The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Botella, L. M.
Right arrow Articles by Bernabéu, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Botella, L. M.
Right arrow Articles by Bernabéu, C.
The Journal of Immunology, 2000, 164: 1372-1378.
Copyright © 2000 by The American Association of Immunologists

Identification of a Functional NF-{kappa}B Site in the Platelet Endothelial Cell Adhesion Molecule-1 Promoter1

Luisa M. Botella2,3,*, Amaya Puig-Kröger3,*, Nuria Almendro*, Tilman Sánchez-Elsner*, Eduardo Muñoz{dagger}, Angel Corbí* and Carmelo Bernabéu*

* Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas, Madrid, Spain; and {dagger} Departamento de Fisiología e Inmunología, Facultad de Medicina, Universidad de Córdoba, Córdoba, Spain


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Platelet endothelial cell adhesion molecule-1 (PECAM-1) is a type I transmembrane adhesion protein of 130 kDa that belongs to a subgroup of the Ig gene superfamily, characterized by the presence of immunoreceptor tyrosine-based inhibitory motifs. PECAM-1 is expressed in circulating platelets, monocytes, neutrophils, a selective subgroup of T cells, and in endothelial cells, where it is preferentially located at intercellular junctions and participates in leukocyte transmigratory processes. The identification of two consensus NF-{kappa}B sites within the PECAM-1 promoter led us to analyze their possible involvement in the PECAM-1 expression regulated by inflammatory stimuli. We found that surface expression and promoter activity of PECAM-1 in myeloid cells are regulated by modulators of NF-{kappa}B, including TNF-{alpha}, PMA, and pyrrolidine dithiocarbamate. Mobility shifts assays identified a specific NF-{kappa}B-binding element at +110/+120, whose mutation abolished the basal promoter activity of PECAM-1 and decreased NF-{kappa}B-dependent responses of the PECAM-1 gene promoter. Furthermore, cotransfection experiments with an expression vector encoding the p65 subunit of NF-{kappa}B showed transactivation of the PECAM-1 promoter. These results demonstrate that NF-{kappa}B can regulate the transcriptional activity of PECAM-1.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Inflammation is a physiological process triggered in organisms by infectious agents, foreign bodies, or injuries and characterized by pain and fever (1). It is associated with an outlet of leukocytes, migrating toward the inflammatory focus where different adhesion molecules allow the interaction between immune cells and endothelium. These adhesion molecules belong to the mucin, selectin, cadherin, integrin, and Ig superfamily (2, 3, 4). The inflammatory focus releases cytokines such as TNF-{alpha}, IL-1, IL-8, or IFN-{gamma}, which induce cell-surface expression of adhesion molecules and activate endothelial cells of neighboring vessels. Leukocytes leave the circulation at sites of local inflammation through a series of sequential steps classified as rolling, activation, tight adhesion, transmigration, and passage across the vascular basement membrane.

Platelet endothelial cell adhesion molecule-1 (PECAM-1),4 also known as CD31, has been implicated as a critical mediator of transendothelial migration (5, 6). This is a type I transmembrane adhesion protein of 130 kDa, which belongs to a subgroup of the Ig superfamily, characterized by the presence of immunoreceptor tyrosine-based inhibitory motifs (7, 8). Accordingly, PECAM-1 can inhibit protein tyrosine kinase-dependent signals transduced by the TCR (9). PECAM-1 is expressed in circulating platelets, monocytes, neutrophils, and a selective subgroup of T cells. In endothelial cells, PECAM-1 is preferentially located at intercellular junctions and participates in leukocyte transmigratory processes. PECAM-1 mediates homotypic adhesion among endothelial cells, as well as monocyte/neutrophil adhesion to endothelium through homophilic interactions. It also interacts in a heterophilic way with ligands such as {alpha}vß3, CD38, and Plasmodium falciparum-infected erythrocytes (7, 10, 11, 12, 13). PECAM-1 is encoded by a 65-kb gene allocated in the long arm of chromosome 17 (14, 15), and the region driving its transcription has been identified as a TATA-less promoter containing relevant EGR-1 and GATA-2 cis-regulatory elements (16, 17). In addition, two consensus sites for NF-{kappa}B were identified at -409 (GGGGTTCTCC) and at +110 (GAGGAATCCCC) (16), although their functional relevance is not known. This family of transcription factors regulates the transcription of adhesion molecules such as E-selectin, VCAM-1, and ICAM-1 (18). Thus, structural and functional similarities of PECAM-1 and these adhesion molecules support the involvement of NF-{kappa}B in the transcription of PECAM-1.

The NF-{kappa}B/Rel family of transcription factors is composed of five distinct DNA-binding subunits called p50, p52, p65 (RelA), c-Rel, and Rel-B (19, 20, 21). The different family members can associate in various homo- or heterodimers through a highly conserved N-terminal 300-aa region known as the rel homology domain. Inactive NF-{kappa}B bound to the inhibitory protein I-{kappa}B is present in the cytoplasm and released upon phosphorylation of I-{kappa}B that regulates its ubiquitin-dependent degradation by the 26S proteasome. Then, the activated NF-{kappa}B dimer translocates to the nucleus and regulates gene transcription. The NF-{kappa}B activation process can be triggered by physiological stimuli such as viral or bacterial infections, as well as inflammatory cytokines as TNF-{alpha} or IL-1. In addition, phorbol esters can be used in vitro as nonphysiological activators of NF-{kappa}B. Previous studies have demonstrated that PECAM-1 expression is up-regulated upon treatment of monocytic cell lines with phorbol esters (16, 22, 23), a finding compatible with the involvement of NF-{kappa}B on PECAM-1 expression. This and the existence of two consensus NF-{kappa}B sites at +110 and -409 within the promoter region led us to assess the possible involvement of NF-{kappa}B on PECAM-1 expression. Here, we have characterized the NF-{kappa}B site at +110 as a functional motif involved in PECAM-1 transcription.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Plasmids

The pXP2 vector contains the promoterless firefly luciferase gene (24). Reporter plasmids pCD31-0.22 LUC, pCD31-0.44 LUC, pCD31-0.66 LUC, pCD31-0.98 LUC, and pCD31-1.42 LUC, containing different fragments of the PECAM-1 promoter inserted into the pXP2 vector, were previously described (16). Mutagenesis of the +110/+120 NF-{kappa}B site of PECAM-1 sequence was made by recombinant PCR from construct pCD31-0.44-LUC. NF-{kappa}B consensus sequence GCAGGGAGGAATCCCC (+110/+120) was changed to GCAGGGTTTAATCCC, where the mutated bases are underlined. For this purpose, complementary oligodeoxynucleotides A (5'- GCAGGGTTTAATCCCCTCAC-3') and B (5'-CTGTGAGGGGATTAAACCCTGC-3') were designed. At the same time, oligodeoxynucleotides L (5'-GATCCAAGCTTGTCGACCC-3') and R (5'-GATCTCAGACTCGGTACCC-3'), corresponding to the polylinker flanking regions of plasmid pXP2, were also synthesized and used as primers. Using the pCD31-0.44-LUC construct as a template, single PCRs with A and R, as well as B and L, primers were performed. The resulting amplification products were used as templates, in the presence of primers L and R, to carry out a third recombinant PCR. The recombinant product was cloned in PCRII TOPO (Invitrogen, San Diego, CA), released upon EcoRI digestion, and subcloned into the SmaI site of pXP2, resulting in the pCD31-0.44-Mut-LUC construct. Plasmids were sequenced to confirm the mutated sequence.

Plasmids pSEAP, which contains the alkaline phosphatase gene driven by the SV40 enhancer and early promoter (Clontech, Palo Alto, CA), and pCMV-ßgal, which contains the ß-galactosidase gene driven by the CMV enhancer and promoter (Clontech), were used to normalize transfection efficiencies. Plasmid pRc/CMV-p65 contains the gene encoding the p65 subunit of NF-{kappa}B driven by the CMV promoter (25). Plasmid pKBF-Luc contains three repeats of the NF-{kappa}B consensus elements present in the H-2Kb gene upstream of the herpes simplex thymidine kinase gene (26).

Transfections

U937 (human promonocytic), K-562 (human erythropoietic), and Raw 264.7 (mouse macrophage) cell lines were cultured in RPMI 1640, supplemented with 10% heat-inactivated FCS, 2 mM L-glutamine, in a 5% CO2 atmosphere at 37°C. U937 and Raw 264.7 cells, but not K-562 cells, express PECAM-1. Transfection of U937, K562 (106), or Raw 264.7 (2 x 105) cells was conducted using Superfect (Qiagen, Chatsworth, CA) and 1 µg of the appropriate PECAM-1 promoter-pXP2 luciferase vector. Luciferase relative units were determined in a TD20/20 luminometer (Promega, Madison, WI). When required, cells were treated with TNF-{alpha} at 50 or 100 ng/ml, with pyrrolidine dithiocarbamate (PDTC) (10–150 µM), or with PMA (40 ng/ml) for the times indicated, 24 h after transfection. Stable transfectants of the PECAM-1 promoter were obtained by electroporation of U937 cells as described (16). Briefly, plasmids pCD31-1.42-LUC and pBSpacAp, encoding the puromycin resistance gene, were cotransfected, and puromycin-resistant cells were isolated and maintained in culture at 0.2 µg/ml of antibiotic.

Flow cytometry

Flow cytometric analyses were performed with an Epics-CS (Coulter Cientifica, Madrid, Spain) using log amplifiers. U937 cells were treated with PMA or PDTC as indicated and incubated with HC1/6 (anti-PECAM-1) mAb (21) for 30 min at 4°C. After two washes with PBS containing 0.1% BSA, FITC-labeled F(ab')2 rabbit anti-mouse IgG (Dakopatts, Copenhagen, Denmark) was added, and incubation proceeded for an additional 30-min period at 4°C. Finally, cells were washed twice, and their fluorescence was estimated.

EMSA

Nuclear extracts from treated or untreated U937 or Raw 264.7 cells were obtained as described (27). Probes consisted of either the 185-bp BglII/NotI fragment of PECAM-1, end labeled by Klenow with 10 µCi of [{alpha}-32P]dCTP, or the oligonucleotides, containing NF-{kappa}B consensus +110/+120 (wild type (WT) and mutant) and -409/-418 (WT), labeled by polynucleotide kinase. These oligonucleotides were WT, +103GCAGGGAGGAATCCCCTCACA+124; mutated (MUT), +103GCAGGGTTTAATCCCCTCACA+124; and WT, -422TACAGGGGTTCTCCACCA-404. Binding reaction was performed with 10 µg of nuclear extracts, 2.5 µg of poly (dI-dC) in a buffer containing 70 mM KCl, 5 mM MgCl2, 0.1 mM ZnCl2, 0.5 mM DTT, 0.05% Nonidet P-40, 10% glycerol, and 20 mM HEPES, pH 7.5, on ice for 1 h. An amount of 2 ng of labeled probe (105 cpm) was added to the reaction mixture. Samples were electrophoresed on a 7.5% polyacrylamide gel in 0.5x TBE at 175 V for 3 h. For competition experiments a 100-fold excess of cold oligonucleotides were incubated in the reaction mixture.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Transcriptional regulation of PECAM-1 by NF-{kappa}B

PECAM-1, as other adhesion molecules, is involved in the recruitment of neutrophils and leukocytes toward the inflammatory foci. Structural characterization of the PECAM-1 promoter region revealed consensus sites for nuclear factors of the NF-{kappa}B family. Because PECAM-1 expression is up-regulated upon treatment of monocytic cell lines with phorbol esters (16, 22, 23), which are strong NF-{kappa}B activators, we assayed the effect of NF-{kappa}B modulators on the PECAM-1 cell-surface expression and gene promoter activity. PDTC has been described as a potent inhibitor of NF-{kappa}B activation (28). Thus, U937 cells were treated with PMA, in the presence of different doses of PDTC, and expression of PECAM-1 at the cell surface was measured by flow cytometry (Fig. 1GoA). As previously described (16), when U937 cells were treated with PMA, the expression of PECAM-1 increased 2.5-fold over the basal level. Importantly, addition of PDTC at 10–70 µM inhibited the PMA-dependent induction up to eight times. At the highest concentration, PDTC lowered the PECAM-1 expression below the basal levels observed in untreated cells, suggesting that NF-{kappa}B is involved in basal expression of PECAM-1. As a control, the viability of PDTC-treated cells was measured and found unaffected with respect to that of untreated cells (data not shown). Moreover, the effect of PDTC on PECAM-1 expression is not a general inhibitory phenomenon, as PDTC has been reported to up-regulate the expression of ß2 integrins (CD11a-c/CD18) in U937 cells (29). To determine whether PMA and PDTC were altering PECAM-1 expression at the transcriptional level, U937 cells were transfected with the pCD31-1.42-LUC reporter construct. PMA addition caused a 2-fold increase in the PECAM-1 promoter activity (Fig. 1GoB). In addition, PDTC abrogated the PMA-induced increase in the promoter activity and, when used at 30 µM, even reduced the basal level of promoter activity observed in untreated cells (Fig. 1GoB). Therefore, both PMA and PDTC directly affect the activity of the PECAM-1 promoter.



View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 1. Effect of the NF-{kappa}B inhibitor PDTC on the PMA-induced PECAM-1 expression. A, Cell-surface expression of PECAM-1. U937 cells were incubated either in the absence or in the presence of PMA (10ng/ml) or PDTC (10–70 µM) for 2 days, as indicated. Then, cells were stained for indirect immunofluorescence using the mAb HC1/6 (anti-PECAM-1) and analyzed by flow cytometry. Values of mean fluorescence intensity are indicated in the upper right corner. B, U937 cells were transiently transfected with the PECAM-1 promoter construct pCD31-1.42-LUC. After 24 h, cells were treated in the presence or in the absence of PMA (40 ng/ml) or PDTC (10–30 µM), as indicated. Transcriptional activity was measured using the luciferase reporter assay. Correction for transfection efficiency was made by cotransfection with a ß-galactosidase expression vector. For comparative purposes, the activity of the PECAM-1 construct in the absence of treatment was given the arbitrary value of 100. As a negative control, the promoter-less vector pXP2 was used. The mean of three different experiments is shown.

 
Subsequently, we analyzed the effect of TNF-{alpha}, the strongest inductor of NF-{kappa}B (19), on the transcription of PECAM-1. To that end, U-937 cells stably transfected with the PECAM-1 promoter were treated with TNF-{alpha} and the promoter activity was analyzed (Fig. 2Go). Addition of TNF-{alpha} resulted in a 2.5-fold induction of the PECAM-1 promoter activity at 12 h after treatment. Taken together, these experiments support the involvement of NF-{kappa}B in the transcription of the PECAM-1 gene.



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 2. Effect of TNF-{alpha} on the PECAM-1 promoter activity. U-937 cells stably transfected with the PECAM-1 reporter pCD31-1.42-LUC were incubated either in the absence or in the presence of TNF-{alpha} 100 ng/ml for the times indicated. Cells were lysed and luciferase activity was measured using a luminometer. For comparative purposes, the activity of PECAM-1 transfectants in the absence of treatment was given the arbitrary value of 100. As a negative control, the luciferase activity of cells transfected with the empty pXP2 vector (MOCK) was included. The mean of three different experiments is shown.

 
Genomic sequence analysis of the 1.55-kb upstream region of the PECAM-1 promoter revealed two possible consensus sites for NF-{kappa}B (16). One of them was found at positions -409/-418 (GGGGTTCTCC) within an AluI element, and the second one was located at +110/+120 (GAGGAATCCCC) within a BglII/NotI restriction fragment (Fig. 3GoA). This latter fragment was used as a probe for binding experiments with nuclear extracts from PMA-treated or untreated U937 cells (Fig. 3GoB). Two specific bands could be detected, which were competed by a consensus NF-{kappa}B oligonucleotide, while the complexes remained unaltered in the presence of heat shock protein factor or AP-1 recognition sequences. Both putative NF-{kappa}B sites at -409/-418 and +110/+120 were also studied in binding experiments using their corresponding oligonucleotides (Fig. 3GoC). The probe containing the NF-{kappa}B site at +110/+120 showed specific bands in U937 and Raw 264.7 cells. By contrast, the oligonucleotide containing the NF-{kappa}B site at -409/-418 did not show any binding when used as a probe, nor competed the binding of the +110/+120 site. Therefore, further studies were focused only on the NF-{kappa}B motif at +110/+120, as a bona fide NF-{kappa}B site. As expected, both PMA and TNF-{alpha} increased the two specific NF-{kappa}B bands (Figs. 3Go, B and D). Also, PDTC inhibited the NF-{kappa}B complex formation and prevented its increase due to either PMA or TNF-{alpha} (Fig. 3GoD). Identification of the specific complexes p50/p65 or p50/p50 was made by Abs against p50 and p65. Addition of anti-p65 resulted in inhibition of the upper complex associated with a supershift effect, whereas the presence of anti-p50 Abs led to inhibition of both complexes and to a supershift effect (Fig. 3GoD). These results suggest that the upper band is formed by p65/p50 heterodimers, while the lower complex is formed by p50 homodimers. Overall, these findings support the involvement of NF-{kappa}B on the PECAM-1 transcription.



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 3. Characterization of a NF-{kappa}B consensus site in PECAM-1 promoter. A, Diagram of the 1.42-Kb SmaI/PstI fragment of the PECAM-1 promoter containing the NF-{kappa}B site at +102. Numbers at sites of restriction enzymes refer to the transcription start site (+1) indicated by an arrow. The 185-bp BglII/NotI fragment (+47/+232) and the synthetic oligonucleotide +102/+126 were used as probes in the EMSA experiments corresponding to B–D. B, EMSA with PMA-treated or untreated U937 nuclear extracts. The 185-bp BglII/NotI fragment used as a probe was end labeled with [{alpha}-32P]dCTP. The presence of competitors (x100-fold excess) heat shock protein factor, AP-1, and NF-{kappa}B (NF) consensus oligonucleotides, and the 185-bp BglII/NotI fragment (F) is indicated. Arrows point to the NF-{kappa}B complexes, identified according to E. C, EMSA using probes containing the -409/-418 and +110/+120 NF-{kappa}B consensus sites. Nuclear extracts from U937 (U) or Raw 264.7 (R) cells were incubated with oligonucletides -422/-404 (-404) or +103/+124 (+102) as indicated. D, Specific blocking of NF-{kappa}B mobilization by PDTC. Nuclear extracts from cells treated with different combinations of TNF-{alpha}, PMA, or PDTC were used as indicated. EMSA experiments were performed using as a probe the oligonucleotide +110/+120 containing a consensus NF-{kappa}B site. E, Identification of NF-{kappa}B/Rel subunits present in the protein-DNA complexes of PECAM-1 promoter. Untreated or TNF-{alpha}-treated U937 cells were used for EMSA experiments using as a probe the oligonucleotide +110/+120 containing a consensus NF-{kappa}B site. The presence of competitor unlabeled oligonucleotide and Abs to p65 and p50 is indicated. The arrows indicate the original NF-{kappa}B complexes whose electrophoretic mobility is modified by the presence of Abs.

 
Involvement of NF-{kappa}B site at +110 in PECAM-1 expression

To test whether the NF-{kappa}B site at +110 was involved in the transcriptional activity of PECAM-1, its consensus sequence was mutated in the context of the pCD31-0.44-LUC plasmid. Then, wild-type and mutant constructs were used to transfect Raw 264.7 cells as these cells constitutively express high levels of TNF-{alpha} (30) and are likely to have constitutively active NF-{kappa}B. As shown in Fig. 4GoA, the mutant construct displayed a clear reduction (seven times) of its promoter activity respect to the wild-type control. Moreover, we found that addition of the NF-{kappa}B inhibitor PDTC decreased the promoter activity of the wild-type construct in a dose-dependent manner (Fig. 4GoB). Therefore, the NF-{kappa}B element at +110 directly contributes to the activity of the PECAM-1 promoter in Raw 246.7 cells.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 4. Role of the NF-{kappa}B site at +110 on the PECAM-1 promoter activity of Raw cells. A, Effect of mutation of the NF-{kappa}B site at +110 on the PECAM-1 promoter activity. Raw 264.7 cells were transiently transfected with the wild-type pCD31-0.44-LUC plasmid (WT) or the corresponding mutant construct (MUT), and, 24 h later, the luciferase activity was measured. Correction for transfection efficiency was made by cotransfection with an alkaline phosphatase expression vector. The mean of three different experiments is shown. As a negative control, the promoter-less vector pXP2 was used. B, Effect of PDTC on the promoter activity of PECAM-1. Raw 264.7 cells were transiently transfected with the pCD31-0.44-LUC plasmid in the presence of the indicated concentrations of PDTC, and luciferase activity was measured after 24 h of treatment. Correction for transfection efficiency was made by cotransfection with an alkaline phosphatase expression vector. The mean of three different experiments is shown.

 
To confirm the transcriptional involvement of the NF-{kappa}B site at +110, EMSA experiments using the wild-type and mutated versions of the NF-{kappa}B oligonucleotide were conducted in Raw 264.7 cells (Fig. 5Go, A and B). When the wild-type oligonucleotide +110/+120 was labeled as a probe, two specific bands corresponding to the NF-{kappa}B transcription factor appeared (Fig. 5GoB). The identification of these bands was made with Abs specific for p50 and p65, respectively (data not shown). However, when the mutated oligonucleotide was used as a probe, no specific complexes could be detected. Taken together, these results support the involvement of the NF-{kappa}B at +110 in the promoter activity of PECAM-1.



View larger version (54K):
[in this window]
[in a new window]
  		FIGURE 5. Analysis by EMSA using as probes the wild-type and the mutated NF-{kappa}B oligonucleotides. A, Sequences of wild-type and mutated oligonucleotides, used as probes, are shown. B, Different amounts of nuclear extracts (5 or 10 µg of total protein) from Raw 264.7 cells were incubated with the wild-type (wt) or the mutated (mut) oligonucleotides (+110/+120) as probes. In each sample, 105 cpm were used. Binding reactions were loaded in a 7.5% polyacrylamide gel and electrophoresed. The presence of 100 times excess competitor is indicated.

 
The p65 subunit of NF-{kappa}B modulates the promoter activity of PECAM-1

The transcriptional involvement of the NF-{kappa}B site at +110 in the promoter activity of PECAM-1 was also assessed by treatment with exogenous TNF-{alpha} of erythropoietic K562 cells because this cell lineage does not express TNF-{alpha}. Similarly to results obtained with Raw 264.7 cells (Fig. 4GoA), in K562 cells the mutant construct of PECAM-1 displayed a reduction (2.5 times) of its promoter activity in respect to the wild-type plasmid (Fig. 6Go). In addition, the activity of the wild-type promoter was increased by TNF-{alpha} in a dose-dependent manner, whereas that of the mutated version was either unaffected or inhibited (Fig. 6Go).



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 6. Effect of TNF-{alpha} on the activity of the PECAM-1 promoter mutated at the NF-{kappa}B site +110/+120. K-562 cells were transiently transfected with the wild-type pCD31-0.44-LUC construct ({square}) or the corresponding mutant construct () in the presence of the indicated concentrations of TNF-{alpha}. Luciferase activity was measured after 24 h of treatment. Correction for transfection efficiency was made by cotransfection with an alkaline phosphatase expression vector. For comparative purposes, the promoter activity of the wild-type pCD31-0.44-LUC construct in the absence of TNF-{alpha} was given the arbitrary value of 100. The mean of four different experiments is shown.

 
To further demonstrate the specific involvement of members of the NF-{kappa}B family in the PECAM-1 promoter activity, transactivation experiments were conducted in Raw 264.7 cells using an expression vector for the p65 subunit (Fig. 7Go). Coexpression of the p65 subunit resulted in a 4.5-fold increase of the transcriptional activity displayed by the pCD31-0.44 LUC wild-type PECAM-1 promoter construct, whereas the activity in the mutant construct was not significantly increased. In addition, PECAM-1 promoter constructs containing (pCD31-0.44-LUC and pCD31-1.42-LUC) or not (pCD31-0.22-LUC and pCD31-0.98-LUC) the NF-{kappa}B site at +110 were analyzed. Only constructs pCD31-0.44-LUC and pCD31-1.42-LUC containing the NF-{kappa}B site at +110 could be transactivated at similar levels with the p65 subunit. It is worth noting that the unresponsive pCD31-0.98-LUC construct contains the putative NF-{kappa}B site at -409. This is in agreement with the lack of specific NF-{kappa}B complexes when using the oligonucleotide -422/-404 in EMSA studies (Fig. 3GoC) and suggests that this is a nonfunctional motif. As a control of the experiment, the KBF-1 promoter construct, containing three NF-{kappa}B responsive elements, showed a 5-fold transcription stimulation upon transfection with the p65 subunit. These results demonstrate that the p65 subunit of the NF-{kappa}B complex takes part in the transcriptional regulation of PECAM-1.



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 7. Effect of p65 overexpression on the PECAM-1 promoter activity. Raw 264.7 cells were transiently transfected with the pCD31-0.22-LUC, pCD31-0.44-LUC (both wild-type and mutant versions), pCD31-0.98-LUC, or pCD31-1.42-LUC constructs, either in the absence or in the presence of the plasmid encoding the p65 subunit of NF-{kappa}B, as indicated. After 24 h, the luciferase activity was measured. Correction for transfection efficiency was made by cotransfection with an alkaline phosphatase expression vector. The mean of three different experiments is shown. As a positive control for the transactivation effect of p65, the plasmid KBF-1 containing multiple repeats of NF-{kappa}B consensus elements was used. The pXP2 vector was used as a negative control.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The NF-{kappa}B family of transcription factors has been reported to be involved in the control of several important physiological processes, including inflammation, cell cycle regulation, and HIV viral replication (19, 20, 21). Thus, NF-{kappa}B regulates transcription of cytokines (e.g., TNF-{alpha}, IL-1, or IFN-{gamma}), and cell-surface receptors (e.g., ICAM-1, VCAM-1, E-selectin, or CD69), involved in the inflammatory response. Here, we report the transcriptional regulation of the cell adhesion molecule PECAM-1 by NF-{kappa}B in myeloid cells.

PECAM-1 is a TATA-less gene, which is a characteristic of constitutively expressed genes, containing multiple transcription initiation sites (16, 17). Endothelial cells express constitutively high levels of PECAM-1, while its expression is regulated in monocytes, during the process of maturation and differentiation to macrophages (16, 22, 23). The results here presented suggest that part of this regulation in macrophages is mediated through the NF-{kappa}B factor, active at the +110/+120 site of the PECAM-1 promoter used in this study. Interestingly enough, mobilization of NF-{kappa}B in monocytes/macrophages can be readily achieved by a variety of stimuli, including cell adherence to the substratum, or the presence of TNF-{alpha} or bacterial LPS (19), suggesting a functional versatility of PECAM-1. The involvement of NF-{kappa}B in PECAM-1 transcription was demonstrated based upon several lines of evidence: 1) surface expression and promoter activity of PECAM-1 are regulated by modulators of NF-{kappa}B, including TNF-{alpha}, PMA, and PDTC; 2) cotransfection experiments with a PECAM-1 promoter-derived reporter construct and an expression vector encoding the p65 subunit of NF-{kappa}B show transactivation of the PECAM-1 promoter; 3) EMSA experiments demonstrate that the NF-{kappa}B site at +110/+120 of the PECAM-1 promoter binds NF-{kappa}B transcription factor; and 4) mutation of the NF-{kappa}B site at +110/+120 abolishes the basal promoter activity of PECAM-1 and inhibits the TNF-{alpha}-dependent induction of the promoter.

A major secretory product of macrophages is TNF-{alpha}, which in turn stimulates mononuclear phagocytes to secrete other cytokines contributing to the leukocyte adhesion and to activate transcription of surface receptors, leading to recruitment of neutrophils, monocytes, and lymphocytes to the inflammatory sites. One way for TNF-{alpha} to increase transcription of its target genes is through mobilization of transcription factors such as those of the NF-{kappa}B family (19, 20). Monocytes, rather undifferentiated cells, circulate in the blood stream and can be recruited to inflammatory foci, differentiate into macrophages, and be activated by cytokines to respond against foreign Ags, to eliminate tumor cells, and to induce proliferation and migration of endothelial cells. NF-{kappa}B is involved in these processes by coordinately controlling gene expression of ILs, adhesion molecules, and cytokines expressed by monocytes/macrophages (19). Therefore, a possible induction of PECAM-1 transcription through NF-{kappa}B activation can be interpreted as an adaptative response of the organism to meet inflammation. In this sense, PECAM-1 participates in neutrophil recruitment at inflammatory sites (5, 6) and is down-regulated after leukocyte extravasation (31). To our knowledge, the effect of TNF-{alpha} on PECAM-1 expression by myeloid cells had not been reported to date. However, three reports have analyzed the combined action of TNF-{alpha} and IFN-{gamma} on endothelial cells (32, 33, 34). Thus, it has been shown that this cytokine combination leads to a redistribution of the PECAM-1 Ag on human endothelial cells (32). However, while some authors find a reduction in the levels of PECAM-1 (33, 34), others do not find alterations in the levels of PECAM-1 transcription or surface expression (32). These contradictory reports might reflect the existence of soluble forms of PECAM-1, generated by alternative splicing (7), which likely show a transcriptional regulation different from the membrane-bound PECAM-1. As all these studies were conducted using the combined action of TNF-{alpha} and IFN-{gamma} in endothelial cells, it is not possible to compare these results with the single TNF-{alpha} treatments on myeloid cells analyzed in this report. In addition, it can be argued that the inducible expression of PECAM-1 detected in myeloid cells should have a different type of regulation than the constitutive expression found in endothelial cells.

It is worth noting that NF-{kappa}B was initially identified as an activator of the Ig {kappa} light chain (35). Since then, an increasing number of genes, belonging to the Ig superfamily, have been reported to be regulated by NF-{kappa}B, including the TCR {alpha} and ß, MHC class I and II, VCAM-1, ICAM-1, or MadCAM (18, 19, 36). Among these, the list of members of the CAM subfamily is now increased with the identification of a functional NF-{kappa}B site in the PECAM-1 promoter. The specific contributions of the NF-{kappa}B factor, as a regulator of transcription of genes belonging to this Ig superfamily, deserve further biological/medical investigation.


   Acknowledgments
 
We thank Dr. Juan Miguel Redondo for helpful discussions, Dr. Pedro Lastres for flow cytometry, Dr. Miguel Relloso for preparation of the figures, and Ms. Carmen Langa for excellent technical assistance.


   Footnotes
 
1 This work has been supported by grants from Comisión Interministerial de Ciencia y Tecnología (CICYT-SAF97-0034 to C.B. and CICYT-SAF98-0068 to A.C.) and Comunidad Autónoma de Madrid (fellowship to T.S.-E.). Back

2 Address correspondence and reprint requests to Dr. Luisa M. Botella, Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas, Velázquez 144, 28006 Madrid, Spain. E-mail address: Back

3 L.M.B. and A.P.-K. contributed equally to this work. Back

4 Abbreviations used in this paper: PECAM-1, platelet endothelial cell adhesion molecule-1; PDTC, pyrrolidine dithiocarbamate. Back

Received for publication August 6, 1999. Accepted for publication November 10, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gallin, J. I., R. Snyderman. 1999. Inflammation: Basic Principles and Clinical Correlates 3rd Ed. Lippincott, Williams and Wilkins, Philadelphia..
  2. Springer, T. A.. 1994. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 76:301.[Medline]
  3. Carlos, T. M., J. M. Harlan. 1994. Leukocyte-endothelial adhesion molecules. Blood 84:2068.[Abstract/Free Full Text]
  4. Dianzani, U., F. Malavasi. 1995. Lymphocyte adhesion to endothelium. Crit. Rev. Immunol. 15:167.[Medline]
  5. Muller, W. A., S. A. Weigl, X. Deng, D. M. Phillips. 1993. PECAM-1 is required for transendothelial migration of leukocytes. J. Exp. Med. 178:449.[Abstract/Free Full Text]
  6. Vaporciyan, A. A., H. M. DeLisser, H. C. Yan, I. I. Mendiguren, S. R. Thom, M. J. Jones, A. P. Ward, S. M. Albelda. 1993. Involvement of platelet-endothelial cell adhesion molecule-1 in neutrophil recruitment in vivo. Science 26:1580.
  7. Newman, P. J.. 1997. The biology of PECAM-1. J. Clin. Invest. 100:(Suppl. 11):S25.
  8. Newman, P. J.. 1999. Switched at birth: a new family for PECAM-1. J. Clin. Invest. 103:5.[Medline]
  9. Newton-Nash, D. K., P. J. Newman. 1999. A new role for platelet-endothelial cell adhesion molecule-1 (CD31): inhibition of TCR-mediated signal transduction. J. Immunol. 163:682.[Abstract/Free Full Text]
  10. Piali, L., P. Hammel, C. Uherek, F. Bachmann, R. H. Gisler, D. Dunon, B. A. Imhof. 1995. CD31/PECAM-1 is a ligand for {alpha}vß3 integrin involved in adhesion of leukocytes to endothelium. J. Cell Biol. 130:451.[Abstract/Free Full Text]
  11. Buckley, C. D., R. Doyonnas, J. P. Newton, S. D. Blystone, E. J. Brown, S. M. Watt, D. L. Simmons. 1996. Identification of {alpha}vß3 as a heterotypic ligand for CD31/PECAM-1. J. Cell Sci. 109:437.[Abstract]
  12. Deaglio, S., M. Morra, R. Mallone, C. M. Ausiello, E. Prager, G. Garbarino, U. Dianzani, H. Stockinger, F. Malavasi. 1998. Human CD38 (ADP-ribosyl cyclase) is a counter-receptor of CD31, an Ig superfamily member. J. Immunol. 160:395.[Abstract/Free Full Text]
  13. Treutiger, C. J., A. Heddini, V. Fernandez, W. A. Muller, M. Wahlgren. 1997. PECAM-1/CD31, an endothelial receptor for binding Plasmodium falciparum-infected erythrocytes. Nat. Med. 12:1405.
  14. Kirschbaum, N. E., R. J. Gumina, P. J. Newman. 1994. Organization of the gene for human platelet/endothelial cell adhesion molecule-1 shows alternatively spliced isoforms and a functionally complex cytoplasmic domain. Blood 84:4028.[Abstract/Free Full Text]
  15. Gumina, R. J., N. E. Kirschbaum, P. N. Rao, P. vanTuinen, P. J. Newman. 1996. The human PECAM1 gene maps to 17q23. Genomics 34:229.[Medline]
  16. Almendro, N., T. Bellón, C. Rius, P. Lastres, C. Langa, A. L. Corbí, C. Bernabéu. 1996. Cloning of the human platelet endothelial cell adhesion molecule-1 promoter and its tissue-specific expression: structural and functional characterization. J. Immunol. 157:5411.[Abstract]
  17. Gumina, R. J., N. E. Kirschbaum, K. Piotrowski, P. J. Newman. 1997. Characterization of the human platelet/endothelial cell adhesion molecule-1 promoter: identification of a GATA-2 binding element required for optimal transcriptional activity. Blood 89:1260.[Abstract/Free Full Text]
  18. Collins, T., M. Read, A. Neish, M. Whitley, D. Thanos, T. Maniatis. 1995. Transcriptional regulation of endothelial cell adhesion molecules: and cytokine-inducible enhancers. FASEB J. 9:899.[Abstract]
  19. Bauerle, P. A., T. Henkel. 1994. Function and activation of NF-{kappa}B in the immune system. Annu. Rev. Immunol. 12:141.[Medline]
  20. Jr Baldwin, A. S.. 1996. The NF-{kappa}B and I-{kappa}B proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649.[Medline]
  21. Ghosh, S., M. J. May, E. B. Kopp. 1998. NF-{kappa}B and rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225.[Medline]
  22. Cabañóas, C., F. Sánchez-Madrid, T. Belln, C. G. Figdor, A. A. Te Velde, J. M. Fernández, A. Acevedo, C. Bernabéu. 1989. Characterization of a novel myeloid antigen regulated during differentiation of monocytic cells. Eur. J. Immunol. 19:1373.[Medline]
  23. Goldberger, A., K. A. Middleton, P. J. Newman. 1994. Changes in expression of the cell adhesion molecule PECAM-1 (CD31) during differentiation of human leukemic cell lines. Tissue Antigens 44:285.[Medline]
  24. Nordeen, S. K.. 1988. Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 6:454.[Medline]
  25. Le Bail, O., R. Schmidt-Ullrich, A. Israël. 1993. Promoter analysis of the gene encoding the I-{kappa}B{alpha}/MAD3 inhibitor of NF-{kappa}B: positive regulation by members of the rel/NF-{kappa}B family. EMBO J. 12:5043.[Medline]
  26. Yano, O., J. Kanellopoulos, M. Kieran, O. Le Bail., A. Israël, P. Kourilsky. 1987. Purification of KBF1, a common factor binding to both H-2 and ß2-microglobulin enhancers. EMBO J. 6:3317.[Medline]
  27. Schreiber, E., P. Matthias, M. M. Muller, W. Schaffner. 1988. Identification of a novel lymphoid specific octamer binding protein (OTF-2B) by proteolytic clipping bandshift assay (PCBA). EMBO J. 7:4221.[Medline]
  28. Schreck, R., B. Meier, M. D. Männel, W. Dröge, P. A. Bauerle. 1992. Dithiocarbamates as potent inhibitors of nuclear factor B activation in intact cells. J. Exp. Med. 175:1181.[Abstract/Free Full Text]
  29. Aragonés, J., C. López-Rodríguez, A. Corbí, P. G. del Arco, M. López-Cabrera, M.O. de Landázuri, J. M. Redondo. 1996. Dithiocarbamates trigger differentiation and induction of CD11c gene through AP-1 in the myeloid lineage. J. Biol. Chem. 271:10924.[Abstract/Free Full Text]
  30. Beutler, B., J. Mahoney, N. Le Trang, P. Pekala, A. Cerami. 1985. Purification of cachectin, a lipoprotein lipase-suppressing hormone secreted by endotoxin-induced RAW 264.7 cells. J. Exp. Med. 161:984.[Abstract/Free Full Text]
  31. Christofidou-Solomidou, M., M. T. Nakada, J. Williams, K. A. Muller, H. M. DeLisser. 1997. Neutrophil platelet endothelial cell adhesion molecule-1 participates in neutrophil recruitment at inflammatory sites and is down-regulated after leukocyte extravasation. J. Immunol. 158:4872.[Abstract]
  32. Romer, L. H., N. V. McLean, H. C. Yan, M. Daise, J. Sun, H. M. DeLisser. 1995. IFN-{gamma} and TNF-{alpha} induce redistribution of PECAM-1 (CD31) on human endothelial cells. J. Immunol. 154:6582.[Abstract]
  33. Rival, Y., A. Del Maschio, M. J. Rabiet, E. Dejana, A. Duperray. 1996. Inhibition of platelet endothelial cell adhesion molecule-1 synthesis and leukocyte transmigration in endothelial cells by the combined action of TNF-{alpha} and IFN-{gamma}. J. Immunol. 157:1233.[Abstract]
  34. Stewart, R. J., T. S. Kashxur, P. A. Marsden. 1996. Vascular endothelial platelet endothelial adhesion molecule-1 (PECAM-1) expression is decreased by TNF-{alpha} and IFN-{gamma}: evidence for cytokine-induced destabilization of messenger ribonucleic acid transcripts in bovine endothelial cells. J. Immunol. 156:1221.[Abstract]
  35. Sen, R., D. Baltimore. 1986. Inducibility of {kappa} immunoglobulin enhancer-binding protein NF-{kappa}B by a postranslational mechanism. Cell 4:921.
  36. Takeuchi, M., V. R. Baichwal. 1995. Induction of the gene encoding mucosal vascular addressin cell adhesion molecule 1 by tumor necrosis factor {alpha} is mediated by NF-{kappa}B proteins. Proc. Natl. Acad. Sci. USA 92:3561.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J Am Coll CardiolHome page
E. Groyer, A. Nicoletti, H. Ait-Oufella, J. Khallou-Laschet, A. Varthaman, A.-T. Gaston, O. Thaunat, S. V. Kaveri, R. Blatny, H. Stockinger, et al.
Atheroprotective Effect of CD31 Receptor Globulin Through Enrichment of Circulating Regulatory T-Cells
J. Am. Coll. Cardiol., July 24, 2007; 50(4): 344 - 350.
[Abstract] [Full Text] [PDF]

Home page
 J. Histochem. Cytochem.Home page
Y. Sawa, Y. Sugimoto, T. Ueki, H. Ishikawa, A. Sato, T. Nagato, and S. Yoshida
Effects of TNF-{alpha} on Leukocyte Adhesion Molecule Expressions in Cultured Human Lymphatic Endothelium
J. Histochem. Cytochem., July 1, 2007; 55(7): 721 - 733.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
J. L. Figarola, N. Shanmugam, R. Natarajan, and S. Rahbar
Anti-Inflammatory Effects of the Advanced Glycation End Product Inhibitor LR-90 in Human Monocytes
Diabetes, March 1, 2007; 56(3): 647 - 655.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
S. Diskin, J. Kumar, Z. Cao, J. S. Schuman, T. Gilmartin, S. R. Head, and N. Panjwani
Detection of differentially expressed glycogenes in trabecular meshwork of eyes with primary open-angle glaucoma.
Invest. Ophthalmol. Vis. Sci., April 1, 2006; 47(4): 1491 - 1499.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
T. Seki, K.-H. Hong, J. Yun, S.-J. Kim, and S. P. Oh
Isolation of a Regulatory Region of Activin Receptor-Like Kinase 1 Gene Sufficient for Arterial Endothelium-Specific Expression
Circ. Res., April 30, 2004; 94(8): e72 - e77.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
N. Gong, H. Wei, S. H. Chowdhury, and S. Chatterjee
Lactosylceramide recruits PKC{alpha}/{epsilon} and phospholipase A2 to stimulate PECAM-1 expression in human monocytes and adhesion to endothelial cells
PNAS, April 27, 2004; 101(17): 6490 - 6495.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. Kashani-Sabet, Y. Liu, S. Fong, P.-Y. Desprez, S. Liu, G. Tu, M. Nosrati, C. Handumrongkul, D. Liggitt, A. D. Thor, et al.
Identification of gene function and functional pathways by systemic plasmid-based ribozyme targeting in adult mice
PNAS, March 19, 2002; 99(6): 3878 - 3883.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Botella, L. M.
Right arrow Articles by Bernabéu, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Botella, L. M.
Right arrow Articles by Bernabéu, C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS