| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Tumor Immunology Program and,
Applied Tumorvirology, German Cancer Research Center, Heidelberg, Germany; and
The Ben May Institute for Cancer Research, University of Chicago, Chicago, IL 60637
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Both caspase-8 and FADD are essential for CD95-induced apoptosis as FADD-deficient thymocytes or caspase-8-deficient cells do not undergo apoptosis following CD95 triggering (12, 13, 14). FADD is essential for CD95-induced apoptosis as FADD-deficient thymocytes do not undergo apoptosis following CD95 triggering (12). FADD also seems to be involved in apoptosis induction by other death receptors. It has been reported that overexpression of C-FADD also inhibits TNF-RI and DR3-induced apoptosis (6, 15).
In addition, FADD is not only involved in death receptor signaling of apoptosis as thymocytes and peripheral T cells from transgenic mice expressing C-FADD under the control of the proximal lck promoter show a defect in activation-induced proliferation (16, 17, 18). Similarly, FADD-/- T cells in chimeric mice of the RAG-1-/- background also show impaired proliferation following activation (12). Therefore, FADD also seems to play a role in T cell development and activation. Furthermore, in contrast to death receptor-deficient mice, FADD-/- mice die in utero, suggesting a role for FADD in embryonic development (12, 19).
Both human and murine FADD have been shown to be phosphorylated at serine residues (3, 20). Here we show that human FADD is exclusively phosphorylated at the C-terminal serine 194 and that this phosphorylation is regulated dependent on the cell cycle.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The Burkitt lymphoma BJAB was cultured in RPMI 1640, 10% FCS, 50 mM HEPES, and 50 µg/ml gentamycin. The embryonic kidney cell line 293T was cultured in DMEM, 10% FCS, 100 mM HEPES, and 50 µg/ml gentamycin.
Abs and reagents
For generation of anti-FADD mAbs, BALB/c mice were immunized four times by injection of 300 µg of purified GST-FADD. Spleen cells from immunized animals were fused with the Ag8 myeloma. 2 wk after fusion culture supernatants from wells positive for growth were tested in an ELISA with His-FADD as coated Ag. Hybridomas that produced anti-FADD mAbs were cloned several times by limited dilution yielding subclones positive for the desired Ab. The Ab used in this study was 1C4 (IgG1). The other anti-FADD mAb (IgG1) used was purchased from Transduction Laboratories (Lexington, Kentucky). The mouse mAb anti-APO-1 (IgG3, k, anti-CD95) recognizes an epitope on the extracellular part of APO-1 (21). The HRP-conjugated goat anti-mouse IgG1 Ab was obtained from Southern Biotechnology Associates (Birmingham, AL). Calf intestine phosphatase was purchased from New England Biolabs (Boston, MA).
Fusion proteins, plasmids, and generation of FADD mutant constructs
Using standard PCR and cloning techniques the following fusion proteins were generated: 6-His-tagged FADD, GST-FADD, GST-N-FADD (amino acids 1–117), and GST-C-FADD (amino acids 80–208). Fusion proteins were expressed and purified as previously described (3). The pcDNA3 plasmid containing FADD or C-FADD cDNA were a kind gift of Dr. Dixit (Genentech, San Francisco, CA). C-terminal deletion mutants of FADD and C-FADD were generated by PCR using the primer TATATCTCGAGTTACCTGTTCTGGAGGT CACGG and a primer binding in the 5' region of the vector and subcloned into pcDNA3 (Invitrogen, San Diego, CA). The FADD S194A mutant was generated using the primer GTGGGGCCATGGCCCCGATGTCATGG and the corresponding complementary primer applied in a QuikChange Mutagenesis Kit (Stratagene, La Jolla, CA).
Metabolic labeling of cells
35S metabolic labeling of BJAB cell was performed essentially as described before (6). For in vivo labeling with [32P]orthophosphate, 1.5 x 107 Jurkat or BJAB cells transfected with empty vector or C-FADD were washed three times with phosphate-free medium (DMEM; Life Technologies, Rockville, MD), resuspended in 3 ml of phosphate-free medium supplemented with 10% dialyzed FCS and 0.5 mCi [32P]orthophosphate and incubated for 4 h at 37°C.
Cell cycle arrest
BJAB cells were treated with 4 mM hydroxyurea (Sigma, St. Louis, MO) or 100 ng/ml nocodazole (Sigma) for 20 h. Cells were washed with PBS once and harvested for analysis by flow cytometry and protein analysis as described below.
Immunoprecipitation and Western blotting
Immunoprecipitation of the CD95 DISC was essentially done as described elsewhere (22, 23). For immunoprecipitation of FADD, 35S-labeled cells were lysed in lysis buffer (30 mM Tris/HCl, pH 7.4, 150 mM NaCl, 1 mM PMSF, and small peptide inhibitors (3), 1% Triton X-100 (Serva, Bay City, MI) and 10% glycerol) and incubated for 1 h at 4°C with 10 µg of 1C4 or anti-FADD precoupled to anti-mouse IgG1 beads (Sigma). Immunoprecipitates were analyzed by two-dimensional IEF-SDS-PAGE as described previously (3) followed by autoradiography. For Western blot detection of FADD, cellular lysates equivalent to 106 cells were separated by one or two-dimensional gel electrophoresis and blotted onto a nitrocellulose membrane (Hybond C; Amersham, Arlington Heights, IL). Blots were blocked with 2% BSA (Boehringer Mannheim, Mannheim, Germany) in TPBS (0.05% Tween 20 in PBS) for 1 h at room temperature. After washing, blots were incubated with anti-FADD mAb (1 µg/ml in TPBS) for 16 h at 4°C. After incubation with secondary Ab (1/20,000 in TPBS), blots were developed using enhanced chemiluminescence (Amersham) following the manufacturers instructions.
Kinase assays
For the in vitro kinase assay, immunoprecipitated AU1-tagged
FADD from transiently transfected 293T cells or 10 µg of GST fusion
proteins precoupled to reduced glutathione (GSH) beads were incubated
with cellular lysates from 107 BJAB cells for
2 h at 4°C. After extensive washing in lysis buffer, beads were
resuspended in kinase buffer (75 mM Tris, pH 7.5, 1% Nonidet P-40,
10 mM MnCl2, 10 mM MgCl2,
10% glycerin, and 100 mM NaCl) containing 0.8 mBq
[
-32P]ATP and incubated for 20 min at
25°C. Beads were washed once in lysis buffer, and proteins were
separated by 12% SDS-PAGE and analyzed by autoradiography and
Coomassie blue staining. In-gel kinase assays were performed as
described (24). Briefly, cellular lysate from 3 x
107 cells was sequentially incubated with the
indicated GST fusion proteins coupled to GSH beads. Beads were washed
extensively, and proteins were separated by SDS-PAGE containing 60
µg/ml copolymerized His-FADD or no substrate.
Transfection of cells
BJAB cells were transfected by electroporation (960 µF, 200 V) using a Gene Pulser (Bio-Rad, Richmond, CA), and single clones were selected in 96-well plates using 4 mg/ml G418 (Sigma) containing medium. Positive clones were identified by Western blot analysis. Transient transfection of 293T cells was done using the calcium phosphate precipitation method.
Flow cytometry
A total of 1 x 106 control or hydroxyurea- or nocodazole-treated cells were incubated with propidium iodide (25), and DNA content was measured by FACScan analysis (Becton Dickinson, San Diego, CA). Ten thousand events were analyzed for each sample.
ELISA
A total of 100 µl of FADD C-terminal peptides as described in
legend to Fig. 4
A (10 µg/ml, diluted in 0.2 M bicarbonate
buffer, pH 9.6) were immobilized on microtiter plates at 4°C for
16 h. Plates were then blocked with RPMI 1640 supplemented with
10% FCS for 1 h at 25°C. After washing three times with TPBS,
10 µg/ml of the anti-FADD mAb 1C4 was added to the first row and
further diluted 1:1. After incubation for 1 h at 25°C, the
plates were washed three times and incubated with HRP-coupled
anti-IgG1 secondary Ab (1:5000 in TPBS) for 1 h at 25°C.
Subsequently, plates were washed three times and developed with
o-phenylenediamine (Sigma; 1 mg/ml, diluted in 0.1 M sodium
citrate buffer, pH 5) and 1 µl/ml perhydrol (Merck, West Point, PA).
Reaction was stopped by adding 3 N sulfuric acid.
|
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We have recently shown that triggering of CD95 leads to the
recruitment of a set of signaling molecules (designated CAP1–6)
forming the DISC (3, 10). These signaling molecules can be
coimmunoprecipitated with activated CD95 and visualized on a
two-dimensional gel (Fig. 1A,
left panel). CAP1 and CAP2 were both identified as FADD
(3), whereby CAP2 represents a serine phosphorylated form.
This was also confirmed by immunoprecipitation with an anti-FADD
mAb from in vivo-phosphorylated cells (Fig. 1B, left
panel). The specific phosphorylation was further confirmed by
treatment of immunoprecipitated CAP2 with calf intestinal phosphatase.
This treatment resulted in a conversion of CAP2 into CAP1 in a
two-dimensional Western blot analysis (data not shown).
|
). We have previously shown that in stably transfected cells
C-FADD is recruited to the activated CD95 receptor, competing for the
binding of endogenous FADD to the DISC and thereby inhibiting apoptosis
(6). To determine whether C-FADD would also be
specifically phosphorylated, we tested BJAB cells stably expressing
C-FADD on two-dimensional gels (Fig. 1
, right panels). In
metabolically 35S-labeled cells, DISC-associated
C-FADD also appeared predominantly as two distinct spots (
CAP1/2),
indicating that it is phosphorylated in a similar way as the wild-type
molecule (Fig. 1B, right panel). To confirm this
assumption, we metabolically labeled cells stably expressing C-FADD
with [32P]orthophosphate to specifically
visualize phosphorylated proteins. In an anti-FADD
immunoprecipitation from these in vivo-labeled cells, only CAP2
could be visualized (Fig. 1B, right panel),
identifying the CAP2 spot as phosphorylated C-FADD. Analysis of the
immunoprecipitated DISC from these cells also showed that both
DISC-associated CAP2 and CAP2 were 32P-labeled
(data not shown), suggesting that both full-length FADD and C-FADD are
phosphorylated in the same way.
|
The results so far indicated that a kinase phosphorylates FADD at
its C-terminal half, affecting the migration of the phosphorylated
molecule on two-dimensional gels. However, only part of FADD is
phosphorylated as nonphosphorylated FADD (CAP1) or C-FADD (CAP1)
could also be detected in all cells. To test if only the C-terminal
half of FADD would be a substrate for phosphorylation, we generated
fusion proteins of GST with either FADD, the N-terminal (GST-N-FADD),
or the C-terminal half of FADD (GST-C-FADD). Incubation of cellular
lysates with these fusion proteins led to the association of a kinase
that phosphorylated GST-FADD and GST-C-FADD in an in vitro kinase assay
(Fig. 2A, lane 5
and 6). GST-N-FADD was not phosphorylated in this assay
(Fig. 2A, lane 6). The data demonstrated that the
C-terminal half of FADD was phosphorylated by a kinase that associated
with FADD and C-FADD in vitro.
|
A,
lanes 8 and 9). Interestingly, this Ab only
detected unphosphorylated FADD (CAP1) when used in an
immunoprecipitation experiment (Fig. 2B, upper right
panel), whereas a control anti-FADD mAb detected both,
nonphosphorylated (CAP1) and phosphorylated (CAP2) FADD (Fig. 2B, upper left panel). The same result was seen
when both Abs were used in a two-dimensional Western blot analysis of
FADD in cellular lysates (Fig. 2B, lower panels).
This suggests that the 1C4 mAb recognizes FADD only in its
unphosphorylated form. Experiments so far have localized the
phosphorylation site of FADD to its C-terminal half. Therefore, we
conclude that the 1C4 mAb reacts with an epitope within the C terminus
of unphosphorylated FADD. Phosphorylation of FADD occurs at a C-terminal serine cluster
We have previously shown that FADD is phosphorylated at serine
residues (3). FADD contains two serine clusters, one
located at the N and one at the C terminus of the molecule (Fig. 3A). To test if the C-terminal
serine cluster indeed contains the phosphorylation site, we generated
deletion mutants of FADD and C-FADD lacking 19 aa at the C terminus
including all seven C-terminal serine residues (designated FADDC and
C-FADDC) (Fig. 3A). These molecules were expressed in
293T cells and analyzed by Western blotting using an anti-FADD mAb
(Fig. 3B, lanes 1–4). In this assay,
phosphorylated and nonphosphorylated FADD can be distinguished by their
different mobilities on the gel by giving rise to two distinct bands
for each FADD and C-FADD (Fig. 3B, lanes 1 and
2). The mutants lacking the C-terminal serine cluster
appeared only as single bands, suggesting that they were no longer
phosphorylated in vivo (Fig. 3B, lanes 3 and
4). To confirm this, we also used the 1C4 mAb for Western
blot detection as this Ab recognized the phosphorylation site of FADD
(Fig. 3B, lanes 5–8). Both C-terminal deletion
mutants were not detected by this Ab, whereas nonphosphorylated species
of FADD and C-FADD could be readily visualized. These experiments
identify the C-terminal serine cluster of FADD as the site of
phosphorylation and establish 1C4 as a phosphorylation
site-specific Ab.
Identification of the FADD phosphorylation site
Because CAP1 and CAP2 were also found in the DISC of murine L929
cells (10), we assumed that the phosphorylation site was
conserved between mouse and man. Of the seven serine residues located
at the C terminus of FADD, five are conserved between the two species
(Fig. 4A). To map the
phosphorylation site exactly, we generated five peptides in which these
five serine residues were individually replaced by glutamic acid to
mimic phosphorylated serine. Then, 1C4 was tested in an ELISA
experiment for reactivity for these peptides. Three of the tested
peptides (Pep S200E, S203E, S205E) were efficiently recognized by 1C4
(Fig. 4B), and peptide Pep S190E gave a weak signal with
1C4. However, Pep S194E was not recognized at all by the 1C4 Ab,
suggesting that phosphorylation of serine 194 prevents binding of 1C4
(Fig. 4A). To confirm this conclusion we generated a C-FADD
molecule in which we replaced serine 194 by alanine. A Western blot
analysis of cellular lysates of 293T cells transiently transfected with
either C-FADD or C-FADD S194A demonstrated that C-FADD S194A was not
recognized by 1C4 anymore (Fig. 4C), confirming the results
of the peptide ELISA. The mutated C-FADD did also not serve as a kinase
substrate in an in vitro kinase assay (Fig. 4D), indicating
that serine 194 is the only site in the molecule that can be
phosphorylated. To finally prove that FADD lacking just one hydroxyl
group (after an serine-alanine replacement) would not be phosphorylated
in vivo anymore, a BJAB cell line was generated stably expressing
C-FADD S194A (Fig. 4E). A Western blot analysis with the
commercial anti-FADD Ab that recognizes both unphosphorylated and
phosphorylated FADD showed that in this transfectant C-FADD S194A only
migrated at the position of unphosphorylated C-FADD (Fig. 4E, lane 2). Taken together, the data demonstrate
that in vivo FADD is specifically phosphorylated at only one serine
residue at position 194.
Phosphorylation of FADD by an associated 70-kDa kinase
To characterize the kinase that phosphorylates FADD, we performed
an in-gel kinase assay. In this assay, proteins associated with the
GST-FADD constructs after incubation with cellular lysates from
BJAB cells were separated by SDS-PAGE followed by a denaturing step.
Subsequently, proteins within the gel were slowly renatured, and
kinases were identified by incubating the gel in a kinase buffer
containing [-32P]ATP. To control for
specificity, we used a gel without (Fig. 5A, lanes 1–4) or
with (Fig. 5A, lanes 5–8) FADD as copolymerized
substrate. Using this assay, we identified a kinase of 
70 kDa that
associated only with FADD and C-FADD and that was specific for
the phosphorylation of the copolymerized substrate FADD (Fig. 5A, lanes 7 and 8). A phosphorylated
band of the same size was also found to associate with endogenous FADD
in in vivo-phosphorylated BJAB cells (Fig. 5B).
|
As FADD plays an essential role in the signal transduction of
CD95, we investigated the role of the phosphorylation of FADD in this
function of the molecule. It has been shown that overexpression of FADD
results in apoptosis induction, presumably by nonphysiological
aggregation of the molecule (26). We could not detect any
significant difference in apoptosis induction by transient
overexpression of FADD or FADDC in 293T cells (data not shown). As
this system may not reflect the physiological function of FADD, we
generated cells stably expressing C-FADD and C-FADDC and analyzed
them for their sensitivity to CD95-mediated apoptosis. Consistent with
our previous data (6), C-FADD-expressing cells were
resistant to CD95-induced apoptosis. Cells expressing similar amounts
of C-FADDC also showed the same degree of apoptosis resistance.
Similar to C-FADD, C-FADDC was also recruited to the activated CD95
receptor competing for binding of endogenous FADD (data not shown).
These data suggest that phosphorylation of FADD does not play a major
role in the induction of apoptosis by CD95.
In addition to its role in death receptor signaling, FADD has been implicated in T cell proliferation (12, 16, 17, 18). The mechanism of this action remains to be defined. However, it was shown that this activity of FADD was not detectable in constantly cycling tumor cells (16). These published data would indicate that in addition to its function in death receptor-mediated apoptosis, FADD is important for cell cycle entry of resting T cells. Furthermore, it was then shown that this inhibition requires functional p53 because in transgenic mice expressing FADD-DN in the T cell compartment the resistance of T cells to mitotic expansion was prevented in the p53 knockout background (17). These data suggest that one activity of FADD may be linked to regulation of the cell cycle.
Therefore, we tested whether phosphorylation of FADD would be subject
to cell cycle regulation. BJAB vector transfectants (Fig. 6A, lanes 1–3) and
BJAB stably expressing C-FADD (Fig. 6A, lanes
4–6) were arrested at G1/S or G2/M
transitions of the cell cycle by treating the cells for 24 h with
hydroxyurea or nocodazole, respectively. FACS analysis confirmed that
both treatments resulted in arrested cells (Fig. 6A,
upper panels). Analysis of the FADD phosphorylation status
showed that cells arrested at G1/S with hydroxyurea
predominantly contained unphosphorylated FADD and C-FADD, respectively.
In contrast, in cells arrested at G2/M, both FADD and
C-FADD were quantitatively phosphorylated. The same result was obtained
when cell were arrested at G1/S with a double thymidine
block or at G2/M with taxol (data not shown).
|
B). Again, in addition to
phosphorylated FADD, an associated phosphorylated protein band of 70
kDa was detected. This band was almost absent in the cells arrested
with hydroxyurea (Fig. 6B, lane 2). We then tested whether classical members of the cdk/cdc family would accept FADD as a substrate. We used recombinant cdc2/cyclin A, cdk2/cyclin A, cdc2/cyclin B1, and cdk2/cyclin E to phosphorylate FADD in in vitro kinase assays. However, none of these kinases that are active at the G2/M boundary could phosphorylate FADD (data not shown). This is consistent with the fact that the putative FADD kinase identified in an in-gel kinase assay that associated with FADD and accepted FADD as an in vitro substrate was 70 kDa in size, whereas all of the cdc/cdk kinases are in the range of 33–35 kDa. Treatment of cells with wortmannin did not change the CAP1-to-CAP2 ratio, making it unlikely that phosphatidylinositol 3'-kinase is involved in the regulation of FADD phosphorylation. In addition, we can rule out protein kinase C because treatment with PMA did not increase the amount of phosphorylated FADD. Furthermore, recombinant casein kinase II also failed to phosphorylate FADD in vitro (data not shown). In summary, our data suggest that during progression during the cell cycle FADD undergoes specific phosphorylation somewhere between G2 and M phase at serine 194 by an unknown cell cycle-regulated kinase of 70 kDa.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C into
FADD-negative Jurkat cells that were generated in the same way as the
previously described caspase-8-negative Jurkat cells (30).
These reconstituted cells were equally sensitive to CD95-mediated
apoptosis (data not shown), confirming the conclusion that
phosphorylation of FADD does not play a role in CD95 apoptosis
signaling. In summary, the kinase responsible for the phosphorylation
of FADD does not seem to be involved in CD95 signaling. Upon overexpression, FADD was shown to associate through the TNFR-associated DD protein (TRADD) (31) with TNF-RI (32) and DR3 (15), and embryonic fibroblasts from FADD-/- mice were resistant to apoptosis induced by overexpression of TNF-RI and DR3, demonstrating that FADD is an essential part of the TNF-RI and DR3 signaling machinery (19). Furthermore, FADD was also suggested to be associated with TRAIL receptors (28, 29, 33). Therefore, our data do not exclude the possibility that phosphorylation of FADD is important for the signal transduction of other death receptors because the signaling machinery used by these receptors may be similar, yet not identical with the one of CD95. In the case of TNF-RI, no direct TNF-dependent interaction of FADD with the adapter molecule TRADD or with TNF-RI has been demonstrated so far (34). Therefore, the mechanism of how FADD is involved in transducing the TNF-RI signal seems to be different and may require phosphorylation of FADD.
FADD is phosphorylated at serine 194, which is part of a C-terminal cluster of seven serine residues. In cells stably transfected with C-FADD, the vast majority of FADD is specifically phosphorylated only at one of these serine residue, demonstrating the selectivity of this event. A point mutant of C-FADD lacking serine 194 (C-FADD S194A) was no longer phosphorylated in an in vitro kinase assay and was also no target for the kinase in vivo. Both human and murine FADD are specifically phosphorylated at a single serine residue (3, 10, 12), suggesting that the site and the function of this serine-specific phosphorylation are conserved between both species. Serine 194 is part of a Met-Ser-Pro motive that presents the most conserved region at the C terminus between human and murine FADD. Many cell cycle-regulated protein kinases phosphorylate in a proline-directed manner (for review see Ref. 35). However, classical cell cycle-regulating kinases such as members of the cdc and cdk family may not be responsible for the FADD phosphorylation because they are much smaller than the 70-kDa kinase we have identified. Further studies will be directed to identify the nature of the cell cycle-regulated FADD kinase on the molecular level.
Another apoptosis regulating molecule, Bcl-2, was recently shown to be specifically phosphorylated in cells arrested at the G2/M transition (36, 37). Also in this case, a direct link between phosphorylation and apoptosis signaling could not be established. FADD is not only involved in apoptosis signaling. It also seems to be necessary for proliferation signals in T cells. The basis of this function has so far not been identified. The C terminus of FADD seems to be required for this function as C-FADD transgenic mice had a similar phenotype as FADD-/- mice (16, 17, 18). Because C-FADD contains the serine residue that is phosphorylated, the phosphorylation of FADD may be important for its function as a mediator of proliferation in T cells. The requirement for FADD in this pathway was demonstrated in vivo, using C-FADD transgenic or FADD-deficient mice. This effect could not be studied in transformed T cell lines (16). One explanation for this could be that primary T cells in contrast to transformed T cells have to proceed from G0 to the G1 phase to proliferate. Therefore, FADD may regulate entry into the cell cycle in T cells. Consistent with this assumption, we here report the identification of an unknown cell cycle-regulated kinase of 70 kDa that specifically phosphorylates FADD at serine 194. Future studies are necessary to identify the FADD kinase and to test its role in cellular proliferation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 C.S. and J.V. contributed equally to this work.
3 Current address: Laboratory of Immunogenetics, National Institute of Allergy and Infectious Disease, National Institutes of Health, 12441 Parklawn Drive, Rockville, MD 20852.
4 Address correspondence and reprint requests to Dr. M. E. Peter, The Ben May Institute for Cancer Research, University of Chicago, 924 East 57th Street, Chicago, IL 60637-5420.
5 Abbreviations used in this paper: TRAIL, TNF-related apoptosis-inducing ligand; DD, death domain; FADD, Fas-associated DD protein; MORT, mediator of receptor-induced toxicity; DISC, death-inducing signaling complex; CAP, cytotoxicity-dependent APO-1-associated protein; DED, death effector domain; DN, dominant negative; TPBC, Tween 20 in PBS; GSH, reduced glutathione; N-FADD, N-terminal FADD; C-FADD, C-terminal FADD; TRADD, TNFR-associated DD protein; IEF, isoelectric focusing.
Received for publication September 8, 1999. Accepted for publication November 11, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B. Immunity 7:831.[Medline]
B pathway. Immunity 7:821.[Medline]
B activation. Cell 81:495.[Medline]
This article has been cited by other articles:
|
|
 |
|
  N. Agata, R. Ahmad, T. Kawano, D. Raina, S. Kharbanda, and D. Kufe MUC1 Oncoprotein Blocks Death Receptor-Mediated Apoptosis by Inhibiting Recruitment of Caspase-8 Cancer Res., August 1, 2008; 68(15): 6136 - 6144. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Tourneur, S. Mistou, A. Schmitt, and G. Chiocchia Adenosine Receptors Control a New Pathway of Fas-associated Death Domain Protein Expression Regulation by Secretion J. Biol. Chem., June 27, 2008; 283(26): 17929 - 17938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-W. Park, H. P. Kim, S.-J. Lee, X. Wang, Y. Wang, E. Ifedigbo, S. C. Watkins, M. Ohba, S. W. Ryter, Y. M. Vyas, et al. Protein Kinase C{alpha} and {zeta} Differentially Regulate Death-Inducing Signaling Complex Formation in Cigarette Smoke Extract-Induced Apoptosis J. Immunol., April 1, 2008; 180(7): 4668 - 4678. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Gibcus, L. Menkema, M. F. Mastik, M. A. Hermsen, G. H. de Bock, M.-L. F. van Velthuysen, R. P. Takes, K. Kok, C. A. Alvarez Marcos, B. F.A.M. van der Laan, et al. Amplicon Mapping and Expression Profiling Identify the Fas-Associated Death Domain Gene as a New Driver in the 11q13.3 Amplicon in Laryngeal/Pharyngeal Cancer Clin. Cancer Res., November 1, 2007; 13(21): 6257 - 6266. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Truscott, J.-B. Denault, B. Goulet, L. Leduy, G. S. Salvesen, and A. Nepveu Carboxyl-terminal Proteolytic Processing of CUX1 by a Caspase Enables Transcriptional Activation in Proliferating Cells J. Biol. Chem., October 12, 2007; 282(41): 30216 - 30226. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. Osborn, S. J. Sohn, and A. Winoto Constitutive Phosphorylation Mutation in Fas-associated Death Domain (FADD) Results in Early Cell Cycle Defects J. Biol. Chem., August 3, 2007; 282(31): 22786 - 22792. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Q. Nhan, W. C. Liles, and S. M. Schwartz Physiological Functions of Caspases Beyond Cell Death Am. J. Pathol., September 1, 2006; 169(3): 729 - 737. [Full Text] [PDF]
|
|
|
|
 |
|
 S. K. Frankel, G. P. Cosgrove, S.-I. Cha, C. D. Cool, M. W. Wynes, B. L. Edelman, K. K. Brown, and D. W. H. Riches TNF-{alpha} Sensitizes Normal and Fibrotic Human Lung Fibroblasts to Fas-Induced Apoptosis Am. J. Respir. Cell Mol. Biol., March 1, 2006; 34(3): 293 - 304. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Chen, M. S. Bhojani, A. C. Heaford, D. C. Chang, B. Laxman, D. G. Thomas, L. B. Griffin, J. Yu, J. M. Coppola, T. J. Giordano, et al. Phosphorylated FADD induces NF-{kappa}B, perturbs cell cycle, and is associated with poor outcome in lung adenocarcinomas PNAS, August 30, 2005; 102(35): 12507 - 12512. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Chau, V. Wong, N.-J. Chen, H.-L. Huang, W.-J. Lin, C. Mirtsos, A. R. Elford, M. Bonnard, A. Wakeham, A. I. You-Ten, et al. Cellular FLICE-inhibitory protein is required for T cell survival and cycling J. Exp. Med., August 1, 2005; 202(3): 405 - 413. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Hua, M. G. Cornejo, M. H. Cardone, C. L. Stokes, and D. A. Lauffenburger Effects of Bcl-2 Levels on Fas Signaling-Induced Caspase-3 Activation: Molecular Genetic Tests of Computational Model Predictions J. Immunol., July 15, 2005; 175(2): 985 - 995. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Lashinger, K. Zhu, S. A. Williams, M. Shrader, C. P.N. Dinney, and D. J. McConkey Bortezomib Abolishes Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Resistance via a p21-Dependent Mechanism in Human Bladder and Prostate Cancer Cells Cancer Res., June 1, 2005; 65(11): 4902 - 4908. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. P. Cousens, F. A. Goulette, and J. W. Darnowski JAK-Mediated Signaling Inhibits Fas Ligand-Induced Apoptosis Independent of De Novo Protein Synthesis J. Immunol., January 1, 2005; 174(1): 320 - 327. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Imamura, K. Konaka, N. Matsumoto, M. Hasegawa, M. Fukui, N. Mukaida, T. Kinoshita, and T. Suda Fas Ligand Induces Cell-autonomous NF-{kappa}B Activation and Interleukin-8 Production by a Mechanism Distinct from That of Tumor Necrosis Factor-{alpha} J. Biol. Chem., November 5, 2004; 279(45): 46415 - 46423. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Shimada, S. Matsuyoshi, M. Nakamura, E. Ishida, M. Kishi, and N. Konishi Phosphorylation of FADD is critical for sensitivity to anticancer drug-induced apoptosis Carcinogenesis, July 1, 2004; 25(7): 1089 - 1097. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Wu, M. Roberts, M. Porter, F. Walker, E. J. Wherry, J. Kelly, M. Gadina, E. M. Silva, G. A. DosReis, M. F. Lopes, et al. Viral FLIP Impairs Survival of Activated T Cells and Generation of CD8+ T Cell Memory J. Immunol., May 15, 2004; 172(10): 6313 - 6323. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. F. Curtin and T. G. Cotter JNK Regulates HIPK3 Expression and Promotes Resistance to Fas-mediated Apoptosis in DU 145 Prostate Carcinoma Cells J. Biol. Chem., April 23, 2004; 279(17): 17090 - 17100. [Abstract] [Full Text] [PDF]
|
|
</ | |||||
