2 min, and 72oC for 3 min for 40 cycles. A total of 10 µl of each reaction was subsequently amplified as follows: 94o C for 1.5 min, 52oC for 2 min, and 72oC for 3 min for 40 cycles. In Fig. 2GoA, amplification conditions were the same, but only 40 cycles were performed. For the experiment depicted in Fig. 5Go, Taq polymerase was utilized; 40 cycles of amplification were performed as follows: 94oC for 1.5 min, 58oC for 2 min, and 72oC for 3 min. A total of 20 µl of each PCR reaction was analyzed by Southern filter hybridization analysis. For sequence analysis, amplified rearrangements were gel purified and ligated into pCR2.1 (Invitrogen, Carlsbad, CA) and transformed into competent Escherichia coli. Recombinant colonies were identified by hybridization and sequenced on an ABI sequencer (Applied Biosystems, Foster City, CA).



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 1. Isolation of the equine DB2-JB2.1 intervening region. PCR amplification of 1 µg spleen DNA isolated from a SCID foal (lane 1) or a normal foal (lane 2) using amplification primers 5'-DB and 3'-JB. Amplification conditions are described in Materials and Methods.

 


View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 2. Analysis of TCRB rearrangements. A, PCR amplification of the germline DB gene (using the amount of DNA (µg) indicated above) from thymus DNA from a normal foal (lanes 1–4), thymus DNA from a SCID foal (lanes 5–8), or no DNA (lane 9). Amplification of the DB2 gene segment (as described in Materials and Methods) was done using the following oligonucleotides: 5'-DB and 3'-DB. B, Nested PCR amplification of DB-JB coding joints (using the amount of DNA (µg) indicated above) from thymus DNA from a normal foal (lanes 1–7), no DNA (lanes 8 and 12), or thymus DNA from a SCID foal (lanes 9–11). Amplification of DB-JB coding joints (as described in Materials and Methods) was done using the following oligonucleotides: 5'-DB and 3'-JB and then 5'-DB inner and 3'-JB inner. C, Nested PCR amplification of VB-DB-JB coding joints (using the amount of DNA (µg) indicated above) from thymus DNA from a normal foal (lanes 1–7), no DNA (lanes 8 and 12), or thymus DNA from a SCID foal (lanes 9–11). Amplification of VB-DB-JB coding joints (as described in Materials and Methods) was done using the following oligonucleotides: 5'-VB and 3'-JB and then 5'-VB inner and 3'-JB inner. D, Nested PCR amplification of DB-JB signal joints (using the amount of DNA (µg) indicated above) from thymus DNA from a normal foal (lanes 1–7), no DNA (lanes 8 and 12), or thymus DNA from a SCID foal (lanes 9–11). Amplification of DB-JB signal joints (as described in Materials and Methods) was done using the following oligonucleotides: 5'-JB and 3'-DB and then 5'-JB inner and 3'-DB inner.

 


View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 5. Analysis of DHJH rearrangements in RAD52-/- and SCID/RAD52-/- mice. PCR amplification of DHJH coding joints (top panel) or DHJH signal joints (bottom panel) from spleen DNA (using the amount of DNA (µg) indicated above) derived from a SCID/RAD52-/- mouse (lanes 1–4), or from spleen DNA derived from a RAD52-/- mouse (lanes 5–8). Amplification of DHJH coding joints (as described in Materials and Methods) was done using the following oligonucleotides: 5'-DFL16.1 and 3'-JH1. Amplification of DHJH signal joints (as described in Materials and Methods) was done using the following oligonucleotides: 3'-DFL16.1 and 5'-JH1.

 
Cell lines

The 0176 and 1821 cell lines were established from dermal biopsies from a normal horse (0176) and a SCID foal (1821) and were the generous gift of Dr. Lance Perryman (North Carolina State University, Raleigh, NC). The SF19 fibroblast cell line was established from a C.B-17 SCID mouse and was the generous gift of Dr. Mel Bosma (Fox Chase Cancer Center, Philadelphia, PA). The 100E cell line (a murine SCID fibroblast cell line that harbors a fragment of human chromosome 8, including the DNA-PKCS gene) was the generous gift of Dr. Cordula Kirchgessner (Stanford University, Stanford, CA) and has been described previously (23).

Immunoblot analysis

The indicated amounts of whole cell extracts were electrophoresed in an SDS/5% polyacrylamide gel and transferred to polyvinylidene difluoride. A mAb (18-2) that recognizes the N-terminal 250 kDa of DNA-PKCS (generous gift of Dr. Tim Carter, St. John’s University, Jamaica, NY) was used as the primary Ab (1:300), and a goat anti-mouse IgG conjugated to HRP was used as the secondary Ab. The membrane was then incubated with an enhanced chemiluminescent substrate (ECL; DuPont, Wilmington, DE), according to the manufacturer’s recommendations.

Construction of DNA-PKCS expression vectors

The following three fragments spanning the DNA-PKCS coding sequence were assembled from eight shorter RT-PCR fragments isolated from the Ramos human B cell lymphoma cell line: 1–3,860, 3,559–8,173, and 7,911–12,358. The fragments were initially cloned into a low copy number plasmid, pGp1f, which has been shown to accept large inserts (generous gift of Dr. Nils Lonberg, GenPharm International, Mountain View, CA). Considerable difficulty was encountered in the initial assembly of the full-length cDNA apparently because of the instability of the cDNA and the toxicity of this sequence to E. coli. These problems were largely eliminated by using a low copy number plasmid and using E. coli deficient in bacterial recombination systems (STBL cells; Life Technologies). NotI sites were engineered by PCR just 5' of the translation initiation site and just 3' of the translation termination site using the following oligonucleotides: 5'-Not, GGACGCGGCCGCATGGCG; 3'-Not, GCGGCCGCAGACCTCACATCCA.

At this point, the sequence of each fragment was confirmed. These three fragments were assembled into a single plasmid by stepwise cloning of the 7,911–12,358 fragment into the plasmid-containing fragment 1–3,860 fragments via SalI sites at 3,482 and 7,933 in the DNA-PKCS coding sequence and an MluI site in the plasmid backbone. Subsequently, the 3,600–8,050 fragment was inserted into the SalI site. Cloning sites were resequenced at this step. The full-length NotI cDNA was then subcloned into the pCMV6 expression vector that provides CMV promoter elements as well as transcription termination and polyadenylation sequences from the human growth hormone gene.

To generate the truncation mutant, a PCR fragment spanning nucleotides 8057–9480 was generated with the following oligonucleotides: 5'-Fse, GGACGAGGTGGATAACAAAGT; 3'-mut, GGGATATCTAAGGGGAATTTGATAAATTGCCTTGTTTGC.

The 3' oligonucleotide incorporates the frameshift at nucleotide 9453 and adds an EcoRV restriction site. The resulting PCR fragment spans a unique FseI site at position 8159. After subcloning into PCR2.1 and sequencing, this PCR fragment was restricted with FseI and EcoRV and then ligated into the full-length DNA-PKCS cDNA that had been restricted with FseI and Eco721 (unique, blunt site at position 11,145). Cloning sites were resequenced in the resulting plasmid.

Extrachromosomal V(D)J recombination assays

Extrachromosomal substrate assays were performed essentially as described by Hesse et al. (49). Briefly, to assess V(D)J recombination in SF19 cells, RAG1 and RAG2 expression constructs (6 µg each; generous gift of Dr. Moshe Sadofsky, Medical College of Georgia, Augusta, GA), DNA-PKCS expression constructs or vector controls (6 µg each), and recombination substrates pJH201 or pJH290 (1 µg each; the generous gifts of Martin Gellert and Joanne Hesse, National Institutes of Health, Bethesda, MD) were transiently introduced into the SF19 cells via liposome transfection using Fugene (Roche Molecular Biochemicals, Indianapolis, IN), according to the manufacturer’s suggested protocol. Forty-eight hours later, the plasmid substrates were rescued by preparing alkaline lysates and restricting with DpnI. A portion of the recovered substrates was subsequently used to transform competent E. coli (max efficiency DH5{alpha}; Life Technologies). The transformed bacteria were plated in duplicate onto plates containing ampicillin alone (100 µg/ml) or both ampicillin and chloramphenicol (22 µg/ml). In each case, plasmid DNA was prepared from at least 20% of the putative recombinants to insure authenticity (i.e., to establish that a recombination event had occurred) and, in the case of pJH201, to determine the fidelity of signal joining.

Assessment of radiation sensitivity

Cells (103) were exposed to various amounts of ionizing radiation using a 137Ce source calibrated at 558.8 R/min and immediately seeded in complete medium containing 10% FBS. After 8 days, cell colonies were fixed with 2% formaldehyde, followed by 100% methanol. Subsequently, the colonies were stained with trypan blue, and colony numbers were assessed.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Isolation of equine DB2-JB2.1 intervening sequence

Like Ig gene rearrangement, TCR rearrangement is temporally regulated. In the thymus, DB to JB rearrangement precedes VB to DBJB rearrangement, which precedes rearrangement of the TCR{alpha} locus. To analyze early TCR rearrangements from SCID thymocytes, the intervening region between TCR DB2 and TCR JB2.1 was amplified from spleen DNA using amplification primers derived from published equine TCRB transcripts (Fig. 1Go) (50). As can be seen, a single hybridizing band of ~800 bp is present in amplifications of SCID spleen DNA (representing the germline configuration of the DB2 and JB2.1 genes), whereas two bands (~800 and ~160 bp, representing unrearranged and rearranged, respectively) are apparent in amplifications from normal spleen DNA. The resulting 800-bp amplification product was sequenced, and amplification primers were generated to analyze TCR DB-JB rearrangements.

Analyses of DBJB coding joints

DNA was prepared from the thymus of a 3-wk-old SCID foal and from the thymus of an ~2-mo-old normal foal. Although a thymus sample was only available from one SCID foal, completely analogous results (as those presented below) were obtained in experiments using spleen DNA from one normal animal and three additional SCID foals. The germline DB2 gene segment (Fig. 2GoA) and JB2.1 gene segment (data not shown) are amplified equally from both normal and SCID thymus DNA. In our initial analysis, although both coding and signal joints were readily detectable from as little as 10 ng of normal thymus DNA, DBJB rearrangements were not detected from the SCID thymus DNA (data not shown). Thus, a more sensitive nested PCR strategy was utilized, as shown in Fig. 2Go, B–D. As can be seen, using this approach, DBJB coding joints could consistently be detected from 0.5 ng normal thymus DNA (and in some experiments as little as 0.05 ng). In contrast, DBJB coding joints could only be detected using 5 µg SCID thymus DNA. Thus, we conclude that the frequency of DBJB coding joints in SCID thymus is at least 4 logs lower than in normal thymus. We also assessed complete VBDBJB rearrangements in both normal and SCID thymus DNA using a nested amplification strategy and VB primers that should prime only a subset of known equine VB gene segments. As can be seen in Fig. 2GoC, VBDBJB rearrangements are readily detectable in as little as 5 ng normal thymus DNA. Complete VBDBJB rearrangements were not consistently detected from SCID thymus; these rearrangements were detected in two of five experiments and only using the highest concentration of DNA (5 µg).

To examine the fine structure of the SCID coding joints, amplification products from several different experiments were cloned and sequenced. These sequences are presented in Table IGo. Duplicate sequences isolated from the same PCR product were eliminated. As can be seen, the rare SCID rearrangements are not substantially different from rearrangements isolated from normal animals. No excessive P segments were observed, as has been reported in SCID mice. It has been demonstrated that rare rearrangements from Ku-deficient mice lack N segments and that SCID mice have a less pronounced deficiency in N segment addition (51). In these sequences, there is a modest decrease in both the length of N segments (average length: 6 bp vs 2.6 bp in rearrangements from normal and SCID thymus, respectively) and the percentage of N segment-positive rearrangements isolated from this SCID foal. In the three rearrangements that lack N segments from SCID thymus, the coding junction occurs at short regions of sequence homology.


View this table:
[in this window]
[in a new window]
 
Table I. Sequence analyses of DB-JB coding joints1

 
Analyses of DBJB signal joints

The frequency of DBJB signal joints in both normal and SCID thymus was similarly assessed (Fig. 2GoD). As can be seen, signal joints are readily detected in as little as 0.5 ng normal thymus DNA, whereas signal joints can only be detected in 5 µg of SCID thymus DNA. Detection of signal joints in SCID thymus was inconsistent, being detected in only two of five experiments. Thus, we conclude that the frequency of DBJB signal joints in SCID thymus is ~4 logs lower than in normal thymus.

Hybrid joints are less diminished in SCID thymocytes than standard joints

Hybrid joints represent apparent mistakes of the recombinase and are the result of ligation of the coding end of one gene segment to the signal end of a second gene segment (52). The frequency of hybrid joining, as assessed using extrachromosomal substrates, has been estimated at 10–30% the rate of standard joining (52). The frequency of hybrid rearrangements of endogenous immune receptor gene segments is considerably lower, 100- to 1000-fold less than standard joining depending on the specific rearrangements analyzed (53, 54). In 1997, Han et al. made the observation that the capacity of Ku80-deficient cell lines to support RAG-induced hybrid joining of an extrachromosomal recombination substrate was similar to that observed in normal cell lines (55). These investigators reported analogous results in studies of cell lines and/or animals deficient in either DNA-PKCS or XRCC4 (41, 51, 56). This led to their hypothesis that hybrid rearrangements might be mediated solely by the RAG proteins. More specifically, they suggested that in a reversal of the normal cleavage reaction, RAG proteins might catalyze a reaction, whereby the 3'-OH from a signal end attacks the phosphodiester of the hairpinned coding end, resulting in hybrid joining. In 1998, Melek et al. (57) substantiated this hypothesis, showing in a cell-free system that the RAG proteins alone could mediate hybrid joining.

Three types of TCRB hybrid rearrangements were assessed in normal and SCID thymus DNA (Fig. 3Go, A–C). When amplifying normal thymus DNA, consistent detection of all three types of hybrid joints required using 500 ng thymus DNA in each amplification. This is in good agreement with previous studies demonstrating that hybrid rearrangements at endogenous loci occur 100- to 1000-fold less frequently than standard rearrangements (53, 54). Relative frequencies of the three different hybrid joints varied considerably in SCID thymocytes. Hybrid joints involving a VB coding segment and the 5'-DB RSS were consistently detected (four of four experiments) at roughly equivalent levels in SCID and normal thymocytes. Several of these rearrangements were cloned and sequenced from both normal and SCID animals (data not shown). In each case, the 5'-DB RSS was completely intact. Because germline VB sequences are not available, it is impossible to determine the extent of nucleotide deletion and/or addition at the VB-DB RSS junction. Still, the modest extent of junctional diversity observed in these rearrangements is consistent with RAG-mediated hybrid joining. Hybrid joints involving the JB coding segment and the 3'-DB RSS could be detected using 5 µg SCID thymus DNA in one of five experiments; thus, these hybrid joints occur at least 2 logs less frequently in SCID thymocytes than in normal thymocytes. Hybrid rearrangements involving the DB coding segment and the JB RSS were not detected in SCID thymus.



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 3. Analysis of TCRB hybrid rearrangements. A, Nested PCR amplification of VB coding to 5'-DB RSS hybrid joints (using the amount of DNA (µg) indicated above) from thymus DNA from a normal foal (lanes 1–4), no DNA (lane 5), or thymus DNA from a SCID foal (lanes 6–9). Amplification of hybrid joints (as described in Materials and Methods) was done using the following oligonucleotides: 5'-VB and 5'-DB and then 5'-VB inner and 5'-DB inner. B, Nested PCR amplification of JB coding to 3'-DB RSS hybrid joints (using the amount of DNA (µg) indicated above) from thymus DNA from a normal foal (lanes 1–4), thymus DNA from a SCID foal (lane 5), or no DNA (lane 6). Amplification of hybrid joints (as described in Materials and Methods) was done using the following oligonucleotides: 3'-JB and 3'-DB and then 3'-JB inner and 3'-DB inner. C, Nested PCR amplification of DB coding to JB RSS hybrid joints (using the amount of DNA (µg) indicated above) from thymus DNA from a normal foal (lanes 1–4), thymus DNA from a SCID foal (lane 5), or no DNA (lane 6). Amplification of hybrid joints (as described in Materials and Methods) was done using the following oligonucleotides: 5'-JB and 5'-DB and then 5'-JB inner and 5'-DB inner.

 
Several conclusions can be derived from these results. First, the fact that some hybrid joints are found at similar frequencies in SCID and normal thymocytes corroborate previous studies suggesting that the RAG proteins alone can mediate hybrid rearrangements in vivo (41, 51, 55, 56). However, the fact that certain hybrid joints are not detected in SCID thymocytes suggests that the RAG proteins cannot mediate all hybrid joints equivalently, and that some hybrid joints are facilitated by the DNA-PK-dependent joining pathway. Finally, the fact that certain hybrid joints can be detected at similar frequencies in wild-type and SCID thymocytes confirms that the TCRB locus is recombinationally active in SCID thymocytes. In sum, these analyses of equine TCRB rearrangements verify the fact that the equine SCID phenotype includes 1) a severe diminution in signal end resolution not observed in SCID mice, and 2) substantially less leakiness in coding end resolution than observed in SCID mice.

Does the mutant equine DNA-PKCS allele inhibit RS joining?

An attractive hypothesis suggested by Gao et al. (39) to explain the discrepancies between the equine and murine SCID phenotypes is that the mutant equine SCID allele might act in a dominant-negative fashion that interrupts normal Ku function, thus explaining the lack of signal joints in these cells. There are several lines of evidence that weaken their argument. First, if the mutant DNA-PKCS protein inhibits Ku function in equine SCID cells, one might expect to observe the well-documented growth abnormalities that are observed in both Ku70- and Ku80-deficient mice (6, 10, 21, 58) in SCID foals. However, except for their immunologic disorders, SCID foals are phenotypically indistinguishable from normal foals (59). Second, in our initial characterization of the equine SCID defect, DNA-PKCS was completely undetectable in immunoblot analysis of extracts from cell lines derived from SCID foals presumably because the mutant protein is unstable. At that time, we had no information as to the specific mutation responsible for the DNA-PKCS deficiency. In the immunoblot analyses, a mixture of anti-DNA-PKCS Abs was utilized, two of which specifically recognize epitopes within the C-terminal 150 kDa of DNA-PKCS and not likely present in the mutated protein in equine SCID cells. Thus, we reexamined DNA-PKCS expression in cell lines from both normal and SCID foals using only the Ab that specifically recognizes the N-terminal 250 kDa of DNA-PKCS (Fig. 4GoA). As can be seen using this Ab, DNA-PKCS is detectable in as little as 12.5 µg whole cell extract from the normal cell line; no unique proteins of ~360 kDa (the predicted size of the mutant DNA-PKCS protein) are detected in as much as 200 µg of whole cell extract from the SCID cell line. Thus, if a mutant form of DNA-PKCS is expressed in equine SCID cells, it appears to be at least 16-fold less abundant than wild-type DNA-PKCS. These data support our initial conclusion that the mutant form of DNA-PKCS in equine SCID cells is unstable.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 4. The mutant DNA-PKCS protein is unstable and not functional. A, Immunoblot analysis of whole cell extracts from the normal equine fibroblast cell line, 0176 (lanes 1–4), using either 100 µg, 50 µg, 25 µg, or 12.5 µg cell extract as indicated, and the SCID fibroblast cell line, 1821 (lanes 5 and 6), using 200 µg or 50 µg extract, as indicated. An anti-DNA-PKCS mAb (18-2, generous gift of Dr. Timothy Carter), which recognizes an epitope within the N-terminal 250 kDa of DNA-PKCS, was utilized. Position of DNA-PKCS and the 200 kDa m.w. marker are indicated with arrows. B, Immunoblot analysis of whole cell extracts from human chromosome 8-transfected cells (lane 1), or SF19 cells transfected with vector alone (lane 2), full-length DNA-PKCS (lane 3), or DNA-PKCS truncated at amino acid 3160. C, Radiation resistance of untransfected murine SCID cells or clonal transfectants transfected with full-length DNA-PKCS expression vector, DNA-PKCS expression vector truncated at amino acid 3160, or harboring a fragment of human chromosome 8. Data are presented as percent survival of unirradiated controls and represent average of triplicate samples.

 
Although it seems implausible that an unstable form of DNA-PKCS could act as a dominant-negative inhibitor, the possibility exists that a low level of a mutant form of DNA-PKCS inhibits signal end joining in equine SCID cells. Thus, to more formally address this possibility, a human DNA-PKCS expression vector with a mutation analogous to the mutation in SCID horses was constructed. This was done first by assembling full-length human DNA-PKCS from a series of overlapping cDNA fragments. The complete coding sequence of human DNA-PKCS was subcloned into the pCMV6 mammalian expression vector. An internal deletion within the coding region was generated such that a frame shift analogous to the equine mutation occurs after amino acid 3160, adding an additional three amino acids from the altered reading frame before the occurrence of a stop codon. Plasmids encoding both full-length and mutated forms of DNA-PKCS as well as vector only controls were stably transfected into the SF19 murine SCID fibroblast cell line and clonal transfectants derived. In immunoblot analyses of whole cell extracts from the transfectants, full-length DNA-PKCS is easily detected and is expressed at roughly equivalent levels as in mouse SCID cells that harbor a portion of human chromosome 8 that contains the DNA-PKCS gene (Fig. 4GoB). As with equine DNA-PKCS, truncation of human DNA-PKCS at amino acid 3160 generates an unstable protein that cannot be clearly detected in the transfectants. As expected, full-length DNA-PKCS substantially restores the radiation resistance of the SF19 cell line, demonstrating the efficacy of our DNA-PKCS expression strategy (Fig. 4GoC). In contrast, transfectants expressing the mutated form have similar radiation sensitivity as the control transfectants. Of note, similar to a recent report (60), the DNA-PKCS transfectants described in this work are more radioresistant than the human chromosome 8 SCID transfectants.

We next assessed both coding and signal joint formation in murine SCID fibroblasts using a transient recombination assay. Three independent transfections are shown; data are presented as number of recombinants/µg substrate transfected. As can be seen, full-length DNA-PKCS substantially reverses the defect in coding joint formation in these murine SCID fibroblasts (Table IIGo). In contrast, coding joint formation was not detected in either control transfectants (including pCMV6 and the RAG expression vectors) or transfections including the expression vector encoding the mutant protein. As expected, the murine SCID fibroblasts are capable of supporting reasonable levels of signal end joining, as assessed with the pJH201 substrate. In this cell line, the fidelity of signal joining is relatively high in the absence of functional DNA-PKCS (85%). The modest improvement in signal fidelity when full-length DNA-PKCS expression vector is cotransfected (95%) is not statistically significant. As can be seen, cotransfection of the expression vector encoding DNA-PKCS, which is truncated at amino acid 3160, had no effect on the rate or fidelity of signal end resolution in murine SCID cells. In sum, we find no evidence of a dominant-negative effect by DNA-PKCS truncated at amino acid 3160. These data suggest that the differences in signal end resolution in SCID mice as compared with SCID foals represent actual differences in the absolute requirement for DNA-PKCS during V(D)J recombination.


View this table:
[in this window]
[in a new window]
 
Table II. Transient recombination in the murine SCID fibroblast cell line SF191

 
Do other end joining pathways contribute to coding and signal end resolution in the absence of DNA-PKCS?

There are several discrepancies between the phenotypes of animals (or cell lines) deficient in the different components of the nonhomologous DNA end joining pathway. As discussed above, animals and cell lines vary in their requirements for DNA-PKCS for both coding and signal joint formation. In contrast, deficiencies in either subunit of Ku, XRCC4, or DNA ligase IV result in both defective signal and coding resolution in similar experimental systems. There are also discrepancies in radiosensitivity of certain cell types, specifically ES cells. Although Ku- and XRCC4-deficient ES cells display extreme radiosensitivity, DNA-PKCS-deficient ES cells have similar radioresistance as normal ES cells.

Several different models have been suggested to explain these apparent discrepancies. First, it has been proposed that DNA-PKCS is not involved in signal joining. The data presented in this study demonstrate that DNA-PKCS is involved in signal end joining, at least in certain species.

A second model that has been proposed is that Ku is required to disassemble the RAG postcleavage complex; without Ku, the RAG proteins remain bound to coding and signal ends, thus explaining why Ku-deficient mice have a more severe defect in V(D)J recombination than DNA-PKCS-deficient mice (10). Although there is considerable evidence suggesting that Ku may be involved in remodeling the recombination complex (10, 61), this still would not account for the lack of signal resolution and more severe coding joint defect observed in SCID foals. Also, this model does not address the discrepancies in radiosensitivity between Ku and DNA-PKCS ES cells.

An attractive theory proposed by several investigators is that additional DNA end joining pathways may function to repair signal ends and some coding ends in DNA-PKCS-deficient mice or in DNA-PKCS-deficient ES cells (39, 41, 45). Bogue et al. have suggested that in normal animals, DNA-PKCS is involved in both coding and signal end resolution, providing for the efficient resolution of hairpinned coding ends and the near perfect ligation of signal ends (41). However, in the absence of DNA-PKCS, an alternative end joining pathway provides for signal end (and certain coding end) joining, but with lower efficiency and fidelity than in the presence of DNA-PKCS. Additionally, Gao et al. (39) have speculated that an alternative end joining pathway that is highly expressed in ES cells repairs DNA strand breaks in DNA-PKCS-deficient ES cells. To explain the marked differences in V(D)J recombination defects in DNA-PKCS-deficient foals and mice, this alternative pathway must not be equivalently active in all species or in different cell types. In fact, there is recent evidence that murine cells have an active DNA-PK-independent end joining pathway not detectable in human cells (62), providing support for the idea that alternative end joining pathways may be more abundantly expressed in certain species than others.

Still, the existence of an alternative pathway does not address the differences in V(D)J recombination defects in Ku vs DNA-PKCS-deficient rodent cells or the differing radiosensitivity of Ku vs DNA-PKCS ES cells. However, if this alternative joining pathway could utilize Ku in targeting DNA ends, this would provide an explanation for the relatively efficient signal joining observed in SCID mice (as opposed to Ku-deficient mice) as well as the radioresistance of DNA-PKCS-deficient ES cells (as opposed to Ku-deficient ES cells). Thus, in murine SCID cells that have an active DNA-PK-independent end joining pathway and adequate levels of Ku, but not DNA-PKCS, Ku can direct the alternative end joining pathway to V(D)J intermediates, explaining relatively normal signal joining in these cells. Similarly, the possibility that Ku directs this putative alternative pathway to damaged DNA would also explain the different radiosensitivities of Ku- and DNA-PKCS-deficient ES cells. This model could still account for the more severe defect in SCID foals if equine lymphocytes are particularly ineffective in this alternative pathway; in this case, even in the presence of Ku, both signal and coding joints are markedly reduced.

As discussed above, the two major pathways for repairing DSBs in eukaryotic cells are HR and NHEJ, although there is considerable evidence for other less well-defined mechanisms. An attractive candidate for an alternative pathway that could facilitate the repair of V(D)J recombination intermediates in the absence of DNA-PKCS is single-strand annealing. This pathway depends on regions of sequence homology between the two DNA ends and resection of the DNA ends so that annealing of complementary regions can occur. In yeast, this pathway requires several components of the RAD52 homologous recombination pathway (RAD52, MRE11, RAD50, and XRS2). There is experimental evidence supporting the idea that a mechanism related to single-strand annealing might resolve V(D)J recombination intermediates in certain situations. First, it is well appreciated that certain coding joints utilize short regions of sequence homology to facilitate joining (63, 64, 65), and in the absence of either Ku or XRCC4, the dependence on short sequence homology for efficient joining is accentuated (11, 51). Furthermore, there is precedent for overlapping roles of the nonhomologous DNA end joining factors in other pathways. Yeast that are defective in nonhomologous DNA end joining are not radiosensitive; the importance of this pathway for rejoining radiation-induced DNA breaks is only observed in yeast that are also defective in homologous end joining (66). Direct genetic evidence exists for overlapping roles for factors from these pathways in that the MRE11/RAD50/XRS2 complex is necessary for HR, NHEJ, and repair via single-strand annealing (67, 68). Direct biochemical evidence exists suggesting that Ku may function in other DNA repair pathways, in that Ku has been shown to stimulate DNA ligase activities for all human DNA ligases (69).

In yeast, RAD52 is essential for both homologous recombination and single-strand annealing (68). Mice with a targeted deletion of the murine RAD52 homologue have recently been generated (70). Although homologous recombination is impaired in cells from these animals, the cells are not hypersensitive to agents that induce DSBs, and the animals show no defects in the immune system. The fact that targeted deletion of RAD52 is not terribly detrimental to the mouse perhaps underscores the fact that NHEJ (as opposed to HR) is the major mechanism for repairing DSBs in higher eukaryotes (70). New insight regarding the function of RAD52 in higher eukaryotes has been gained, in that it has recently been demonstrated that RAD52, like Ku, can bind DNA ends in a sequence-independent manner (71). This finding led to the hypothesis that RAD52 may direct other factors involved either in single-strand annealing or homologous recombination to damaged DNA much in the same way that Ku has been proposed to direct components of the NHEJ pathway to damaged DNA (71).

We reasoned that if single-strand annealing contributes to signal end joining in murine lymphocytes in the absence of DNA-PKCS, signal joining would be more significantly impaired in lymphocytes lacking both DNA-PKCS and RAD52. Thus, we examined Ig DHJH rearrangements in mice deficient in both RAD52 and DNA-PKCS (Fig. 5Go). As can be seen, the level of DHJH coding joints in SCID/RAD52-/- animals is depressed ~50- to 100-fold as compared with RAD52-/- controls. This level of coding joint diminution is exactly what is observed when comparing DHJH coding joints in DNA-PKCS-deficient vs normal mice (41). In SCID/RAD52-/-, the level of signal joints is diminished by ~5- to 10-fold as compared with RAD52-/- animals. Again, this level of diminution is completely analogous to that observed when comparing DHJH signal joints in DNA-PKCS-deficient vs normal mice. In sum, SCID/RAD52-/- animals appear to be indistinguishable from SCID animals with respect to both coding and signal joint formation, and we conclude that RAD52 does not participate in resolving V(D)J recombination intermediates in the absence of DNA-PKCS. This obviously does not rule out the possibility that Ku directs some other component of this pathway (or others) to unresolved V(D)J recombination intermediates, or that another RAD52 homologue exists (as suggested previously (72)) that may play a more prominent role in DSBR in higher eukaryotes. Finally, this experiment underscores the less severe diminution in signal end resolution in SCID mice as compared with SCID foals and the substantial leakiness in coding end resolution in SCID mice that is not observed in SCID foals (compare Figs. 2Go and 5Go).

Conclusion

In sum, these experiments establish that unlike DNA-PKCS deficiency in mice, the lack of DNA-PKC in foals results in a profound defect in signal end resolution during V(D)J recombination. This difference cannot be explained by the specific mutation in SCID foals leading to a mutant protein that inhibits signal end resolution. Instead, these data suggest that different species vary in their absolute requirements for DNA-PKCS during V(D)J recombination. These data are consistent with the hypothesis that in the absence of DNA-PKCS, an undefined end joining pathway joins the nonhomologous DNA ends generated during V(D)J recombination. The observed differences in the absolute requirement for DNA-PKCS during V(D)J recombination may reflect the relative abundance of this alternative end joining pathway.


    Acknowledgments
 
We thank Dr. Charles Hasemann, Dr. David Roth, and Gail Streater for critical review of these data and many stimulating discussions.


    Footnotes
 
1 This work was supported by National Institutes of Health Grant AI32600, the Harold C. Simmons Research Center, the American Heart Association, Texas Affiliate (K.M.), and the Dutch Cancer Foundation (EUR 94-858, to T.R.). Back

2 Address correspondence and reprint requests to Dr. Katheryn Meek, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75235-8884. E-mail address: Back

3 Abbreviations used in this paper: RAG, recombination-activating gene; DNA-PKCS, DNA-dependent protein kinase, catalytic subunit; DSB, double-strand break; DSBR, double-strand break repair; ES, embryonic stem; HR, homologous recombination; NHEJ, nonhomologous end joining; RSS, recombination signal sequence; XRCC, x-ray cross-complementation group. Back

Received for publication September 27, 1999. Accepted for publication November 16, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Lewis, S. M.. 1994. The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses. Adv. Immunol. 56:27.[Medline]
  2. Van Gent, D. C., J. F. McBlane, D. A. Ramsden, M. J. Sadofsky, J. E. Hesse, M. Gellert. 1995. Initiation of V(D)J recombination in a cell-free system. Cell 81:925.[Medline]
  3. McBlane, J. F., D. C. van Gent, D. A. Ramsden, C. Romeo, C. A. Cuomo, M. Gellert, M. A. Oettinger. 1995. Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps. Cell 83:387.[Medline]
  4. Eastman, Q. M., T. M. Leu, D. G. Schatz. 1996. Initiation of V(D)J recombination in vitro obeying the 12/23 rule. Nature 380:85.[Medline]
  5. Lieber, M. R., J. E. Hesse, S. Lewis, G. C. Bosma, N. Rosenberg, K. Mizuuchi, M. J. Bosma, M. Gellert. 1988. The defect in murine severe combined immune deficiency: joining of signal sequences but not coding segments in V(D)J recombination. Cell 55:7.[Medline]
  6. Nussenzweig, A., C. Chen, V. da Costa Soares, M. Sanchez, K. Sokol, M. C. Nussenzweig, G. C. Li. 1996. Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature 382:551.[Medline]
  7. Schwarz, K., G. H. Gauss, L. Ludwig, U. Pannicke, Z. Li, D. Lindner, W. Friedrich, R. A. Seger, T. E. Hansen-Hagge, S. Desiderio, et al 1996. RAG mutations in human B cell-negative SCID. Science 274:97.[Abstract/Free Full Text]
  8. Shinkai, Y., G. Rathbun, K. P. Lam, E. M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. M. Stall, et al 1992. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68:855.[Medline]
  9. Wiler, R., R. Leber, B. B. Moore, L. F. VanDyk, L. E. Perryman, K. Meek. 1995. Equine severe combined immunodeficiency: a defect in V(D)J recombination and DNA-dependent protein kinase activity. Proc. Natl. Acad. Sci. USA 92:11485.[Abstract/Free Full Text]
  10. Zhu, C., M. A. Bogue, D. S. Lim, P. Hasty, D. B. Roth. 1996. Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates. Cell 86:379.[Medline]
  11. Li, Z., T. Otevrel, Y. Gao, H. L. Cheng, B. Seed, T. D. Stamato, G. E. Taccioli, F. W. Alt. 1995. The XRCC4 gene encodes a novel protein involved in DNA double-strand break repair and V(D)J recombination. Cell 83:1079.[Medline]
  12. Bosma, G. C., R. P. Custer, M. J. Bosma. 1983. A severe combined immunodeficiency mutation in the mouse. Nature 301:527.[Medline]
  13. Fulop, G. M., R. A. Phillips. 1990. The scid mutation in mice causes a general defect in DNA repair. Nature 347:479.[Medline]
  14. Biedermann, K. A., J. R. Sun, A. J. Giaccia, L. M. Tosto, J. M. Brown. 1991. Scid mutation in mice confers hypersensitivity to ionizing radiation and a deficiency in DNA double-strand break repair. Proc. Natl. Acad. Sci. USA 88:1394.[Abstract/Free Full Text]
  15. Kanaar, R., J. H. Hoeijmakers, D. C. van Gent. 1998. Molecular mechanisms of DNA double strand break repair. Trends Cell Biol. 8:483.[Medline]
  16. Blunt, T., N. J. Finnie, G. E. Taccioli, G. C. Smith, J. Demengeot, T. M. Gottlieb, R. Mizuta, A. J. Varghese, F. W. Alt, P. A. Jeggo, et al 1995. Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80:813.[Medline]
  17. Boubnov, N. V., K. T. Hall, Z. Wills, S. E. Lee, D. M. He, D. M. Benjamin, C. R. Pulaski, H. Band, W. Reeves, E. A. Hendrickson, et al 1995. Complementation of the ionizing radiation sensitivity, DNA end binding, and V(D)J recombination defects of double-strand break repair mutants by the p86 Ku autoantigen. Proc. Natl. Acad. Sci. USA 92:890.[Abstract/Free Full Text]
  18. Errami, A., V. Smider, W. K. Rathmell, D. M. He, E. A. Hendrickson, M. Z. Zdzienicka, G. Chu. 1996. Ku86 defines the genetic defect and restores x-ray resistance and V(D)J recombination to complementation group 5 hamster cell mutants. Mol. Cell. Biol. 16:1519.[Abstract]
  19. Getts, R. C., T. D. Stamato. 1994. Absence of a Ku-like DNA end binding activity in the xrs double-strand DNA repair-deficient mutant. J. Biol. Chem. 269:15981.[Abstract/Free Full Text]
  20. Gu, Y., S. Jin, Y. Gao, D. T. Weaver, F. W. Alt. 1997. Ku70-deficient embryonic stem cells have increased ionizing radiosensitivity, defective DNA end-binding activity, and inability to support V(D)J recombination. Proc. Natl. Acad. Sci. USA 94:8076.[Abstract/Free Full Text]
  21. Gu, Y. S., K. J. Seidl, G. A. Rathbun, C. M. Zhu, J. P. Manis, N. Vanderstoep, L. Davidson, H. L. Cheng, J. M. Sekiguchi, K. Frank, et al 1997. Growth retardation and leaky SCID phenotype of KU70-deficient mice. Immunity 7:653.[Medline]
  22. He, D. M., S. E. Lee, E. A. Hendrickson. 1996. Restoration of x-ray and etoposide resistance, Ku-end binding activity and V(D)J recombination to the Chinese hamster sxi-3 mutant by a hamster Ku86 cDNA. Mutat. Res. 363:43.[Medline]
  23. Kirchgessner, C. U., C. K. Patil, J. W. Evans, C. A. Cuomo, L. M. Fried, T. Carter, M. A. Oettinger, J. M. Brown. 1995. DNA-dependent kinase (p350) as a candidate gene for the murine SCID defect. Science 267:1178.[Abstract/Free Full Text]
  24. Pergola, F., M. Z. Zdzienicka, M. R. Lieber. 1993. V(D)J recombination in mammalian cell mutants defective in DNA double-strand break repair. Mol. Cell. Biol. 13:3464.[Abstract/Free Full Text]
  25. Peterson, S. R., A. Kurimasa, M. Oshimura, W. S. Dynan, E. M. Bradbury, D. J. Chen. 1995. Loss of the catalytic subunit of the DNA-dependent protein kinase in DNA double-strand-break-repair mutant mammalian cells. Proc. Natl. Acad. Sci. USA 92:3171.[Abstract/Free Full Text]
  26. Shin, E. K., L. E. Perryman, K. Meek. 1997. A kinase-negative mutation of DNA-PK(CS) in equine SCID results in defective coding and signal joint formation. J. Immunol. 158:3565.[Abstract]
  27. Sipley, J. D., J. C. Menninger, K. O. Hartley, D. C. Ward, S. P. Jackson, C. W. Anderson. 1995. Gene for the catalytic subunit of the human DNA-activated protein kinase maps to the site of the XRCC7 gene on chromosome 8. Proc. Natl. Acad. Sci. USA 92:7515.[Abstract/Free Full Text]
  28. Taccioli, G. E., G. Rathbun, E. Oltz, T. Stamato, P. A. Jeggo, F. W. Alt. 1993. Impairment of V(D)J recombination in double-strand break repair mutants. Science 260:207.[Abstract/Free Full Text]
  29. Taccioli, G. E., T. M. Gottlieb, T. Blunt, A. Priestley, J. Demengeot, R. Mizuta, A. R. Lehmann, F. W. Alt, S. P. Jackson, P. A. Jeggo. 1994. Ku80: product of the XRCC5 gene and its role in DNA repair and V(D)J recombination. Science 265:1442.[Abstract/Free Full Text]
  30. Grawunder, U., D. Zimmer, S. Fugmann, K. Schwarz, M. R. Lieber. 1998. DNA ligase IV is essential for V(D)J recombination and DNA double-strand break repair in human precursor lymphocytes. Mol. Cell 2:477.[Medline]
  31. Barnes, D. E., G. Stamp, I. Rosewell, A. Denzel, T. Lindahl. 1998. Targeted disruption of the gene encoding DNA ligase IV leads to lethality in embryonic mice. Curr. Biol. 8:1395.[Medline]
  32. Frank, K. M., J. M. Sekiguchi, K. J. Seidl, W. Swat, G. A. Rathbun, H. L. Cheng, L. Davidson, L. Kangaloo, F. W. Alt. 1998. Late embryonic lethality and impaired V(D)J recombination in mice lacking DNA ligase IV. Nature 396:173.[Medline]
  33. Anderson, C. W., S. P. Lees-Miller. 1992. The nuclear serine/threonine protein kinase DNA-PK. Crit. Rev. Eukaryotic Gene Expression 2:283.[Medline]
  34. Anderson, C. W., T. H. Carter. 1996. The DNA-activated protein kinase: DNA-PK. Curr. Top. Microbiol. Immunol. 217:91.[Medline]
  35. Gottlieb, T. M., S. P. Jackson. 1993. The DNA-dependent protein kinase: requirement for DNA ends and association with Ku antigen. Cell 72:131.[Medline]
  36. Rathmell, W. K., G. Chu. 1994. A DNA end-binding factor involved in double-strand break repair and V(D)J recombination. Mol. Cell. Biol. 14:4741.[Abstract/Free Full Text]
  37. Suwa, A., M. Hirakata, Y. Takeda, S. A. Jesch, T. Mimori, J. A. Hardin. 1994. DNA-dependent protein kinase (Ku protein-p350 complex) assembles on double-stranded DNA. Proc. Natl. Acad. Sci. USA 91:6904.[Abstract/Free Full Text]
  38. Lewis, S., A. Gifford, D. Baltimore. 1985. DNA elements are asymmetrically joined during the site-specific recombination of {kappa} immunoglobulin genes. Science 228:677.[Abstract/Free Full Text]
  39. Gao, Y. J., J. Chaudhuri, C. M. Zhu, L. Davidson, D. T. Weaver, F. W. Alt. 1998. A targeted DNA-PKCS-null mutation reveals DNA-PK-independent functions for KU in V(D)J recombination. Immunity 9:367.[Medline]
  40. Taccioli, G. E., A. G. Amatucci, H. J. Beamish, D. Gell, X. H. Xiang, M. I. T. Arzayus, A. Priestley, S. P. Jackson, A. M. Rothstein, P. A. Jeggo, V. L. M. Herrera. 1998. Targeted disruption of the catalytic subunit of the DNA-PK gene in mice confers severe combined immunodeficiency and radiosensitivity. Immunity 9:355.[Medline]
  41. Bogue, M. A., C. Jhappan, D. B. Roth. 1998. Analysis of variable (diversity) joining recombination in DNA dependent protein kinase (DNA-PK)-deficient mice reveals DNA-PK-independent pathways for both signal and coding joint formation. Proc. Natl. Acad. Sci. USA 95:15559.[Abstract/Free Full Text]
  42. Kurimasa, A., L. J. H. Ouyang, S. Dong, X. L. Wang, C. Li, D. J. Cordon-Cardo, D. J. Chen, G. C. Li. 1999. Catalytic subunit of DNA-dependent protein kinase: impact on lymphocyte development and tumorigenesis. Proc. Natl. Acad. Sci. USA 96:1403.[Abstract/Free Full Text]
  43. Fukumura, R., R. Araki, A. Fujimori, M. Mori, T. Saito, F. Watanabe, M. Sarashi, H. Itsukaichi, K. Eguchikasai, K. Sato, et al 1998. Murine cell line SX9 bearing a mutation in the DNA-PKCS gene exhibits aberrant V(D)J recombination not only in the coding joint but also in the signal joint. J. Biol. Chem. 273:13058.[Abstract/Free Full Text]
  44. Errami, A., D. M. He, A. A. Friedl, W. J. I. Overkamp, B. Morolli, E. A. Hendrickson, F. Eckardtschupp, M. Oshimura, P. H. M. Lohman, S. P. Jackson, M. Z. Zdzienicka. 1998. XR-C1, a new CHO cell mutant which is defective in DNA-PKCS, is impaired in both V(D)J coding and signal joint formation. Nucleic Acids Res. 26:3146.[Abstract/Free Full Text]
  45. Kulesza, P., M. R. Lieber. 1998. DNA-PK is essential only for coding joint formation in V(D)J recombination. Nucleic Acids Res. 26:3944.[Abstract/Free Full Text]
  46. Blunt, T., D. Gell, M. Fox, G. E. Taccioli, A. R. Lehmann, S. P. Jackson, P. A. Jeggo. 1996. Identification of a nonsense mutation in the carboxyl-terminal region of DNA-dependent protein kinase catalytic subunit in the scid mouse. Proc. Natl. Acad. Sci. USA 93:10285.[Abstract/Free Full Text]
  47. Danska, J. S., D. P. Holland, S. Mariathasan, K. M. Williams, C. J. Guidos. 1996. Biochemical and genetic defects in the DNA-dependent protein kinase in murine scid lymphocytes. Mol. Cell. Biol. 16:5507.[Abstract]
  48. Leber, R., R. Wiler, L. E. Perryman, K. Meek. 1998. Equine SCID: mechanistic analysis and comparison with murine SCID. Vet. Immunol. Immunopathol. 65:1.[Medline]
  49. Hesse, J. E., M. R. Lieber, M. Gellert, K. Mizuuchi. 1987. Extrachromosomal DNA substrates in pre-B cells undergo inversion or deletion at immunoglobulin V-(D)-J joining signals. Cell 49:775.[Medline]
  50. Schrenzel, M. D., J. L. Watson, D. A. Ferrick. 1994. Characterization of horse (Equus caballus) T-cell receptor ß chain genes. Immunogenetics 40:135.[Medline]
  51. Bogue, M. A., C. Wang, C. Zhu, D. B. Roth. 1997. V(D)J recombination in Ku86-deficient mice: distinct effects on coding, signal, and hybrid joint formation. Immunity 7:37.[Medline]
  52. Lewis, S. M., J. E. Hesse, K. Mizuuchi, M. Gellert. 1988. Novel strand exchanges in V(D)J recombination. Cell 55:1099.[Medline]
  53. VanDyk, L. F., T. W. Wise, B. B. Moore, K. Meek. 1996. Immunoglobulin DH recombination signal sequence targeting: effect of DH coding and flanking regions and recombination partner. J. Immunol. 157:4005.[Abstract]
  54. Sollbach, A. E., G. E. Wu. 1995. Inversions produced during V(D)J rearrangement at IgH, the immunoglobulin heavy-chain locus. Mol. Cell. Biol. 15:671.[Abstract]
  55. Han, J. O., S. B. Steen, D. B. Roth. 1997. Ku86 is not required for protection of signal ends or for formation of nonstandard V(D)J recombination products. Mol. Cell. Biol. 17:2226.[Abstract]
  56. Han, J. O., L. A. Erskine, M. M. Purugganan, T. D. Stamato, D. B. Roth. 1998. V(D)J recombination intermediates and non-standard products in XRCC4-deficient cells. Nucleic Acids Res. 26:3769.[Abstract/Free Full Text]
  57. Melek, M., M. Gellert, D. C. van Gent. 1998. Rejoining of DNA by the RAG1 and RAG2 proteins. Science 280:301.[Abstract/Free Full Text]
  58. Ouyang, H., A. Nussenzweig, A. Kurimasa, V. D. Soares, X. L. Li, C. Cordoncardo, W. H. Li, N. Cheong, M. Nussenzweig, G. Iliakis, D. J. Chen, G. C. Li. 1997. KU70 is required for DNA repair but not for T cell antigen receptor gene recombination in vivo. J. Exp. Med. 186:921.[Abstract/Free Full Text]
  59. McGuire, T. C., M. J. Poppie. 1973. Hypogammaglobulinemia and thymic hypoplasia in horses: a primary combined immunodeficiency disorder. Infect. Immun. 8:272.[Abstract/Free Full Text]
  60. Kurimasa, A., S. Kumano, N. V. Boubnov, M. D. Story, C. S. Tung, S. R. Peterson, D. J. Chen. 1999. Requirement for the kinase activity of human DNA-dependent protein kinase catalytic subunit in DNA strand break rejoining. Mol. Cell. Biol. 19:3877.[Abstract/Free Full Text]
  61. Agrawal, A., D. G. Schatz. 1997. RAG1 and RAG2 form a stable postcleavage synaptic complex with DNA containing signal ends in V(D)J recombination. Cell 89:43.[Medline]
  62. Baumann, P., S. C. West. 1998. DNA end-joining catalyzed by human cell-free extracts. Proc. Natl. Acad. Sci. USA 95:14066.[Abstract/Free Full Text]
  63. Gu, H., I. Forster, K. Rajewsky. 1990. Sequence homologies, N sequence insertion and JH gene utilization in VHDJH joining: implications for the joining mechanism and the ontogenetic timing of Ly1 B cell and B-CLL progenitor generation. EMBO J. 9:2133.[Medline]
  64. Meek, K.. 1990. Analysis of junctional diversity during B lymphocyte development. Science 250:820.[Abstract/Free Full Text]
  65. Chukwuocha, R. U., B. Nadel, A. J. Feeney. 1995. Analysis of homology-directed recombination in VDJ junctions from cytoplasmic Ig- pre-B cells of newborn mice. J. Immunol. 154:1246.[Abstract]
  66. Siede, W., A. A. Friedl, I. Dianova, F. Eckardt-Schupp, E. C. Friedberg. 1996. The Saccharomyces cerevisiae Ku autoantigen homologue affects radiosensitivity only in the absence of homologous recombination. Genetics 142:91.[Abstract]
  67. Haber, J. E.. 1998. The many interfaces of Mre11. Cell 95:583.[Medline]
  68. Ivanov, E. L., N. Sugawara, J. Fishman-Lobell, J. E. Haber. 1996. Genetic requirements for the single-strand annealing pathway of double-strand break repair in Saccharomyces cerevisiae. Genetics 142:693.[Abstract]
  69. Ramsden, D. A., M. Gellert. 1998. Ku protein stimulates DNA end joining by mammalian DNA ligases: a direct role for Ku in repair of DNA double-strand breaks. EMBO J. 17:609.[Medline]
  70. Rijkers, T., J. Van Den Ouweland, B. Morolli, A. G. Rolink, W. M. Baarends, P. P. Van Sloun, P. H. Lohman, A. Pastink. 1998. Targeted inactivation of mouse RAD52 reduces homologous recombination but not resistance to ionizing radiation. Mol. Cell. Biol. 18:6423.[Abstract/Free Full Text]
  71. Van Dyck, E., A. Z. Stasiak, A. Stasiak, S. C. West. 1999. Binding of double-strand breaks in DNA by human Rad52 protein. Nature 398:728.[Medline]
  72. Haber, J. E.. 1999. DNA repair: gatekeepers of recombination. Nature 398:665.[Medline]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
P. Douglas, X. Cui, W. D. Block, Y. Yu, S. Gupta, Q. Ding, R. Ye, N. Morrice, S. P. Lees-Miller, and K. Meek
The DNA-Dependent Protein Kinase Catalytic Subunit Is Phosphorylated In Vivo on Threonine 3950, a Highly Conserved Amino Acid in the Protein Kinase Domain
Mol. Cell. Biol., March 1, 2007; 27(5): 1581 - 1591.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
X. Cui, Y. Yu, S. Gupta, Y.-M. Cho, S. P. Lees-Miller, and K. Meek
Autophosphorylation of DNA-Dependent Protein Kinase Regulates DNA End Processing and May Also Alter Double-Strand Break Repair Pathway Choice
Mol. Cell. Biol., December 15, 2005; 25(24): 10842 - 10852.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Gupta and K. Meek
The leucine rich region of DNA-PKcs contributes to its innate DNA affinity
Nucleic Acids Res., December 9, 2005; 33(22): 6972 - 6981.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Convery, E. K. Shin, Q. Ding, W. Wang, P. Douglas, L. S. Davis, J. A. Nickoloff, S. P. Lees-Miller, and K. Meek
Inhibition of homologous recombination by variants of the catalytic subunit of the DNA-dependent protein kinase (DNA-PKcs)
PNAS, February 1, 2005; 102(5): 1345 - 1350.
[Abstract] [Full Text] [PDF]


Home page
Vet PatholHome page
L. E. Perryman
Molecular Pathology of Severe Combined Immunodeficiency in Mice, Horses, and Dogs
Vet. Pathol., March 1, 2004; 41(2): 95 - 100.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Q. Ding, Y. V. R. Reddy, W. Wang, T. Woods, P. Douglas, D. A. Ramsden, S. P. Lees-Miller, and K. Meek
Autophosphorylation of the Catalytic Subunit of the DNA-Dependent Protein Kinase Is Required for Efficient End Processing during DNA Double-Strand Break Repair
Mol. Cell. Biol., August 15, 2003; 23(16): 5836 - 5848.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Woods, W. Wang, E. Convery, A. Errami, M. Z. Zdzienicka, and K. Meek
A single amino acid substitution in DNA-PKcs explains the novel phenotype of the CHO mutant, XR-C2
Nucleic Acids Res., December 1, 2002; 30(23): 5120 - 5128.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Meek, L. Kienker, C. Dallas, W. Wang, M. J. Dark, P. J. Venta, M. L. Huie, R. Hirschhorn, and T. Bell
SCID in Jack Russell Terriers: A New Animal Model of DNA-PKcs Deficiency
J. Immunol., August 15, 2001; 167(4): 2142 - 2150.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
L. J. Kienker, E. K. Shin, and K. Meek
Both V(D)J recombination and radioresistance require DNA-PK kinase activity, though minimal levels suffice for V(D)J recombination
Nucleic Acids Res., July 15, 2000; 28(14): 2752 - 2761.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shin, E. K.
Right arrow Articles by Meek, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shin, E. K.
Right arrow Articles by Meek, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS