| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Laboratory of Clinical Investigation, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892; and
Laboratory of Retrovirus Research, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
10:1 in
immortalized T cell lines, in PBMC, and in diverse populations of
thymocytes. The EC50 of CCL25 for CCR9A was lower than that
for CCR9B, and CCR9A was desensitized by doses of CCL25 that failed to
silence CCR9B. CCR9 is the first example of a chemokine receptor in
which alternative mRNA splicing leads to proteins of differing
activities, providing a mechanism for extending the range of
concentrations over which a cell can respond to increments in the
concentration of ligand. The study of CCR9A and CCR9B should enhance
our understanding of the role of the chemokine system in T cell
biology, particularly during the stages of thymocyte
development. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We have previously identified and characterized novel chemokine receptors and HIV/SIV coreceptors on lymphocytes (6, 7, 8, 9, 10), and work in our and other laboratories using immortalized CD4+ T cell lines have suggested that there might exist as yet unidentified HIV-1 coreceptor(s) (K.W.C.P., unpublished observations, and Ref. 11). In experiments to identify such receptors, we found that the SUP-T1 T cell lymphoma line expressed GPR-9-6, a gene entered in the database as encoding a chemokine receptor-related protein (GenBank accession number U45982). While our experiments to date with a limited number of HIV-1 strains have not revealed coreceptor activity for GPR-9-6, we found that GPR-9-6 encodes signaling receptors for the CC chemokine ligand 25 (CCL25)2/thymus-expressed chemokine (TECK)/Ckß-15. In the remainder of this work, we will, for the sake of clarity, designate the GPR-9-6 gene CCR9, in accordance with the recommendations of the committee for chemokine receptor nomenclature (Philip Murphy and Craig Gerard, personal communication). Similarly, we will adopt the chemokine nomenclature proposed at the Keystone Symposium on Chemokines and Chemokine Receptors, January 18–23, 1999, and refer to the chemokine TECK/Ckß-15 as CCL25.
CCL25 was discovered by sequencing cDNAs made from the thymuses of
RAG-1-deficient mice and is an unusual CC chemokine in many respects
(12). The sequence of CCL25 is less than 30% identical to
any other CC chemokine, and the CCL25 gene is not found in any of the
known CC chemokine gene clusters, but is instead on chromosome 8 in
mice (12) and on chromosome 19 in humans
(13). Expression of the CCL25 gene is restricted, with
mRNA detected in thymus and small intestine, and in spleen after
challenge with LPS; expression in the thymus was shown to be in
dendritic cells and, at least in the fetal thymus, in MHC
II+ epithelium as well (12, 14).
CCL25 has been reported to be a chemoattractant for mouse thymocytes
and for thymocyte precursors (12, 14) as well as for mouse
splenic dendritic cells and IFN-
-activated macrophages
(12). Based on these observations, CCL25 has been proposed
to be important in T cell development, either by affecting recruitment
of thymic precursors, migration of thymocytes within the thymus, or
recruitment of thymic dendritic cells that are important for
autoantigen-driven negative selection (12).
Although the large number of lymphocyte-targeting chemokines, together with ligand/receptor promiscuity, suggest extensive redundancy in the activities of the chemokine system in lymphocyte biology, it is becoming clear that particular ligand/receptor groups act preferentially on lymphocytes at specific stages of development, activation, and differentiation. As examples, CXCL12 (stromal cell-derived factor-1 (SDF-1)) is necessary for B cell development (15), and CCR7 ligands are necessary for trafficking of naive T cells into secondary lymphoid organs (16); many receptors for proinflammatory CC chemokines show significant expression/activity only on activated memory T cells (17, 18); CXCR3 expression/activity is intimately associated with T cell activation of both naive and memory cells (18); CCR6 is distinguished by its being fully active on resting memory T cells (8, 19); and a number of chemokine receptors have been reported to show preferential expression depending on whether CD4 T cells have differentiated down Th1 vs Th2 pathways (reviewed in Ref. 20). With respect to thymocyte development, a good deal of circumstantial evidence based on expression data has suggested the importance of the chemokine system, but no definitive role for chemokines and their receptors has been established. CCL25 is of particular interest in this regard because of its restricted tissue and cell-type expression and its activity on thymocytes.
We have isolated cDNAs encoding receptors for CCL25. These cDNAs encode
two proteins that we have designated CCR9A and CCR9B. As the result of
differential splicing of the CCR9 mRNA, CCR9A is predicted to contain
12 additional amino acids at its N terminus as compared with CCR9B.
This degree of polymorphism at the N terminus of a chemokine receptor
is novel. Of greater interest, we demonstrate that CCR9A and CCR9B,
while both active, are not functionally equivalent, with CCR9A
signaling and being desensitized at lower concentrations of chemokine
as compared with CCR9B. These data suggest that the two forms of CCR9
extend the range of CCL25 concentrations over which a cell can sense
increments in the concentration of ligand. Consistent with the
expression of CCL25, the CCR9 gene is highly expressed in thymus, with
analysis of thymocyte subsets revealing highest levels in the
CD4+CD8+ cells. In all
lymphocytes examined, mRNAs for CCR9A and CCR9B were found at
a ratio of 10:1. Our work provides information and tools that are
likely to lead to an increased understanding of the activities of the
chemokine system, particularly in regard to thymocytes and T cell
development, enhancing our appreciation of the breadth of involvement
of chemokines and chemokine receptors in lymphocyte biology.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Jurkat-TAg cells, which had been transfected with the
large T-Ag gene of SV40, were derived as described (21)
and kindly provided by Lawrence Samelson, National Institutes of Health
(Bethesda, MD). Jurkat clone E6-1, SUP-T1, U937, and human embryonic
kidney (HEK) 293 cells were obtained from American Type Culture
Collection (Manassas, VA). CEM x174 and MOLT-4 clone 8 cells were
obtained from the National Institutes of Health AIDS Research and
Reference Reagent Program (Rockville, MD). MT4 cells were kindly
provided by Malcolm Martin (National Institutes of Health). H9 cells
were derived as described (22) and obtained from the
Center for Biologics Evaluation and Research, Food and Drug
Administration. Elutriated monocytes and PBMC were obtained from normal
donors by the Department of Transfusion Medicine, National Institutes
of Health. Macrophages were produced by culturing monocytes for 1 wk in
Iscove’s medium containing 10% human serum type AB (Sigma, St. Louis,
MO) plus pyruvate. PBMC were activated by culturing with 1 µg/ml PHA
and 20 IU/ml of IL-2 for 3 days. HEK-293 cells were grown in MEM plus
10% horse serum. Other cell lines and PBMC were grown in RPMI 1640
with 10% FBS. For purification of thymocytes, thymus fragments were
obtained during cardiac surgery from children (ages 1 mo-3 yr) with
congenital heart disease. The tissue was minced, large aggregates were
removed by passing through a nylon mesh, and thymocytes were separated
by centrifugation on a Ficoll-Paque gradient (Pharmacia Biotech,
Uppsala, Sweden). The total thymocyte suspension was separated into
CD4-CD8-,
CD4+CD8+,
CD4+CD8-, and
CD8+CD4-, thymocyte
subsets using the CD4 Multisort Kit and VarioMACS magnet separator
according to the manufacturer’s instructions (Miltenyi Biotec, Auburn,
CA). The phenotypes of separated thymocyte subsets were analyzed using
PE-conjugated anti-CD4 and allophycocyanin-conjugated anti-CD8
mAbs from PharMingen (San Diego, CA). The
CD4-CD8- preparation
contained 20% CD4dull cells, which also
represent immature thymocytes (23). The
CD4+CD8+ preparation was
>95% pure. The CD4+CD8-
preparation contained, in addition to these cells, 20%
CD4+CD8+ cells and 10%
CD4-CD8- cells, and the
CD4-CD8+ preparation
contained, in addition to these cells, 20%
CD4dullCD8- cells, 20%
CD4+CD8+ cells, and 10%
CD4-CD8- cells.
Cloning of CCR9A and CCR9B cDNAs
Total RNA was prepared from the SUP-T1 cells using TRIzol reagent (Life Technologies, Gaithersburg, MD); poly(A)+ RNA was selected using oligo(dT) cellulose (Collaborative Biomedical Products, Bedford, MA); and cDNA was synthesized using oligo(dT) primers and the SuperScript Preamplification System (Life Technologies), according to suppliers’ protocols. For amplification, pools of degenerate primers containing NotI sites (bolded below) were designed based on transmembrane domain (TMD) III and TMD VII amino acid sequences of G protein-coupled receptors from the human sequences for CCR2B, CCR5, CCR3, CCR8, CX3CR1, CXCR4, STRL33, GPR15, APJ, GPR1, and D6. The TMD III primers that yielded the amplified cDNAs described below were 5'-GCGGTGGCGGCCGC(C/G)T(C/G/T)GA(C/T)(A/C)(C/G)IT(A/T)(A/C)T(G/T)(C/G)(A/C/T)I(A/G)GGT, and the TMD VII primers were 5'-GCGGTGGCGGCCGC(G/T)(G/T)(A/C)(A/G)TA(A/C/G)A(G/T)(C/G)AI(A/C/G)GG(A/G)(G/T)(A/T)(C/G)AIGCA. PCR amplifications were done with cDNA synthesized from 0.015 µg poly(A)+ and with 1.5 µM of each primer in a 20 µl reaction volume with Taq polymerase and reagents from Perkin-Elmer (Norwalk, CT), according to the supplier’s protocol. PCR was done using 30 cycles of denaturation at 94°C for 0.5 min, annealing at 45°C for 2 min, and chain extension at 72°C for 1.5 min.
One microliter of this first PCR amplification was used for substrate
in a second PCR done identically to the first. The products of the
second reaction were digested with BamHI to eliminate the
amplified products from CXCR4, which is highly expressed in SUP-T1
cells and which contains an internal BamHI site, and then
separated by electrophoresis on a 1.5% agarose gel. The fragments of
600–650 bp were purified, digested with NotI, and ligated
into pBlueScript (Stratagene, La Jolla, CA). The ligated DNA was used
to transform bacteria that were grown on indicator plates, and white
colonies were picked and grown for sequencing. Using
poly(A)+ RNA prepared from SUP-T1 cells, a cDNA
library was prepared in the 
ZAP Express vector (Stratagene),
according to the supplier’s protocol. Approximately 2.5 x
106 plaques from the nonamplified library were
screened using a radiolabeled CCR9 cDNA probe. Phage from 11 positive
plaques were plaque purified, and the pBK-CMV plasmids containing CCR9
inserts were recovered by in vivo excision, according to the
supplier’s protocol. Nine clones were sequenced either completely or
in part using a Perkin-Elmer ABS Prism 377 automated sequencer,
according to the manufacturer’s protocols.
Construction of CCR9A and CCR9B expression vectors
CCR9A cDNA clone 6 was cut at BsmFI sites at positions 85 and 1351 (see GenBank sequence for CCR9A cDNA, accession number AF145439), ligated to a 5' adapter containing an XhoI site and a 3' adapter containing a SalI site 5' to a BglII site, and then ligated into pCEP4 (Invitrogen, Carlsbad, CA) that had been cut with XhoI and BamHI. CCR9B cDNA clone 3 was cut at BsmFI sites at positions 53 and 1270 (see GenBank sequence for CCR9B cDNA, accession number AF145440) and treated as for CCR9A above. To place the CCR9A/B cDNAs in a vector containing an SV40 origin of replication, they were excised from pCEP4 using XhoI and SalI and inserted into a similarly cut pCI-neo (Promega, Madison, WI). For transfections, plasmid DNAs were prepared by banding twice through CsCl-ethidium bromide gradients.
Cellular transfections
For all transfections of Jurkat-TAg cells, 400 µl of the cells
suspended at 2.5 x 107 cells/ml in RPMI
1640 medium containing 10 mM HEPES was transferred to a cuvette with a
0.4-cm gap (Bio-Rad Laboratories, Hercules, CA), and electroporation
was performed in a Gene Pulser apparatus (Bio-Rad) at room temperature
using 250 V and 960 µF, after which the cells were left at room
temperature for 10 min, diluted to 5 ml with RPMI 1640/10% FBS, and
cultured for 36 h before harvesting for assays for calcium flux or
chemotaxis. For studies on the flow cytometer, cells were transfected
with 40 µg of pCI-neo or pCI-neo/CCR9A or pCI-neo/CCR9B each with 25
µg of pEGFP-F encoding a farnesylated green fluorescent protein and
containing an SV40 origin of replication (Clontech, Palo Alto, CA). For
preparing cells for chemotaxis assays and for using in the fluorescence
spectrometer, the pEGFP-F DNA was omitted and the amounts of the other
DNAs were as stated in the text. For transfections to produce stable
cell lines, pCEP4/CCR9A and pCEP4/CCR9B were used to transfect HEK-293
cells, as described (9), and colonies were selected and
grown using 200 µg/ml hygromycin B (Sigma).
Northern blot analysis
Human tissue blots of poly(A)+ RNA (Clontech) were hybridized and washed according to the supplier’s protocols. For the dot blot not shown, the nonhybridizing samples included poly(A)+ RNA from whole brain, amygdala, caudate nucleus, cerebellum, cerebral cortex, frontal lobe, hippocampus, medulla oblongata, occipital lobe, putamen, substantia nigra, temporal lobe, thalamus, subthalamic nucleus, spinal cord, heart, aorta, skeletal muscle, colon, bladder, uterus, prostate, stomach, testis, ovary, pancreas, pituitary, adrenal, thyroid, salivary gland, breast, kidney, liver, small bowel, spleen, peripheral leukocytes, lymph node, bone marrow, appendix, lung, trachea, placenta, fetal brain, fetal heart, fetal kidney, fetal liver, fetal spleen, fetal thymus, and fetal lung. For analysis of RNA in cell lines and leukocytes, total RNA was prepared using TRIzol (Life Technologies), separated by electrophoresis in a formaldehyde-agarose gel, and transferred onto reinforced nitrocellulose membrane (Optibind; Schleicher & Schuell, Keene, NH). Prehybridization, hybridization, and washing were done as described (24) with final washes in 0.1x SSC, 0.1% SDS at 50°C. 32P-labeled probe for CCR9 was made from the CCR9A/B cDNA fragment corresponding to positions 584-1094 in the CCR9A cDNA, GenBank accession number AF145439, using the random primer-based Megaprime DNA labeling kit (Amersham Pharmacia Biotech, Piscataway, NJ), according to the manufacturer’s protocol, and the probe was used as described (24). Hybridization with an oligonucleotide probe to the 18S rRNA was done as described (25). Autoradiography was done using an intensifying screen.
Determination of expression of mRNAs for CCR9A and CCR9B using PCR
Using 1–5 µg of total RNA, prepared as above, cDNA was synthesized with the SuperScript PreAmplification System (Life Technologies) and diluted in 10–50 µl of water. Sequences of interest were amplified by PCR, using the Takara Taq PCR kit (Takara Shuzo, Otsu, Japan) in reactions containing various amounts of cDNA and 1 µM of each primer in a volume of 20 µl. Amplifications were done using 34 cycles of denaturation at 95°C for 45 s, annealing at 65°C for 1 min, and elongation at 72°C for 1 min. The primers used for amplifying CCR9 sequences were 5'-GTCCCAGG GAGAGTTGCATC (sense) and 5'-TGGCAATGTACCTGTCCACG (antisense), and the predicted products are 500 bp for CCR9A and 451 bp for CCR9B. The primers used for GAPDH were 5'-ACCACCATGGAGAAG GCTGG (sense) and 5'-CTCAGTGTAGCCCAGGATGC (antisense), as previously described (26). PCR products were resolved by electrophoresis on a 2% agarose gel, and the DNA was transferred to Zeta-Probe nylon membrane (Bio-Rad) after base denaturation and neutralization, according to the manufacturer’s protocol. The membrane was prehybridized in 6x SSC, 10x Denhardt’s solution, 20 µg/ml yeast tRNA, 50 µg/ml salmon sperm DNA, and 1% SDS at 50°C for 2 h. Hybridizations were done in 6x SSC and 1% SDS at 50°C overnight with 1–2 million cpm/ml using an oligonucleotide containing sequences common to CCR9A and -B, (5'- GCTGATGACTATGGCTCTGAATCCACATCT) or using a GAPDH oligonucleotide (5'-GTGGAAGGACTCATGACCACAGTCCATGCC) that had been 32P end-labeled using polynucleotide kinase (New England BioLabs, Beverly, MA), according to the manufacturer’s protocol. Membranes were washed at 55°C three times in 6x SSC and 1% SDS for 20 min, followed by one wash in 1x SSC and 1% SDS. Signal intensities were measured using a PhosphorImager and ImageQuant software (Molecular Dynamics, Sunnyvale, CA). cDNA samples were diluted to ranges in which there were linear relationships between input cDNA and signals from the PCR products. For quantitative comparisons among samples, the CCR9 signals were normalized to the signals for GAPDH. Using equal amounts of input, CCR9A and CCR9B cDNAs gave equal amounts of the 500 bp (CCR9A) and the 451 bp (CCR9B) products, demonstrating equal efficiencies in amplifying the two products.
Southern blot analysis of genomic DNA
Twenty micrograms of genomic DNA was isolated from human peripheral blood leukocytes and digested separately with the enzymes HindIII, BamHI, and PstI. The digested fragments were separated by agarose gel electrophoresis and transfered to a Zeta-Probe nylon membrane (Bio-Rad) that was hybridized overnight in 0.25 M sodium phosphate (pH 7.2), 7% SDS at 65°C; washed three times with 20 mM sodium phosphate (pH 7.2), 5% SDS at 65°C for 60 min; and finally washed twice for 60 min in 20 mM sodium phosphate (pH 7.2), 1% SDS, per the supplier’s recommendations. Preparation of probe and autoradiography was done as described above for Northern blotting.
Measurements of calcium flux
Assays on the flow cytometer for measurement of calcium fluxes
in transfected cells and cell lines were done as described
(18). Briefly, cells were washed with HBSS containing
calcium and magnesium, 10 mM HEPES, and 1% FBS (HBSS/FBS) resuspended
at 2 x 107 cells/ml, loaded with the
fluorescent calcium probe indo-1 acetoxymethylester and the detergent
Pleuronic (Molecular Probes, Eugene, OR) at concentrations of 10 µM
and 300 µg/ml, respectively, for 45 min at 30°C with occasional
shaking, followed by two washes in HBSS/FBS buffer. Measurements of
calcium flux were performed on a FACSVantage flow cytometer (Becton
Dickinson Immunocytometry Systems, San Jose, CA) equipped with an argon
laser tuned to 488 nm and a krypton laser tuned to 360 nm with
fluorescence analyzed at 390/20 and 530/20 for
Ca2+-bound and free probe, respectively. For each
stimulation, the cells were kept at room temperature and using a sample
of 0.5 ml of cells, 50 µl of HBSS/FBS was added at 30 s as a
sham injection, followed by injection of 50 µl of HBSS/FBS containing
various concentrations of chemokines. Data were analyzed using the
FlowJo software (Treestar, San Carlos, CA). For some studies, including
those shown in Fig. 5
, CCL25 was a preparation of Ckß-15 obtained
from Human Genome Sciences (Rockville, MD). This recombinant Ckß-15
contained the N-terminal sequence MRGSHHHHHHGSVES, with a histidine
tag, fused to the CCL25 sequence beginning, according to the published
sequence (12), at Val21 and
extending to the C terminus at Leu151 (David
Hilbert, Human Genome Sciences, personal communication). CCL25 used in
the other experiments for which data are shown, and all other
chemokines used in calcium flux and/or chemotaxis assays were obtained
from Peprotech (Rocky Hill, NJ), except for CCL21 (Ckß-9/SLC) and
CCL13 (Ckß-10/MCP-4), which were also obtained from Human Genome
Sciences. The CCL25 provided by Peprotech begins at
Gln24 and extends to the C terminus at
Leu151, according to the supplier’s
specifications, and this protein was more active in our assays than the
preparation from Human Genome Sciences.
|
Chemotaxis assays
Chemotaxis assays were done as described (28), with modifications, using 6.5-mm Transwell tissue culture inserts with a 5 µm pore size (Corning, Corning, NY). Transfected cells and cell lines were suspended at 1 x 107 cells/ml in RPMI 1640 with 0.5% BSA, and 100 µl of cell suspension was added to an insert in a well with 600 µl of medium. After equilibration at 37°C for 2 h, chemokine was added to the wells and the plates were incubated for an additional 90 min before cells were harvested, collected by centrifugation, and counted. Duplicate wells were used for each condition.
Testing an N-terminal peptide from CCR9A as a CCL25 antagonist
A peptide consisting of the N-terminal 12 aa of CCR9A was synthesized (Commonwealth Biotechnologies, Richmond, VA) and dissolved in 1% acetic acid. A total of 3.5 µM CCL25 with and without 3.5 mM peptide was incubated in 0.5% acetic acid at room temperature for 1 h and tested on fura-2-AM-loaded, CCR9A-transfected HEK-293 cells at a concentration of 70 nM CCL25 using a calcium flux assay, as described above.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To identify novel HIV-1 coreceptors and/or chemokine receptors
expressed in the immortalized, CD4+ T cell line,
SUP-T1, we performed RT-PCR with poly(A)+ RNA
prepared from these cells using pools of degenerate primers based on
conserved amino acid sequences in TMD VII and in, and immediately
carboxyl-terminal to, TMD III. Among the initial 100 PCR products
sequenced, in addition to cDNA fragments for CXCR4, which has been
shown to be expressed in SUP-T1 cells (9), we also found a
cDNA fragment corresponding to the gene whose sequence had been
deposited in the database as GPR-9-6 (GenBank accession number U45982)
and that encodes a chemokine receptor-like, orphan G protein-coupled
receptor. As noted above and based on the data presented below, we will
refer to this gene as CCR9 in the remainder of the manuscript.
After Northern analysis verified the expression of the CCR9 mRNA in
SUP-T1 cells (see below), we screened a cDNA library that we had
prepared from these cells using a CCR9 probe to obtain cDNA clones for
functional studies. Nine cDNAs were isolated and four were analyzed in
detail, revealing two types of CCR9 cDNAs that differed in their
predicted coding sequences. Two representative cDNAs, clone 6 and clone
3, were sequenced in their entireties and contained 2544 and 2462 bp,
respectively, as depicted in Fig. 1A. The sequences have been
deposited in GenBank with accession number AF145439 for clone 6 and
AF145440 for clone 3. These cDNAs are likely to be close to full
length, since their lengths corresponded to the approximate size of the
major species of CCR9 mRNA, as revealed by Northern analysis (see
below).
|
The differences between the open reading frames in clone 6 and clone 3
were due to a 49-bp insertion in clone 6 with respect to clone 3.
Comparisons of clone 6 and clone 3 sequences with sequences in the
database from an extended region of human chromosome 3 (GenBank
accession number AC005669) revealed that the 49-bp insertion in clone 6
was due to alternative mRNA splicing, as diagrammed in Fig. 1
A, with the predicted initiator codon in clone 6 within an
exon 5.8 kb upstream from the major coding exon. In the genomic
sequence, the 49-bp fragment found in clone 6 is bounded by the
canonical intronic splice acceptor and splice donor dinucleotides. In
addition to the 369-codon open reading frame, clone 6 contained a 5'
nontranslated region of 157 bp and a 3' nontranslated region of 1280
bp, absent the poly(A) tail. In addition to the 357-codon open reading
frame, clone 3 contained a 5' nontranslated region of 112 bp and a 3'
nontranslated region, absent the poly(A) tail, of 1279 bp.
We refer to the protein encoded by clone 6 as CCR9A and that encoded by
clone 3 as CCR9B, and refer to them collectively, when appropriate, as
CCR9A/B. Comparisons between CCR9A/B and related chemokine receptors
and orphan receptors are shown in Fig. 1B. Like other
chemokine receptors, CCR9A/B has an N-terminal region with a high
number of acidic residues, a short and basic third intracellular loop,
and cysteine residues in the N-terminal region
(Cys38 in CCR9A) and the third extracellular loop
(Cys289 in CCR9A) (30). Like many
other G protein-coupled receptors, CCR9A/B has a site for N-linked
glycosylation in the N-terminal region (Asn32 in
CCR9A), conserved cysteines in extracellular loops 1
(Cys119 in CCR9A) and 2
(Cys198 in CCR9A), and the DRY sequence following
TMD III, which mutagenesis studies have found to be important for G
protein coupling (reviewed in Ref. 31). CCR9A/B also
contains a cysteine residue in the carboxyl-terminal region
(Cys337 in CCR9A) that, based on the data for
rhodopsin, the ß2-adrenergic receptor, and
related receptors, is likely to be palmitoylated (reviewed in Ref.
32).
Expression of the CCR9 gene
Fig. 2 shows that there is a single
human gene for CCR9A/B. As noted above, the CCR9 gene was found within
176,968 bp sequenced from chromosome 3 and entered in GenBank under
accession number AC005669. Our cDNAs were included within positions
(3') 3,666-(5') 20,337 of that GenBank entry. None of the other
chemokine receptor or chemokine receptor-related orphan receptor genes
that are located on chromosome 3 was found within this sequence.
|
, A shows high level
expression of the CCR9 gene limited to the thymus, with relatively low
level expression also in spleen. The major species of CCR9 mRNA is
2.6 kb. On a longer exposure of the blot in Fig. 3A and
on other blots not shown, faint signals could be detected in PBL or
PBMC, which were not increased after activation with PHA and IL-2. Fig. 3B demonstrates, as noted above, that CCR9 is expressed in
the CD4+ T cell lines SUP-T1 and MOLT-4 clone 8
without detectable expression in several other T cell or monocytic
lines or in monocyte-derived macrophages. CCR9 expression was also not
detected in the NK cell lines NK3.3 and YT, or in a line of
EBV-transformed B cells, or in cord blood T cells that had been
differentiated into Th1 or Th2 cell lines (not shown). Of note, thymus
contains minor CCR9 mRNA species of 6 and 8.5 kb, not well seen in
Fig. 3B, that are not found in MOLT-4 clone 8 cells.
|
A,
CD4+CD8+ thymocytes
expressed significantly higher levels of CCR9 as compared with other
thymocyte subpopulations. As detailed in Materials and
Methods, while the preparation of
CD4+CD8+ cells was
extremely pure, the preparations of single-positive cells contained up
to 20% CD4+CD8+ cells as
well, so that the levels shown for single-positive cells are most
likely overestimates. To analyze the relative expression of mRNA
encoding CCR9A vs CCR9B in thymocytes and other cells, we designed PCR
primers that would yield products of 500 and 451 bp from CCR9A and
CCR9B cDNAs, respectively. As shown in Fig. 4B, CCR9A mRNA
was expressed uniformly at 10-fold higher levels as compared with
CCR9B cDNA in thymocyte subsets as well as in PBMC and T cell
lines.
|
cDNA fragments encoding CCR9A and CCR9B were inserted downstream
of the CMV immediate-early promoter in the vector pCI-neo, which
contains an SV40 origin of replication. pCI-neo, pCI-neo encoding
CCR9A, and pCI-neo encoding CCR9B were each cotransfected with the
plasmid pEGFP-F, which contains an SV40 origin of replication and
sequences encoding a farnesylated and codon-optimized green fluorescent
protein (33), into Jurkat-TAg cells, which express the
SV40 large T Ag (21). pEGFP-F DNA was included to identify
cells expressing protein from the transfected DNAs on the flow
cytometer. Approximately 36 h after transfection, the cells were
loaded with the ratiometric fluorescent calcium probe indo-1
acetoxymethyl ester and tested for responses to a collection of
chemokines using a flow cytometer-based calcium flux assay
(18). As shown in Fig. 5,
the chemokine CCL25 produced a calcium flux on the CCR9A and, to a
lesser extent, on the CCR9B-transfected cells, but not on the cells
transfected with the unmodified pCI-neo vector. Calcium responses to
CCL25 were seen only in the GFP-bright cells, consistent with
detectable responses being confined to those cells likely to be
expressing the highest levels of CCR9A and CCR9B from the cotransfected
DNAs. CXCL8 (IL-8) was used as a negative control and produced no
signals. As expected from the known expression of CXCR4 in Jurkat cells
(9, 34), CXCL12 (SDF-1) produced signals on the
pCI-neo-transfected control cells and equally on both the
GFP-negative/low and the GFP-high cells. Similarly, responses to
ligands for CCR4, CCR7, and CXCR3 were seen that were not specific for,
or enhanced, on the CCR9A or the CCR9B-transfected cells (not
shown).
In addition to experiments on the flow cytometer with cells
cotransfected with CCR9A/B and GFP plasmids, Jurkat-TAg cells were also
transfected with CCR9A and CCR9B plasmids alone and analyzed for
calcium fluxes on a ratio fluorescence spectrometer after the cells had
been loaded with fura-2 acetoxymethyl ester. Transfected cells analyzed
on the fluorometer responded to CCL25, and as with the experiments on
the flow cytometer, there were no specific responses on the CCR9A- or
CCR9B-transfected cells to chemokines other than CCL25. CCR9A- and
CCR9B-mediated responses to chemokines were also analyzed using CCR9A-
and CCR9B-transfected HEK-293 cell lines. Besides CXCL12 (SDF-1), which
signals on the parent HEK-293 cells, only CCL25, and not CCR4, CCR7, or
CXCR3 ligands, which gave responses on the control-transfected
Jurkat-TAg cells, produced signals on the CCR9A- or CCR9B-expressing
lines (not shown). The results from testing the transfected Jurkat-TAg
cells, which were done using the largest number of chemokines, are
shown in Table I.
|
, the levels of
the maximal calcium signals were dependent on the amounts of DNA used
for the transfections. Also as shown, independent of the amount of DNA
used and the level of maximal signals, the EC50
for CCL25 was consistently lower on the CCR9A-expressing as compared
with the CCR9B-expressing cells, even though at the highest
concentrations of CCL25 we could demonstrate equal, maximal responses
for the two receptors, all suggesting that the receptors showed
differences in signaling that were not due to differences in receptor
expression. Our concern that the EC50 might fall
at higher levels of receptor expression was unfounded, since in fact,
the EC50 with both CCR9A and CCR9B tended to rise
slightly with transfections done using greater amounts of DNA. Fig. 6E demonstrates that, as expected from the mRNA expression
data, the MOLT-4 clone 8 cells responded to CCL25. The
EC50 for CCL25 on MOLT-4 clone 8 cells was 25
ng/ml, close to that found for the CCR9A-transfected Jurkat-TAg cells,
consistent with the predominant expression of CCR9A on these cells
(Fig. 4B).
|
, we demonstrated that this was the
case. For example, following stimulation of cells expressing CCR9A with
100 ng/ml CCL25, the subsequent addition of 1000 ng/ml did not produce
a detectable signal. In contrast, CCR9B-expressing cells responded
comparably to CCL25 after both the initial stimulation with 100 ng/ml
and the subsequent stimulation with 1000 ng/ml. Of note, just as for
the transiently transfected Jurkat cells, the CCR9A-expressing HEK-293
cells responded to lower concentrations of CCL25 than did the cells
expressing CCR9B.
|
Migration of CCR9A- and CCR9B-expressing cells to CCL25
We analyzed the migration of Jurkat-TAg cells transfected with
pCI-neo and pCI-neo encoding CCR9A and CCR9B, as well as MOLT-4 clone 8
and SUP-T1 cells in response to varying concentrations of CCL25, using
porous Transwell tissue culture inserts to separate the cells in the
upper chambers from the chemokine-containing medium in the lower
chambers. As shown in Fig. 8, the CCR9A-
and CCR9B-transfected cells as well as MOLT-4 clone 8 and SUP-T1 cells,
but not the control-transfected Jurkat-TAg cells, migrated in response
to CCL25 in a dose-dependent fashion, with decreased migration at the
highest concentration of chemokine, producing the expected bell-shaped
curve. Consistent with our calcium flux data shown in
Figs. 5–7,
CCR9A-expressing cells were more responsive to CCL25 than cells
expressing CCR9B, responding at lower concentrations of CCL25 and
showing a more dramatic falloff in migration at a CCL25 concentration
of 2000 ng/ml. The CCR9A-transfected cells showed dose responses for
chemotaxis to CCL25 that were close to those seen for the MOLT-4 clone
8 and SUP-T1 cell lines. Chemotaxis experiments using cells transfected
with varying amounts of DNA showed that approximately twice as much
CCR9B as compared with CCR9A DNA was required to produce cells
migrating in equivalent numbers (not shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-activated THP-1 cells
(12). Consistent with the expression pattern for CCL25 and
its activity on thymocytes, we have found the CCR9 gene to be highly
expressed in thymus, with detectable but much lower expression in
spleen and PBL. We did not detect expression of CCR9 mRNA in human
intestine or appendix by dot blot (Fig. 3A), or in
IFN--activated monocyte-derived macrophages, or in monocyte-derived
dendritic cells by RNase protection assay (not shown). Because of
possible differences between mice and humans and between the origins
and culture conditions for primary cells, and because of the limits of
detection in our probing for mRNA, our data do not definitively
demonstrate any discrepancies between published reports of CCL25
responsiveness and CCR9A/B expression that would suggest another CCL25
receptor(s); and despite testing an extensive collection of chemokines,
we have no indication that there are additional ligands for CCR9A
and/or CCR9B. The high and relatively selective expression of the CCR9 gene and CCL25 in the thymus raises the obvious question as to whether this receptor/ligand pair is involved in stem cell recruitment to, or thymocyte migration within or out of, the thymus. There is evidence that stem cell recruitment to the thymus and migration of thymocytes within and possibly out of the thymus require G protein activation. Pertussis toxin, which inactivates chemokine receptor-coupled G proteins of the Gi family, can block T cell precursor migration across a filter to repopulate precursor-depleted mouse embryonic thymic lobes (14); and transgenic mice expressing the catalytic subunit of pertussis toxin under control of the lck promoter show accumulation of mature T cells in the thymus, with T cell depletion of secondary lymphoid organs (35). Recent work has shown that pertussis toxin leads to the accumulation of single-positive cells in the thymic cortex (36), and the failure of these cells to move to the medulla could underlie the inability of the thymocytes expressing the pertussis toxin transgene to emigrate. These results implicating Gi proteins in thymocyte migration suggest a role for chemokine receptors and their ligands.
A large number of chemokines, including members of the CC, CXC, and C subfamilies, along with their receptors, have been reported to be expressed in the thymus. Among the chemokine receptors expressed prominently in the thymus are CXCR4 (37, 38, 39), CCR4 (40), CCR8 (41, 42), and CCR7 (36, 43). Recent studies have begun to investigate systematically chemokine responsiveness and chemokine receptor expression among thymocyte subsets (36, 43). In mice, CCR4 and responsiveness to CCR4 ligands have been found predominately on cells following positive selection, which have up-regulated CD69, while expression of CCR7 and responsiveness to CCR7 ligands are acquired as thymocytes become fully mature (36, 43), suggesting that these receptors might be important in migration of thymocytes across the corticomedullary junction.
Responsiveness to CCL25 has been found to extend from double-positive cells through the single-positive, CD69+ subset, disappearing on the mature single-positive cells (43). In a separate analysis of chemokine mRNA expression in MHC II+ epithelium from mouse fetal thymus as compared with nonthymic tissue, CCL25 was unusual in being preferentially expressed in thymic epithelium, and CCL25 was a chemoattractant for fetal day 14 thymic precursors (14). Nonetheless, in these same studies, Abs to CCL25 failed to block trans-filter migration of precursor cells to repopulate precursor-depleted mouse embryonic thymic lobes (14). These results do not, however, rule out a role for CCR9A/B in stem cell recruitment, since there may be an as yet unidentified CCR9A/B ligand(s).
Our data on CCR9A/B expression on thymocyte subsets are consistent with
the published descriptions of subset responses to CCL25. We found
expression on double-negative/CD4dull cells,
which represent the precursors of the double-positive thymocytes
(23), consistent with the responses to TECK seen for
immature mouse thymocytes (14). However, we found the
highest expression of CCR9A/B on
CD4+CD8+ thymocytes (Fig. 4A). This suggests that CCR9 and its ligand are involved in
events subsequent to recruitment of cells to the thymus and is
consistent with the observations that CCL25 is expressed not only by
fetal thymic epithelial cells, but also by medullary dendritic cells.
Together, the data on receptor and ligand expression raise the
possibility that CCR9 promotes the movement of double-positive
thymocytes to contact epithelial and dendritic cells during migration
from cortex to medulla, and is therefore important for that migration
and/or for the processes of positive and negative selection, which
depend on these interactions. Because single-positive thymocytes show
much-diminished expression of CCR9 and PBL express little CCR9 on
average, it is also possible that CCL25/CCR9 are involved in retaining
cells in the thymus until maturation is complete. Finally, it is worth
considering that CCL25/CCR9 may be involved in providing signals for
thymocyte maturation in ways not limited to effects on cell
movement.
We have shown that both SUP-T1 and MOLT-4 clone 8 cells express the CCR9 gene and respond to CCL25. The SUP-T1 line was derived from a child with T cell non-Hodgkin’s lymphoma (44), and the MOLT-4 line was derived from a young adult with acute lymphoblastic leukemia (45). The very high level of expression of CCR9 mRNA and CCR9A/B function on MOLT-4 clone 8 cells raises the possibility that the CCR9 gene has been amplified in these cells and that the expression of the receptor, through autocrine activities of CCL25 or otherwise, might confer some growth advantage.
MOLT-4 clone 8 and SUP-T1 cells have been used in HIV research, since they readily form syncytia with many isolates. It is possible that the abilities of some HIV-1 (and/or SIV) variants to infect SUP-T1 and MOLT-4 clone 8 cells are due to the cells’ expression of CCR9A/B, and analysis of coreceptor function for these receptors is ongoing.
Of particular interest is our cloning of cDNAs that reflect alternative splicing of CCR9 mRNA, giving rise to two forms of the receptor that differ by 12 aa in the N-terminal region. Although the coding regions of chemoattractant receptor genes are often found on single exons, there are now many examples of exceptions to this rule, including, for example, the genes for CCR2 (46), CCR6 (7), CCR7 (47), CXCR4 (37, 48), and CXCR5 (49). Alternative splicing is well described as a mechanism of generating diversity among G protein-coupled receptors, resulting in changes in the C termini and intracellular loops as well as truncated receptors, sometimes resulting in changes in receptor activities (reviewed in Ref. 50). Among chemokine receptors, alternative splicing produces two forms of human CCR2, CCR2A and CCR2B, which differ in their C-terminal regions (51), and two forms of mouse CXCR4, which differ by 2 aa within the N-terminal region (52, 53). However, with the exception of a recently described serotonin receptor in Caenorhabditis elegans (54), we are not aware of other examples of alternative splicing producing variants of a G protein-coupled receptor with the magnitude of the N-terminal difference found for CCR9A and CCR9B.
While this manuscript was under revision, a report appeared describing
a human CXCR4 RNA of 4 kb that was predicted to encode a novel
receptor that differs at its N terminus as compared with that encoded
by the major 1.7-kb mRNA species (55). This novel form of
CXCR4, termed CXCR4-Lo, is predicted to lack the five N-terminal
residues found in the standard sequence and to contain nine other
residues in their places, and was reported to have an
EC50 3-fold that of the standard receptor. The
CXCR4-Lo mRNA does not represent an alternatively spliced form, but an
mRNA with a retained intron, producing a species with more than 2 kb of
additional 5' nontranslated sequence as compared with the mRNA for
CXCR4. The presence of both multiple upstream AUGs in the CXCR4-Lo RNA
as well as a particularly unfavorable context for the postulated start
codon for CXCR4-Lo according to the rules described by Kozak
(29) suggest that CXCR4-Lo will not be translated
efficiently from the 4-kb RNA, and raise questions about its biological
significance. Kozak has noted that such incompletely processed mRNAs
are particularly common in lymphocytes and that mRNA processing might
therefore be a mechanism used in lymphocytes to regulate translation
(56).
With regard to activities for chemokine receptor variants arising from
alternative splicing, functional studies have not revealed differences
in the responses to ligands between the two forms of CCR2 (46, 51) or the variants of mouse CXCR4 (48, 52). It is
therefore of particular note that we have demonstrated functional
differences between CCR9A and CCR9B. Our experiments using calcium flux
assays with both transiently transfected Jurkat cells and stably
transfected HEK-293 cell lines showed that the
EC50 of CCL25 for CCR9A is lower than for CCR9B
and similarly that CCR9A is desensitized at lower concentrations of
CCL25 as compared with CCR9B, indicating that CCR9A is the more
efficient receptor. Consistent with our findings in the calcium flux
assays, CCR9A also appeared superior to CCR9B in mediating chemotaxis,
although the analysis here was less extensive. It is likely that the
longer N-terminal region on CCR9A as compared with CCR9B produces a
receptor with enhanced affinity for CCL25, although we have not yet
measured the affinity directly. Because receptor in the active
conformation is the target for the kinases that inactivate G
protein-coupled receptors (57), lower affinity of CCR9B
for CCL25 would be a straightforward explanation for the relative
insensitivity of CCR9B to homologous desensitization (Fig. 7).
We have analyzed the relative levels of mRNAs for CCR9A and CCR9B on
thymocyte subsets, cell lines, and PBMC. As shown in Fig. 4B, both forms were expressed in the primary cells as well
as in the cell lines, and the ratios of these alternatively spliced
forms were 10:1 in all samples tested. The expression of mRNAs for
both CCR9A and CCR9B in cell lines and the invariant ratio of the two
forms in preparations of primary cells suggest that both forms are
coexpressed on individual cells. These data raise the
question as to the advantage of a cell expressing both the A and the B
forms of the receptor. Although we have no evidence for a ligand for
CCR9A/B other than CCL25, it is possible that there are other ligands
for these receptors, or perhaps alternative forms of CCL25, that show
greater differences in their activities on CCR9A and CCR9B than we have
documented using our preparation of rCCL25. It is also possible that
there are qualitative differences in signaling pathways activated by
CCL25 on CCR9A vs CCR9B. Of course, it may be that the two receptors
are only distinguished functionally by the quantitative differences
that we have documented.
Although the advantage of a sensitive receptor would seem obvious in allowing a cell to respond to ligand gradients at a distance from the ligand source, the role of a coexpressed insensitive receptor is less clear. In this regard, our data on receptor desensitization may be particularly informative, since it demonstrates that CCR9B could enable a cell to respond to a change in ligand concentration at concentrations in which CCR9A is inactive. Together, the two receptors would extend the conditions under which a cell could respond to CCL25 beyond what could be achieved with a single receptor. This might be advantageous for trafficking as a cell moves up a gradient of CCL25, or it might enable a cell that has come to rest at a site with a high CCL25 concentration to react in other ways to a local release of CCL25. Our data suggest a novel mechanism for expanding the range of concentrations over which a cell can respond to increments in the concentration of chemokine.
While this manuscript was under review, Zaballos et al. (58) reported that GPR-9-6 is a receptor for TECK/CCL25 and designated the receptor CCR9. The sequence of the cDNA that they reported and used in their studies corresponds to our CCR9A. The major additional data provided by our work are the identification of CCR9B and the characterization of expression and activity of CCR9B as compared with CCR9A, demonstrating the existence of CCL25 receptors that differ in their sensitivities to ligand and showing expression of both forms in human thymocytes, with highest levels in CD4+CD8+ cells. It is of interest that the mouse sequence reported by Zaballos et al. (58), which shows 86% identity with the human receptor, contains the CCR9A Met13, suggesting that CCR9B may exist in mice as well as in humans.
Data accumulating from many studies suggest that chemokine receptors expressed on lymphocytes function preferentially at particular stages in the life of a T cell (3, 18). The information that has accumulated to date has been primarily related to mature T cells, both for homeostatic trafficking of naive cells and for the trafficking of memory/effector cells, particularly those activated and differentiated down Th1 and Th2 pathways. Although circumstantial evidence also suggests that the chemokine system has roles in the earlier stages of T cell development, there is as yet no proof of this supposition. The description and characterization of CCR9A and CCR9B as receptors for CCL25 will provide tools to address the question directly, since the high and preferential expression of CCL25 and CCR9A/B in the thymus suggest that these particular components of the chemokine system are likely to play important roles in thymocyte migration and/or in T cell development. If this speculation is borne out, it will expand our understanding of the breadth of the involvement of the chemokine system in T cell biology and contribute to the emerging appreciation that, rather than being a collection of molecules with redundant activities, individual chemokines and their receptors play dedicated roles in establishment and maintenance of immune functions.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Abbreviations used in this paper: CCL, CC chemokine ligand; Ckß, chemokine ß; CXCL, CXC chemokine ligand; GFP, green fluorescent protein; HEK, human embryonic kidney; SDF-1, stromal cell-derived factor-1; TECK, thymus-expressed chemokine; TMD, transmembrane domain.
Received for publication May 7, 1999. Accepted for publication November 22, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. Biochem. Biophys. Res. Commun. 236:212.[Medline]
. J. Immunol. 162:186. with patterns of tissue expression that suggest nonredundant roles in vivo. J. Immunol. 157:4511.[Abstract]
is a ligand for both CXC chemokine receptor- 4 isoforms. J. Immunol. 158:3561.[Abstract]
activation of Gi2 are differentially expressed in vivo. Eur. J. Immunol. 27:2102.[Medline]
This article has been cited by other articles:
|
|
 |
|
  C.-R. Yu, R. M. Mahdi, X. Liu, A. Zhang, T. Naka, T. Kishimoto, and C. E. Egwuagu SOCS1 Regulates CCR7 Expression and Migration of CD4+ T Cells into Peripheral Tissues J. Immunol., July 15, 2008; 181(2): 1190 - 1198. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Ehlert, C. A. Addison, M. D. Burdick, S. L. Kunkel, and R. M. Strieter Identification and Partial Characterization of a Variant of Human CXCR3 Generated by Posttranscriptional Exon Skipping J. Immunol., November 15, 2004; 173(10): 6234 - 6240. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Qiuping, X. Jei, J. Youxin, J. Wei, L. Chun, W. Jin, W. Qun, L. Yan, H. Chunsong, Y. Mingzhen, et al. CC Chemokine Ligand 25 Enhances Resistance to Apoptosis in CD4+ T Cells from Patients with T-Cell Lineage Acute and Chronic Lymphocytic Leukemia by Means of Livin Activation Cancer Res., October 15, 2004; 64(20): 7579 - 7587. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Garin, N. Tarantino, S. Faure, M. Daoudi, C. Lecureuil, A. Bourdais, P. Debre, P. Deterre, and C. Combadiere Two Novel Fully Functional Isoforms of CX3CR1 Are Potent HIV Coreceptors J. Immunol., November 15, 2003; 171(10): 5305 - 5312. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Qiuping, L. Qun, H. Chunsong, Z. Xiaolian, H. Baojun, Y. Mingzhen, L. Chengming, H. Jinshen, G. Qingping, Z. Kejian, et al. Selectively Increased Expression and Functions of Chemokine Receptor CCR9 on CD4+ T Cells from Patients with T-Cell Lineage Acute Lymphocytic Leukemia Cancer Res., October 1, 2003; 63(19): 6469 - 6477. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. K. Park, D. Amichay, P. Love, E. Wick, F. Liao, A. Grinberg, R. L. Rabin, H. H. Zhang, S. Gebeyehu, T. M. Wright, et al. The CXC Chemokine Murine Monokine Induced by IFN-{gamma} (CXC Chemokine Ligand 9) Is Made by APCs, Targets Lymphocytes Including Activated B Cells, and Supports Antibody Responses to a Bacterial Pathogen In Vivo J. Immunol., August 1, 2002; 169(3): 1433 - 1443. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Pedroza-Martins, W. J. Boscardin, D. J. Anisman-Posner, D. Schols, Y. J. Bryson, and C. H. Uittenbogaart Impact of Cytokines on Replication in the Thymus of Primary Human Immunodeficiency Virus Type 1 Isolates from Infants J. Virol., June 14, 2002; 76(14): 6929 - 6943. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Zaitseva, T. Kawamura, R. Loomis, H. Goldstein, A. Blauvelt, and H. Golding Stromal-Derived Factor 1 Expression in the Human Thymus J. Immunol., March 15, 2002; 168(6): 2609 - 2617. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Uehara, A. Grinberg, J. M. Farber, and P. E. Love A Role for CCR9 in T Lymphocyte Development and Migration J. Immunol., March 15, 2002; 168(6): 2811 - 2819. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Uehara, K. Song, J. M. Farber, and P. E. Love Characterization of CCR9 Expression and CCL25/Thymus-Expressed Chemokine Responsiveness During T Cell Development: CD3highCD69+ Thymocytes and {gamma}{delta}TCR+ Thymocytes Preferentially Respond to CCL25 J. Immunol., January 1, 2002; 168(1): 134 - 142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Papadakis, J. Prehn, V. Nelson, L. Cheng, S. W. Binder, P. D. Ponath, D. P. Andrew, and S. R. Targan The Role of Thymus-Expressed Chemokine and Its Receptor CCR9 on Lymphocytes in the Regional Specialization of the Mucosal Immune System J. Immunol., November 1, 2000; 165(9): 5069 - 5076. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. M. Murphy, M. Baggiolini, I. F. Charo, C. A. Hebert, R. Horuk, K. Matsushima, L. H. Miller, J. J. Oppenheim, and C. A. Power International Union of Pharmacology. XXII. Nomenclature for Chemokine Receptors Pharmacol. Rev., March 1, 2000; 52(1): 145 - 176. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
indicates that the single-positive
populations also contained other subsets, as described in
Materials and Methods. The asterisk indicates that the
level of CCR9A in the CD4+CD8+ preparation was
greater than that in other thymocyte subsets (p <
0.01, t test). Thymocytes and PBMC were each from a
single donor. B, The ratio of CCR9A and CCR9B mRNAs is
uniform among cell types expressing CCR9. Using the same cDNA as for
A, CCR9A and CCR9B sequences were amplified and
detected, as described in Materials and Methods. An
autoradiogram is displayed above, and quantification based on
PhosphorImager data is shown below. For both A and
B, results are averaged from three PCR
experiments.
