|
|
||||||||


*
Harold C. Simmons Arthritis Research Center, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, TX 75235; and
Department of Radiation Genetics and Chemical Mutagenesis, MGC, Leiden University Medical Center, Leiden, The Netherlands
| Abstract |
|---|
|
|
|---|
4 logs in equine SCID thymocytes as compared with normal horse
thymocytes. A potential explanation for the differences between SCID
mice and foals is that the mutant DNA-PKCS allele in SCID
foals inhibits signal end resolution. We tested this hypothesis using
DNA-PKCS expression vectors; in sum, we find no evidence of
a dominant-negative effect by the mutant protein. These and other
recent data are consistent with an emerging consensus: that in normal
cells, DNA-PKCS participates in both coding and signal end
resolution, but in the absence of DNA-PKCS an undefined end
joining pathway (which is variably expressed in different species and
cell types) can facilitate imperfect signal and coding end
joining. | Introduction |
|---|
|
|
|---|
In eukaryotes, two major mechanisms exist for the repair of double-strand DNA breaks (DSBs): 1) homologous recombination (HR), in which repair of the damaged DNA is directed by gene conversion; and 2) nonhomologous end joining (NHEJ), an error prone end to end joining pathway (reviewed in Ref. 15). In yeast, DSBs are generally repaired via HR, whereas NHEJ plays a very minor role. Higher eukaryotes are exactly opposite, depending heavily on NHEJ to repair DSBs, while HR plays a less significant role. At least five DNA repair factors are required for V(D)J recombination: XRCC4, Ku70 (XRCC5), Ku 86 (XRCC6), DNA-PKCS (XRCC7), and DNA ligase IV (6, 10, 11, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32); three of these are components of the DNA-dependent protein kinase (the Ku heterodimer), and DNA-PKCS (33, 34, 35, 36, 37).
The RAG endonuclease is targeted specifically to immune receptor gene segments by simple DNA sequence elements (recombination signal sequences, RSS) adjacent to V, D, and J gene segments, and involves two dsDNA cuts and subsequent religations (mediated by the NHEJ pathway). This results in the formation of two new DNA joints, coding joints that are generally modified by nucleotide additions and/or deletions and signal joints that contain the two RSS and are largely unmodified (38). It was initially recognized that the defect in C.B-17 SCID mice affected only coding joint resolution, leaving signal joint formation relatively intact (5), although more recent data demonstrate a modest defect in both the rate and fidelity of signal end resolution (39, 40, 41, 42). In 1994, the defect in SCID mice was first shown to be in DNA-PKCS (16).
In 1995, we demonstrated that the defective mechanism in SCID foals is V(D)J recombination (9); as with C.B-17 SCID mice, the mutant factor in SCID foals is DNA-PKCS (26). However, our analyses suggested that in SCID foals, both coding and signal end resolution are profoundly diminished. In fact, subsequent reports, in which two additional rodent cell lines with DNA-PKCS mutations were characterized, also support a role for DNA-PKCS in signal end joining (43, 44), although analyses of a human cell line with defective DNA-PKCS expression suggest that DNA-PKCS is not required for signal joining (45). The murine SCID mutation results in the deletion of only 83 amino acids from the C terminus of DNA-PKCS (46, 47), whereas substantially more of the protein (967 amino acids) is deleted by the equine SCID mutation (26). Thus, we hypothesized that some residual DNA-PKCS activity in SCID mice (possibly independent of kinase activity) might explain the observed difference in signal ligation. Recent reports demonstrating that mice with targeted deletions of DNA-PKCS also have relatively normal signal end resolution negate this hypothesis (39, 40, 41, 42). In sum, in recent years, no less than eight reports with considerably diverse conclusions have focused attention on the role of DNA-PKCS in signal end resolution. An emerging consensus is that (at least in rodents), in the absence of DNA-PKCS, there is a modest deficiency in both the rate and fidelity of signal end joining coupled with a much more substantial diminution of coding end resolution.
Our initial studies of endogenous Ig light chain rearrangements from
SCID foals revealed two differences from SCID mice: 1) undetectable
V
-J
signal joints in
equine lymphocytes as compared with murine lymphocytes; and 2) a lack
of leakiness when analyzing light chain coding joints from SCID foals
as compared with SCID mice (9, 48). Since in our initial
studies only Ig light chain rearrangements were analyzed (because of
limited available sequence information of horse immune receptor genes),
it might be argued that the lack of observed signal joints might
actually reflect tighter temporal control of Ig gene rearrangement in
equine vs murine lymphocytes. The requirement for successful heavy
chain rearrangement before the initiation of light chain rearrangement
might be more tightly enforced in equine lymphocytes than in murine
lymphocytes. Thus, one possible explanation for the lack of
V
-J
signal joints in
SCID foals is that light chain rearrangement is not initiated. Although
our conclusion (that signal end joining is impaired in SCID foals) was
supported by analyses of rearrangements of extrachromosomal substrates
in cell lines derived from SCID foals, these experiments were limited
by the fact that these plasmid substrates do not replicate in equine
cell lines, making quantitation difficult (9).
In this study, we establish that the capacity for both signal and
coding end joining at a recombinationally active
TCRB locus in equine SCID lymphocytes is
4
logs lower than in normal lymphocytes. Additionally, we present data
suggesting that the observed differences in end resolution are not
because of the specific nature of the mutant
DNA-PKCS allele in SCID foals, but more likely
reflect differences between species in the ability to bypass the
requirement for DNA-PKCS during certain types of
end joining.
| Materials and Methods |
|---|
|
|
|---|
DNA was prepared from thymus collected from a 20-day-old SCID
foal and from a normal foal
2 mo old using commercially available
DNA extraction buffer (Applied Biosystems, Foster City, CA). Similarly,
DNA was isolated from the spleen of both SCID and normal animals.
Oligonucleotides
Sequences of oligonucleotides used in this study are as follows: 5'-DB, CCAACCTCTGCCACCTGTGCT; 5'-DB inner, CTGCCGCTGCCCAGTGGT; 3'-DB, CCATCCCAGAGCAGATTCCCG; 3'-DB inner, GCTGTGCGGGGTGTTTTC; 5'-JB, TGTCCAGATTACCATGTCCAG; 5'-JB inner, CTAATTCTGGAAATGGGAAG; 3'-JB, TAGCACAGTGAGCCGAGTCCC; 3'-JB inner, TGGCCCGAAGAACAGCTC; 5'-DB RSS, CCCCCAGTCCCCACAATGTTA; 3'-DB RSS, AAGCACCTCCTTTACCTG; 5'-VB, TTCTGGGCTTGGTGTTCTCGTCTCT; 5'-VB inner, GGTCAAATTTCCCATCAG; 5'-VB inner-2, AACATTTTCAACTCTGACAGTGA; 5'-DFL16.1, ACCAGAGACCATACTGGCCAGGGC; 3'-DFL16.1, CTCAAGAGTCTGCTGGGCACAATG; 5'-JH1, GGTGCCTTAAGGCAGGATATGGAGAGAGTT; 3'-JH1, GTTCTAGAATGGAATGTGCAGAAAGAAAAA.
Polymerase chain reactions
PCR reactions were conducted using the indicated amounts of DNA
in 100 µl reactions. For the experiment depicted in Fig. 1
, 40 cycles
of amplification were performed using Elongase (Life Technologies,
Gaithersburg, MD) and the following conditions:
94oC for 30 s, 59oC
for 1.5 min, 68oC for 8 min. For the nested PCR
experiments depicted in Figs. 2
, BD, and 3,
AC, Taq polymerase was utilized; initial
amplification conditions were: 94oC for 1.5 min,
61oC for 2 min, and 72oC
for 3 min for 40 cycles. A total of 10 µl of each reaction was
subsequently amplified as follows: 94o C for 1.5
min, 52oC for 2 min, and
72oC for 3 min for 40 cycles. In Fig. 2
A, amplification conditions were the same, but only 40
cycles were performed. For the experiment depicted in Fig. 5
, Taq polymerase was utilized; 40 cycles of amplification were
performed as follows: 94oC for 1.5 min,
58oC for 2 min, and 72oC
for 3 min. A total of 20 µl of each PCR reaction was analyzed by
Southern filter hybridization analysis. For sequence analysis,
amplified rearrangements were gel purified and ligated into pCR2.1
(Invitrogen, Carlsbad, CA) and transformed into competent
Escherichia coli. Recombinant colonies were identified by
hybridization and sequenced on an ABI sequencer (Applied Biosystems,
Foster City, CA).
|
|
|
The 0176 and 1821 cell lines were established from dermal biopsies from a normal horse (0176) and a SCID foal (1821) and were the generous gift of Dr. Lance Perryman (North Carolina State University, Raleigh, NC). The SF19 fibroblast cell line was established from a C.B-17 SCID mouse and was the generous gift of Dr. Mel Bosma (Fox Chase Cancer Center, Philadelphia, PA). The 100E cell line (a murine SCID fibroblast cell line that harbors a fragment of human chromosome 8, including the DNA-PKCS gene) was the generous gift of Dr. Cordula Kirchgessner (Stanford University, Stanford, CA) and has been described previously (23).
Immunoblot analysis
The indicated amounts of whole cell extracts were electrophoresed in an SDS/5% polyacrylamide gel and transferred to polyvinylidene difluoride. A mAb (18-2) that recognizes the N-terminal 250 kDa of DNA-PKCS (generous gift of Dr. Tim Carter, St. Johns University, Jamaica, NY) was used as the primary Ab (1:300), and a goat anti-mouse IgG conjugated to HRP was used as the secondary Ab. The membrane was then incubated with an enhanced chemiluminescent substrate (ECL; DuPont, Wilmington, DE), according to the manufacturers recommendations.
Construction of DNA-PKCS expression vectors
The following three fragments spanning the DNA-PKCS coding sequence were assembled from eight shorter RT-PCR fragments isolated from the Ramos human B cell lymphoma cell line: 13,860, 3,5598,173, and 7,91112,358. The fragments were initially cloned into a low copy number plasmid, pGp1f, which has been shown to accept large inserts (generous gift of Dr. Nils Lonberg, GenPharm International, Mountain View, CA). Considerable difficulty was encountered in the initial assembly of the full-length cDNA apparently because of the instability of the cDNA and the toxicity of this sequence to E. coli. These problems were largely eliminated by using a low copy number plasmid and using E. coli deficient in bacterial recombination systems (STBL cells; Life Technologies). NotI sites were engineered by PCR just 5' of the translation initiation site and just 3' of the translation termination site using the following oligonucleotides: 5'-Not, GGACGCGGCCGCATGGCG; 3'-Not, GCGGCCGCAGACCTCACATCCA.
At this point, the sequence of each fragment was confirmed. These three fragments were assembled into a single plasmid by stepwise cloning of the 7,91112,358 fragment into the plasmid-containing fragment 13,860 fragments via SalI sites at 3,482 and 7,933 in the DNA-PKCS coding sequence and an MluI site in the plasmid backbone. Subsequently, the 3,6008,050 fragment was inserted into the SalI site. Cloning sites were resequenced at this step. The full-length NotI cDNA was then subcloned into the pCMV6 expression vector that provides CMV promoter elements as well as transcription termination and polyadenylation sequences from the human growth hormone gene.
To generate the truncation mutant, a PCR fragment spanning nucleotides 80579480 was generated with the following oligonucleotides: 5'-Fse, GGACGAGGTGGATAACAAAGT; 3'-mut, GGGATATCTAAGGGGAATTTGATAAATTGCCTTGTTTGC.
The 3' oligonucleotide incorporates the frameshift at nucleotide 9453 and adds an EcoRV restriction site. The resulting PCR fragment spans a unique FseI site at position 8159. After subcloning into PCR2.1 and sequencing, this PCR fragment was restricted with FseI and EcoRV and then ligated into the full-length DNA-PKCS cDNA that had been restricted with FseI and Eco721 (unique, blunt site at position 11,145). Cloning sites were resequenced in the resulting plasmid.
Extrachromosomal V(D)J recombination assays
Extrachromosomal substrate assays were performed essentially as
described by Hesse et al. (49). Briefly, to assess V(D)J
recombination in SF19 cells, RAG1 and RAG2 expression constructs (6
µg each; generous gift of Dr. Moshe Sadofsky, Medical College of
Georgia, Augusta, GA), DNA-PKCS expression
constructs or vector controls (6 µg each), and recombination
substrates pJH201 or pJH290
(1 µg each; the generous gifts of Martin Gellert and Joanne Hesse,
National Institutes of Health, Bethesda, MD) were transiently
introduced into the SF19 cells via liposome transfection using Fugene
(Roche Molecular Biochemicals, Indianapolis, IN), according to the
manufacturers suggested protocol. Forty-eight hours later, the
plasmid substrates were rescued by preparing alkaline lysates and
restricting with DpnI. A portion of the recovered substrates
was subsequently used to transform competent E. coli (max
efficiency DH5
; Life Technologies). The
transformed bacteria were plated in duplicate onto plates containing
ampicillin alone (100 µg/ml) or both ampicillin and chloramphenicol
(22 µg/ml). In each case, plasmid DNA was prepared from at least 20%
of the putative recombinants to insure authenticity (i.e., to establish
that a recombination event had occurred) and, in the case of
pJH201, to determine the fidelity of signal
joining.
Assessment of radiation sensitivity
Cells (103) were exposed to various amounts of ionizing radiation using a 137Ce source calibrated at 558.8 R/min and immediately seeded in complete medium containing 10% FBS. After 8 days, cell colonies were fixed with 2% formaldehyde, followed by 100% methanol. Subsequently, the colonies were stained with trypan blue, and colony numbers were assessed.
| Results and Discussion |
|---|
|
|
|---|
Like Ig gene rearrangement, TCR rearrangement is temporally
regulated. In the thymus, DB to
JB rearrangement precedes
VB to
DBJB rearrangement, which
precedes rearrangement of the TCR
locus. To
analyze early TCR rearrangements from SCID thymocytes, the intervening
region between TCR DB2 and TCR
JB2.1 was amplified from spleen DNA using
amplification primers derived from published equine
TCRB transcripts (Fig. 1
) (50). As can be seen, a
single hybridizing band of
800 bp is present in amplifications of
SCID spleen DNA (representing the germline configuration of the
DB2 and JB2.1 genes),
whereas two bands (
800 and
160 bp, representing unrearranged and
rearranged, respectively) are apparent in amplifications from normal
spleen DNA. The resulting 800-bp amplification product was sequenced,
and amplification primers were generated to analyze TCR
DB-JB rearrangements.
Analyses of DBJB coding joints
DNA was prepared from the thymus of a 3-wk-old SCID foal and from
the thymus of an
2-mo-old normal foal. Although a thymus sample was
only available from one SCID foal, completely analogous results (as
those presented below) were obtained in experiments using spleen DNA
from one normal animal and three additional SCID foals. The germline
DB2 gene segment (Fig. 2
A) and
JB2.1 gene segment (data not shown) are amplified
equally from both normal and SCID thymus DNA. In our initial analysis,
although both coding and signal joints were readily detectable from as
little as 10 ng of normal thymus DNA,
DBJB rearrangements were
not detected from the SCID thymus DNA (data not shown). Thus, a more
sensitive nested PCR strategy was utilized, as shown in Fig. 2
, BD. As can be seen, using this approach,
DBJB coding joints could
consistently be detected from 0.5 ng normal thymus DNA (and in some
experiments as little as 0.05 ng). In contrast,
DBJB coding joints could
only be detected using 5 µg SCID thymus DNA. Thus, we conclude that
the frequency of DBJB
coding joints in SCID thymus is at least 4 logs lower than in normal
thymus. We also assessed complete
VBDBJB
rearrangements in both normal and SCID thymus DNA using a nested
amplification strategy and VB primers that should
prime only a subset of known equine VB gene
segments. As can be seen in Fig. 2
C,
VBDBJB
rearrangements are readily detectable in as little as 5 ng normal
thymus DNA. Complete
VBDBJB
rearrangements were not consistently detected from SCID thymus; these
rearrangements were detected in two of five experiments and only using
the highest concentration of DNA (5 µg).
To examine the fine structure of the SCID coding joints, amplification
products from several different experiments were cloned and sequenced.
These sequences are presented in Table I
.
Duplicate sequences isolated from the same PCR product were eliminated.
As can be seen, the rare SCID rearrangements are not substantially
different from rearrangements isolated from normal animals. No
excessive P segments were observed, as has been reported in SCID mice.
It has been demonstrated that rare rearrangements from Ku-deficient
mice lack N segments and that SCID mice have a less pronounced
deficiency in N segment addition (51). In these sequences,
there is a modest decrease in both the length of N segments (average
length: 6 bp vs 2.6 bp in rearrangements from normal and SCID thymus,
respectively) and the percentage of N segment-positive rearrangements
isolated from this SCID foal. In the three rearrangements that lack N
segments from SCID thymus, the coding junction occurs at short regions
of sequence homology.
|
The frequency of DBJB
signal joints in both normal and SCID thymus was similarly assessed
(Fig. 2
D). As can be seen, signal joints are readily
detected in as little as 0.5 ng normal thymus DNA, whereas signal
joints can only be detected in 5 µg of SCID thymus DNA. Detection of
signal joints in SCID thymus was inconsistent, being detected in only
two of five experiments. Thus, we conclude that the frequency of
DBJB signal joints in SCID
thymus is
4 logs lower than in normal thymus.
Hybrid joints are less diminished in SCID thymocytes than standard joints
Hybrid joints represent apparent mistakes of the recombinase and are the result of ligation of the coding end of one gene segment to the signal end of a second gene segment (52). The frequency of hybrid joining, as assessed using extrachromosomal substrates, has been estimated at 1030% the rate of standard joining (52). The frequency of hybrid rearrangements of endogenous immune receptor gene segments is considerably lower, 100- to 1000-fold less than standard joining depending on the specific rearrangements analyzed (53, 54). In 1997, Han et al. made the observation that the capacity of Ku80-deficient cell lines to support RAG-induced hybrid joining of an extrachromosomal recombination substrate was similar to that observed in normal cell lines (55). These investigators reported analogous results in studies of cell lines and/or animals deficient in either DNA-PKCS or XRCC4 (41, 51, 56). This led to their hypothesis that hybrid rearrangements might be mediated solely by the RAG proteins. More specifically, they suggested that in a reversal of the normal cleavage reaction, RAG proteins might catalyze a reaction, whereby the 3'-OH from a signal end attacks the phosphodiester of the hairpinned coding end, resulting in hybrid joining. In 1998, Melek et al. (57) substantiated this hypothesis, showing in a cell-free system that the RAG proteins alone could mediate hybrid joining.
Three types of TCRB hybrid rearrangements were
assessed in normal and SCID thymus DNA (Fig. 3
, AC). When amplifying
normal thymus DNA, consistent detection of all three types of hybrid
joints required using 500 ng thymus DNA in each amplification. This is
in good agreement with previous studies demonstrating that hybrid
rearrangements at endogenous loci occur 100- to 1000-fold less
frequently than standard rearrangements (53, 54). Relative
frequencies of the three different hybrid joints varied considerably in
SCID thymocytes. Hybrid joints involving a VB
coding segment and the 5'-DB RSS were
consistently detected (four of four experiments) at roughly equivalent
levels in SCID and normal thymocytes. Several of these rearrangements
were cloned and sequenced from both normal and SCID animals (data not
shown). In each case, the 5'-DB RSS was
completely intact. Because germline VB sequences
are not available, it is impossible to determine the extent of
nucleotide deletion and/or addition at the
VB-DB RSS junction. Still,
the modest extent of junctional diversity observed in these
rearrangements is consistent with RAG-mediated hybrid joining. Hybrid
joints involving the JB coding segment and the
3'-DB RSS could be detected using 5 µg SCID
thymus DNA in one of five experiments; thus, these hybrid joints occur
at least 2 logs less frequently in SCID thymocytes than in normal
thymocytes. Hybrid rearrangements involving the
DB coding segment and the
JB RSS were not detected in SCID thymus.
|
Does the mutant equine DNA-PKCS allele inhibit RS joining?
An attractive hypothesis suggested by Gao et al. (39)
to explain the discrepancies between the equine and murine SCID
phenotypes is that the mutant equine SCID allele might act in a
dominant-negative fashion that interrupts normal Ku function, thus
explaining the lack of signal joints in these cells. There are several
lines of evidence that weaken their argument. First, if the mutant
DNA-PKCS protein inhibits Ku function in equine
SCID cells, one might expect to observe the well-documented growth
abnormalities that are observed in both Ku70- and Ku80-deficient mice
(6, 10, 21, 58) in SCID foals. However, except for their
immunologic disorders, SCID foals are phenotypically indistinguishable
from normal foals (59). Second, in our initial
characterization of the equine SCID defect,
DNA-PKCS was completely undetectable in
immunoblot analysis of extracts from cell lines derived from SCID foals
presumably because the mutant protein is unstable. At that time, we had
no information as to the specific mutation responsible for the
DNA-PKCS deficiency. In the immunoblot analyses,
a mixture of anti-DNA-PKCS Abs was utilized,
two of which specifically recognize epitopes within the C-terminal 150
kDa of DNA-PKCS and not likely present in the
mutated protein in equine SCID cells. Thus, we reexamined
DNA-PKCS expression in cell lines from both
normal and SCID foals using only the Ab that specifically recognizes
the N-terminal 250 kDa of DNA-PKCS (Fig. 4
A). As can be seen using this
Ab, DNA-PKCS is detectable in as little as 12.5
µg whole cell extract from the normal cell line; no unique proteins
of
360 kDa (the predicted size of the mutant
DNA-PKCS protein) are detected in as much as 200
µg of whole cell extract from the SCID cell line. Thus, if a mutant
form of DNA-PKCS is expressed in equine SCID
cells, it appears to be at least 16-fold less abundant than wild-type
DNA-PKCS. These data support our initial
conclusion that the mutant form of DNA-PKCS in
equine SCID cells is unstable.
|
We next assessed both coding and signal joint formation in murine SCID
fibroblasts using a transient recombination assay. Three independent
transfections are shown; data are presented as number of
recombinants/µg substrate transfected. As can be seen, full-length
DNA-PKCS substantially reverses the defect in
coding joint formation in these murine SCID fibroblasts (Table II
). In contrast, coding joint formation
was not detected in either control transfectants (including pCMV6 and
the RAG expression vectors) or transfections including the expression
vector encoding the mutant protein. As expected, the murine SCID
fibroblasts are capable of supporting reasonable levels of signal end
joining, as assessed with the pJH201 substrate.
In this cell line, the fidelity of signal joining is relatively high in
the absence of functional DNA-PKCS (85%). The
modest improvement in signal fidelity when full-length
DNA-PKCS expression vector is cotransfected
(95%) is not statistically significant. As can be seen, cotransfection
of the expression vector encoding DNA-PKCS, which
is truncated at amino acid 3160, had no effect on the rate or fidelity
of signal end resolution in murine SCID cells. In sum, we find no
evidence of a dominant-negative effect by
DNA-PKCS truncated at amino acid 3160. These data
suggest that the differences in signal end resolution in SCID mice as
compared with SCID foals represent actual differences in the absolute
requirement for DNA-PKCS during V(D)J
recombination.
|
There are several discrepancies between the phenotypes of animals (or cell lines) deficient in the different components of the nonhomologous DNA end joining pathway. As discussed above, animals and cell lines vary in their requirements for DNA-PKCS for both coding and signal joint formation. In contrast, deficiencies in either subunit of Ku, XRCC4, or DNA ligase IV result in both defective signal and coding resolution in similar experimental systems. There are also discrepancies in radiosensitivity of certain cell types, specifically ES cells. Although Ku- and XRCC4-deficient ES cells display extreme radiosensitivity, DNA-PKCS-deficient ES cells have similar radioresistance as normal ES cells.
Several different models have been suggested to explain these apparent discrepancies. First, it has been proposed that DNA-PKCS is not involved in signal joining. The data presented in this study demonstrate that DNA-PKCS is involved in signal end joining, at least in certain species.
A second model that has been proposed is that Ku is required to disassemble the RAG postcleavage complex; without Ku, the RAG proteins remain bound to coding and signal ends, thus explaining why Ku-deficient mice have a more severe defect in V(D)J recombination than DNA-PKCS-deficient mice (10). Although there is considerable evidence suggesting that Ku may be involved in remodeling the recombination complex (10, 61), this still would not account for the lack of signal resolution and more severe coding joint defect observed in SCID foals. Also, this model does not address the discrepancies in radiosensitivity between Ku and DNA-PKCS ES cells.
An attractive theory proposed by several investigators is that additional DNA end joining pathways may function to repair signal ends and some coding ends in DNA-PKCS-deficient mice or in DNA-PKCS-deficient ES cells (39, 41, 45). Bogue et al. have suggested that in normal animals, DNA-PKCS is involved in both coding and signal end resolution, providing for the efficient resolution of hairpinned coding ends and the near perfect ligation of signal ends (41). However, in the absence of DNA-PKCS, an alternative end joining pathway provides for signal end (and certain coding end) joining, but with lower efficiency and fidelity than in the presence of DNA-PKCS. Additionally, Gao et al. (39) have speculated that an alternative end joining pathway that is highly expressed in ES cells repairs DNA strand breaks in DNA-PKCS-deficient ES cells. To explain the marked differences in V(D)J recombination defects in DNA-PKCS-deficient foals and mice, this alternative pathway must not be equivalently active in all species or in different cell types. In fact, there is recent evidence that murine cells have an active DNA-PK-independent end joining pathway not detectable in human cells (62), providing support for the idea that alternative end joining pathways may be more abundantly expressed in certain species than others.
Still, the existence of an alternative pathway does not address the differences in V(D)J recombination defects in Ku vs DNA-PKCS-deficient rodent cells or the differing radiosensitivity of Ku vs DNA-PKCS ES cells. However, if this alternative joining pathway could utilize Ku in targeting DNA ends, this would provide an explanation for the relatively efficient signal joining observed in SCID mice (as opposed to Ku-deficient mice) as well as the radioresistance of DNA-PKCS-deficient ES cells (as opposed to Ku-deficient ES cells). Thus, in murine SCID cells that have an active DNA-PK-independent end joining pathway and adequate levels of Ku, but not DNA-PKCS, Ku can direct the alternative end joining pathway to V(D)J intermediates, explaining relatively normal signal joining in these cells. Similarly, the possibility that Ku directs this putative alternative pathway to damaged DNA would also explain the different radiosensitivities of Ku- and DNA-PKCS-deficient ES cells. This model could still account for the more severe defect in SCID foals if equine lymphocytes are particularly ineffective in this alternative pathway; in this case, even in the presence of Ku, both signal and coding joints are markedly reduced.
As discussed above, the two major pathways for repairing DSBs in eukaryotic cells are HR and NHEJ, although there is considerable evidence for other less well-defined mechanisms. An attractive candidate for an alternative pathway that could facilitate the repair of V(D)J recombination intermediates in the absence of DNA-PKCS is single-strand annealing. This pathway depends on regions of sequence homology between the two DNA ends and resection of the DNA ends so that annealing of complementary regions can occur. In yeast, this pathway requires several components of the RAD52 homologous recombination pathway (RAD52, MRE11, RAD50, and XRS2). There is experimental evidence supporting the idea that a mechanism related to single-strand annealing might resolve V(D)J recombination intermediates in certain situations. First, it is well appreciated that certain coding joints utilize short regions of sequence homology to facilitate joining (63, 64, 65), and in the absence of either Ku or XRCC4, the dependence on short sequence homology for efficient joining is accentuated (11, 51). Furthermore, there is precedent for overlapping roles of the nonhomologous DNA end joining factors in other pathways. Yeast that are defective in nonhomologous DNA end joining are not radiosensitive; the importance of this pathway for rejoining radiation-induced DNA breaks is only observed in yeast that are also defective in homologous end joining (66). Direct genetic evidence exists for overlapping roles for factors from these pathways in that the MRE11/RAD50/XRS2 complex is necessary for HR, NHEJ, and repair via single-strand annealing (67, 68). Direct biochemical evidence exists suggesting that Ku may function in other DNA repair pathways, in that Ku has been shown to stimulate DNA ligase activities for all human DNA ligases (69).
In yeast, RAD52 is essential for both homologous recombination and single-strand annealing (68). Mice with a targeted deletion of the murine RAD52 homologue have recently been generated (70). Although homologous recombination is impaired in cells from these animals, the cells are not hypersensitive to agents that induce DSBs, and the animals show no defects in the immune system. The fact that targeted deletion of RAD52 is not terribly detrimental to the mouse perhaps underscores the fact that NHEJ (as opposed to HR) is the major mechanism for repairing DSBs in higher eukaryotes (70). New insight regarding the function of RAD52 in higher eukaryotes has been gained, in that it has recently been demonstrated that RAD52, like Ku, can bind DNA ends in a sequence-independent manner (71). This finding led to the hypothesis that RAD52 may direct other factors involved either in single-strand annealing or homologous recombination to damaged DNA much in the same way that Ku has been proposed to direct components of the NHEJ pathway to damaged DNA (71).
We reasoned that if single-strand annealing contributes to signal end
joining in murine lymphocytes in the absence of
DNA-PKCS, signal joining would be more
significantly impaired in lymphocytes lacking both
DNA-PKCS and RAD52. Thus, we examined Ig
DHJH rearrangements in mice
deficient in both RAD52 and DNA-PKCS (Fig. 5
). As can be seen, the level of
DHJH coding joints in
SCID/RAD52-/- animals is depressed
50- to
100-fold as compared with RAD52-/- controls.
This level of coding joint diminution is exactly what is observed when
comparing DHJH coding
joints in DNA-PKCS-deficient vs normal mice
(41). In SCID/RAD52-/-, the level
of signal joints is diminished by
5- to 10-fold as compared with
RAD52-/- animals. Again, this level of
diminution is completely analogous to that observed when comparing
DHJH signal joints in
DNA-PKCS-deficient vs normal mice. In sum,
SCID/RAD52-/- animals appear to be
indistinguishable from SCID animals with respect to both coding and
signal joint formation, and we conclude that RAD52 does not participate
in resolving V(D)J recombination intermediates in the absence of
DNA-PKCS. This obviously does not rule out the
possibility that Ku directs some other component of this pathway (or
others) to unresolved V(D)J recombination intermediates, or that
another RAD52 homologue exists (as suggested previously
(72)) that may play a more prominent role in DSBR in
higher eukaryotes. Finally, this experiment underscores the less severe
diminution in signal end resolution in SCID mice as compared with SCID
foals and the substantial leakiness in coding end resolution in SCID
mice that is not observed in SCID foals (compare Figs. 2
and 5
).
Conclusion
In sum, these experiments establish that unlike DNA-PKCS deficiency in mice, the lack of DNA-PKC in foals results in a profound defect in signal end resolution during V(D)J recombination. This difference cannot be explained by the specific mutation in SCID foals leading to a mutant protein that inhibits signal end resolution. Instead, these data suggest that different species vary in their absolute requirements for DNA-PKCS during V(D)J recombination. These data are consistent with the hypothesis that in the absence of DNA-PKCS, an undefined end joining pathway joins the nonhomologous DNA ends generated during V(D)J recombination. The observed differences in the absolute requirement for DNA-PKCS during V(D)J recombination may reflect the relative abundance of this alternative end joining pathway.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Katheryn Meek, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75235-8884. E-mail address: ![]()
3 Abbreviations used in this paper: RAG, recombination-activating gene; DNA-PKCS, DNA-dependent protein kinase, catalytic subunit; DSB, double-strand break; DSBR, double-strand break repair; ES, embryonic stem; HR, homologous recombination; NHEJ, nonhomologous end joining; RSS, recombination signal sequence; XRCC, x-ray cross-complementation group. ![]()
Received for publication September 27, 1999. Accepted for publication November 16, 1999.
| References |
|---|
|
|
|---|
immunoglobulin genes. Science 228:677.This article has been cited by other articles:
![]() |
P. Douglas, X. Cui, W. D. Block, Y. Yu, S. Gupta, Q. Ding, R. Ye, N. Morrice, S. P. Lees-Miller, and K. Meek The DNA-Dependent Protein Kinase Catalytic Subunit Is Phosphorylated In Vivo on Threonine 3950, a Highly Conserved Amino Acid in the Protein Kinase Domain Mol. Cell. Biol., March 1, 2007; 27(5): 1581 - 1591. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Cui, Y. Yu, S. Gupta, Y.-M. Cho, S. P. Lees-Miller, and K. Meek Autophosphorylation of DNA-Dependent Protein Kinase Regulates DNA End Processing and May Also Alter Double-Strand Break Repair Pathway Choice Mol. Cell. Biol., December 15, 2005; 25(24): 10842 - 10852. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gupta and K. Meek The leucine rich region of DNA-PKcs contributes to its innate DNA affinity Nucleic Acids Res., December 9, 2005; 33(22): 6972 - 6981. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Convery, E. K. Shin, Q. Ding, W. Wang, P. Douglas, L. S. Davis, J. A. Nickoloff, S. P. Lees-Miller, and K. Meek Inhibition of homologous recombination by variants of the catalytic subunit of the DNA-dependent protein kinase (DNA-PKcs) PNAS, February 1, 2005; 102(5): 1345 - 1350. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Perryman Molecular Pathology of Severe Combined Immunodeficiency in Mice, Horses, and Dogs Vet. Pathol., March 1, 2004; 41(2): 95 - 100. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Ding, Y. V. R. Reddy, W. Wang, T. Woods, P. Douglas, D. A. Ramsden, S. P. Lees-Miller, and K. Meek Autophosphorylation of the Catalytic Subunit of the DNA-Dependent Protein Kinase Is Required for Efficient End Processing during DNA Double-Strand Break Repair Mol. Cell. Biol., August 15, 2003; 23(16): 5836 - 5848. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Woods, W. Wang, E. Convery, A. Errami, M. Z. Zdzienicka, and K. Meek A single amino acid substitution in DNA-PKcs explains the novel phenotype of the CHO mutant, XR-C2 Nucleic Acids Res., December 1, 2002; 30(23): 5120 - 5128. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Meek, L. Kienker, C. Dallas, W. Wang, M. J. Dark, P. J. Venta, M. L. Huie, R. Hirschhorn, and T. Bell SCID in Jack Russell Terriers: A New Animal Model of DNA-PKcs Deficiency J. Immunol., August 15, 2001; 167(4): 2142 - 2150. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Kienker, E. K. Shin, and K. Meek Both V(D)J recombination and radioresistance require DNA-PK kinase activity, though minimal levels suffice for V(D)J recombination Nucleic Acids Res., July 15, 2000; 28(14): 2752 - 2761. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |