The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jalukar, S. V.
Right arrow Articles by Bishop, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jalukar, S. V.
Right arrow Articles by Bishop, G. A.
The Journal of Immunology, 2000, 164: 623-630.
Copyright © 2000 by The American Association of Immunologists

Characterization of the Roles of TNF Receptor-Associated Factor 6 in CD40-Mediated B Lymphocyte Effector Functions1

Sangita V. Jalukar*, Bruce S. Hostager* and Gail A. Bishop2,*,{dagger},{ddagger}

Departments of * Microbiology and {dagger} Internal Medicine, University of Iowa, Iowa City, IA 52242; and {ddagger} Veterans Affairs Medical Center, Iowa City, IA 52242


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Signaling through CD40 in B cells leads to B cell proliferation, Ig and IL-6 secretion, isotype switching, and up-regulation of surface molecules. TNF receptor-associated factor (TRAF) proteins associate with the cytoplasmic tail of CD40 and act as adapter molecules. Of the six TRAFs identified to date, TRAFs 2, 3, 5, and 6 are reported to associate directly with the cytoplasmic tail of CD40, but previous studies have principally examined transient overexpression of TRAF6 in cells that do not normally express CD40. Thus, we examined the role of TRAF6 in CD40-mediated B lymphocyte effector functions using two approaches. We produced and stably expressed in mouse B cell lines a human CD40 molecule with two cytoplasmic domain point mutations (hCD40EEAA); this mutant fails to bind TRAF6, while showing normal association with TRAFs 2 and 3. We also inducibly expressed in B cells a transfected "dominant-negative" TRAF6 molecule which contains only the C-terminal TRAF-binding domain of TRAF6. Using both molecules, we found that TRAF6 association with CD40 is important for CD40-induced IL-6 and Ig secretion, and that TRAF6 mediates its effects on CD40-stimulated Ig secretion principally through its effects on IL-6 production by the B cell. TRAF6 association with CD40 was also found to be important for B7-1 up-regulation, but not for up-regulation of other surface molecules. Interestingly, however, although we could show TRAF6-dependent CD40-mediated activation of NF-{kappa}B in 293 kidney epithelial cells, no such effect was seen in B cells, suggesting that TRAF6 has cell-type-specific functions.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CD40 is a member of the TNF receptor (TNFR)3 family of surface molecules and is expressed on bone marrow B cells, mature B cells, and certain accessory cells, including bone marrow-derived and follicular dendritic cells. Activated CD4+ T cells express CD154, the ligand for CD40 (1, 2). Signaling through CD40 in B cells leads to B cell proliferation (3), Ig and IL-6 secretion (3, 4), isotype switching (5), and up-regulation of surface molecules such as B7-1 (6), LFA-1, ICAM-1 (7), and Fas (8). However, the downstream signaling events following CD40 ligation are not well understood. The cytoplasmic (CY) tail of CD40 does not contain any enzymatic domains, but associates with a family of signal transducer proteins, the TNF receptor-associated factors (TRAFs). TRAFs have no identified enzymatic functions and may serve as adapter molecules. TRAF protein structure is characterized by a conserved carboxyl-terminal TRAF-C domain, a coiled-coil TRAF-N domain, and, with the exception of TRAF1, amino-terminal Zn RING and finger domains. The TRAF-C domain binds to receptor cytoplasmic domains, whereas the TRAF-N domain mediates TRAF homo- and hetero-oligomerization (9, 10). The Zn-binding domains are believed to be essential for downstream signaling on the basis of mostly indirect evidence (9, 11, 12). Of the six TRAFs identified to date, TRAFs 2, 3, 5, and 6 are reported to associate directly with the cytoplasmic tail of CD40 (10, 12). TRAFs 2, 3, and 5 interact with the same region whereas TRAF6 binds to a more membrane proximal region (11). Although the function of TRAF2, which binds most of the known TNFR family of molecules, has received considerable attention, little is yet known about the function of other TRAF molecules. The developmentally early lethality of TRAF deficiencies in genetically altered mice has precluded the use of TRAF-/- mice as an optimal model system for understanding the roles of TRAFs in mature lymphocytes. The most common experimental approach to date for examining TRAF function has been transient overexpression of TRAFs in the easily transfected human adenovirus-transformed kidney epithelial cell line 293. When overexpressed in 293 cells, TRAFs 2,3, 5, and 6 constitutively associate with TNFR family receptors, and expression of TRAFs alone is sufficient to activate the transcription factor NF-{kappa}B (9, 12, 13). However, when lymphocytes are examined, evidence has been presented that TRAFs may neither associate with TNFR family molecules in resting cells nor activate NF-{kappa}B in a constitutive fashion (14), and TRAF function may thus have cell-type-specific features.

TRAF6 consists of 522 amino acids and has a m.w. of 57,00. It shares 30% sequence identity with other TRAFs in the TRAF-C and the Zn-binding domains (11). A role for TRAF6 in activation of NF-{kappa}B has been reported for various receptors such as CD40 (12), IL-1 receptor (11), and hToll receptor (15). TRAF6 has also been reported to stimulate extracellular signal-related kinase activation in CD40 signaling along a ras-independent pathway (16). However, all of these experiments were done using transient transfection of non-B cells, and, as described above, their results may not be applicable to the functions of TRAF6 in response to CD40 signaling in B lymphocytes. We have used two alternative approaches to study the physiologic role of TRAF6 in CD40 signaling to B cells. In the first approach, we produced and stably expressed in mouse B cell lines a human CD40 molecule with two cytoplasmic domain point mutations (hCD40EEAA); this mutant fails to bind TRAF6, while showing normal association with TRAFs 2 and 3. In the second approach, we inducibly expressed in B cells a transfected dominant-negative (DN) TRAF6 molecule which contains only the C-terminal TRAF-binding domain of TRAF6. Using these complementary approaches, we find that TRAF6 association with CD40 is important for CD40-induced IL-6 and Ig secretion as well as B7-1 up-regulation. Interestingly, however, CD40-mediated activation of NF-{kappa}B and c-Jun kinase in B cells was unaffected by disrupting the CD40-TRAF6 association.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines

Mouse B cell lines CH12.LX (17) and M12.4.1 (18) were cultured in RPMI 1640 supplemented with 10% FCS, 10 µM 2-ME, and antibiotics [B cell medium (BCM) 10]. Transfected B cells were cultured in BCM-10 supplemented with 400 µg/ml geneticin (Life Technologies, Grand Island, NY). Chinese hamster ovary cells (CHO-K1) obtained from the American Type Culture Collection (Manassas, VA) were cultured in DMEM (high glucose) supplemented with 10% FCS, 10 µM 2-ME, 1x MEM non-essential amino acids (Sigma, St. Louis, MO), and antibiotics (MEM culture medium (MCM)-10). CHO cells transfected with a plasmid encoding the mouse CD40 ligand CD154 (19) were cultured in MCM-10 supplemented with 1 mg/ml geneticin. CHO cells transfected with a plasmid encoding human CD154 were a kind gift from Dr. Amelia Black (IDEC Pharmaceuticals, San Diego, CA) and were cultured in CHO-S-SFM II (Life Technologies) supplemented with 50 nM methotrexate. Embryonic kidney epithelial cell lines 293 and 293-T were cultivated in MCM-10.

Construction of DNTRAF6 and hCD40EEAA

Flag-tagged DNTRAF6 consists of the C-terminal 228 amino acids of TRAF6, corresponding to the TRAF-binding domain but lacking the Zn fingers and the RING finger. DNTRAF6 and WTTRAF6 were prepared by PCR amplification of cDNA from M12 cells. For DNTRAF6, CCGTCGACATGGAAACTATCAAACAGTTGGAGAGTC and CCTCTAGATTGAACACAAGTACATGGACGC primers and for wild-type (WT) TRAF6, GGGTCGACATGAGTCTCTTAAACTGTGAGAAC and CCGAATGGTCCGTTTGAGCTC primers were used, and cDNA from M12.4.1 was used as a template. Amplified cDNA was inserted into the mammalian expression vector pRSV.5(neo) (20) for constitutive expression or the plasmid pOPRSVI.mcs1 (19) for inducible expression of DNTRAF6. Mutant hCD40EEAA, in which two glutamic acid residues at positions 232 and 235 were substituted by alanines, was PCR amplified using oligonucleotide primers containing appropriately positioned point mutations and phCD40.neo (21) as a template. The PCR product was inserted into pRSV.5(neo). DNA sequencing confirmed that all PCR products were free of any undesired mutations. FLAG-tagged TRAF2 and hemagglutinin (HA)-tagged TRAF3 constructs have been described previously (22).

Generation of mouse B cell transfectants

M12.4.1 and CH12.LX stable transfectants constitutively expressing lac repressor (LacI) have been described previously (19, 23). Super transfection of CH12.LAC and M12.LAC with DNTRAF6 and transfection of CH12.LX and M12.4.1 with hCD40EEAA constructs was conducted using electroporation as previously described (24). Geneticin-resistant clones were analyzed for expression of DNTRAF6 and hCD40EEAA using intracellular or surface membrane immunofluorescence staining, with analysis by flow cytometry on a FACScan (Becton Dickinson, Mountain View, CA) flow cytometer, as described (21, 22). Induction of inducible DNTRAF6 expression was accomplished by incubation of transfectants with 100 µM isopropylthio-{beta}-D-galactoside (IPTG) for 48 h as described previously (19, 23). Generation of B cell transfectants expressing WThCD40 has been described previously (21).

Abs and reagents

A mAb specific for the FLAG epitope tag was purchased from Eastman Kodak (New Haven, CT). Anti-HA epitope tag Ab was purchased from Babco (Richmond, CA). Anti-mouse IgG-HRP was purchased from Bio-Rad (Hercules, CA). Recombinant mouse IL-6 and the mAbs 16/10A1 (fluorescein-conjugated anti-mouse B7-1, hamster IgG), G235-2356 (antitrinitrophenyl, isotype control, hamster IgG), Jo2 (anti-mouse Fas, hamster IgG) were purchased from PharMingen (San Diego, CA). Goat anti-hamster IgG-FITC was purchased from Jackson ImmunoResearch Laboratories (West Grove, PA). MOPC-21, streptavidin-HRP, and luciferin were purchased from Sigma (St. Louis, MO). Goat anti-mouse IgG1-FITC and goat anti-rat IgG-FITC were purchased from Southern Biotechnology Associates (Birmingham, AL). The following hybridomas were purchased from the American Type Culture Collection (ATCC) or were generous gifts from the indicated individuals: G28–5 (anti-human CD40, mouse IgG1; ATCC); M17/4.4.11.9 (anti-mouse LFA-1{alpha}, rat IgG2a; ATCC); YN1/1.74 (anti-mouse ICAM-1, rat IgG2a; ATCC); UC8–169 (hamster IgG, isotype control; ATCC); 20F3.11 and 32C11.4 (anti-mouse IL-6, rat IgG; ATCC); 1C10 (anti-mouse CD40, rat IgG2a) from Dr. Frances Lund (Trudeau Institute, Saranac Lake, NY), and EM95.3 (anti-mouse IgE, rat IgG2a) from Dr. Thomas Waldschmidt (University of Iowa, Iowa City, IA).

Binding studies

Transient transfection of 293-T cells was performed by calcium phosphate precipitation (22) with the indicated constructs. Cells were harvested 36–48 h after transfection and lysed in 400 µl of lysis buffer [1% Triton X-100, 150 mm NaCl, 20 mM HEPES (pH 7.0), 0.4 mM EDTA, and protease inhibitors; Boehringer Mannheim, Indianapolis, IN] for 30 min on ice. The lysates were centrifuged at 14, 000 x g for 15 min at 4°C, and 370 µl of the supernatants was immunoprecipitated with anti-hCD40-coated protein G-agarose beads for 1.5 h at 4°C. The beads were washed four times with lysis buffer, resolved by SDS-PAGE, and protein bands were transferred to nitrocellulose. Subsequent immunoblotting was performed with anti-FLAG mAb (for TRAFs 2 and 6) or anti-HA (for TRAF3) Ab followed by HRP-labeled goat anti-mouse IgG Ab, as previously described. Protein bands were visualized using a chemiluminescent detection system (Pierce, Rockford, IL).

Analysis of surface molecule up-regulation

M12.4.1 transfectants (105) expressing DNTRAF6 (induced with 100 µM IPTG for 24 h) or hCD40EEAA were stimulated with 2 µg of anti-CD40 mAbs or isotype control Ab for 72 h in a volume of 2 ml. Surface expression of B7-1, ICAM-1, LFA-1, and Fas was determined by flow cytometry as described previously (21).

IL-6 secretion

Transfected CH12.LX cells (1 x 105) plus untransfected CHO-K1, CHO-mouse CD154, or CHO-hCD154 cells were cocultured at a ratio of B cells:CHO cell (4:1) with or without IPTG in BCM-10 for 48 h, and the supernatants were quantitated for secreted IL-6 by ELISA as described (19). Values given represent the mean ± SE of triplicate wells. Exogenous IL-6 (10 ng/ml) and anti-IL-6 mAbs (10 µg/ml) were used at previously determined saturating concentrations.

Ab secretion assay

CH12.LX cells express surface and secreted IgM specific for phosphatidylcholine, an Ag found on the surface of sheep RBC (25). IgM secretion by CH12.LX transfectants was determined as described previously (26). Briefly, cells were preincubated with or without 100 µM IPTG for 24 h for transfectants expressing inducible DNTRAF6 followed by incubation with the indicated stimuli for 48 h. Cells expressing hCD40EEAA were stimulated for a total of 72 h. To study the role of IL-6 in Ab secretion, cells were stimulated in the presence or absence of either blocking or nonblocking IL-6 Abs or in the presence of exogenous recombinant mouse IL-6. The number of IgM-secreting cells/106 viable recovered cells was enumerated as cells able to form lytic plaques on a lawn of sheep RBC as described (26). Sheep erythrocytes used as a source of phosphatidylcholine Ag were purchased from Elmira Biologicals (Iowa City, IA).

Nuclear protein extraction and EMSA

Both nuclear protein extraction and EMSA were performed as described previously (14). Briefly, 107 viable cells, previously induced with 100 µM IPTG for 48 h when indicated, were stimulated with 1 µg/ml of anti-CD40 Ab or isotype control Ab for 1.5 h at a concentration of 106 cells/ml. Cells were lysed and nuclear extracts were prepared as described previously (14). The extracts were stored at -70°C in the presence of protease inhibitors (Mini Complete; Boehringer Mannheim). The double-stranded NF-{kappa}B probe, previously described (14), was end labeled with [{gamma}-32P]ATP using T4 polynucleotide kinase. A total of 5 µg of nuclear extract was incubated with 0.25–0.5 ng of probe for 30 min at room temperature. The samples were resolved on a 5% native polyacrylamide gel at a constant current of 20 mA. The gel was dried and exposed to x-ray film overnight at -70°C.

Reporter gene assay

M12.4.1 stable transfectants (induced for 24 h with 100 µM IPTG in the case of cells expressing DNTRAF6) were transiently transfected by electroporation with 5 µg of CMV-{beta}-galactosidase ({beta}-gal) construct and 10 µg of a luciferase reporter construct (4xI{kappa}B-Luc) under the control of four NF-{kappa}B binding sites and a minimal promoter as previously described (14). 293 cells were transiently transfected with 1 µg each of CMV-{beta}-gal construct and 4xI{kappa}B-Luc construct, 5 µg of various TRAF6 expression vectors, and 1 µg of WT hCD40 construct by calcium phosphate precipitation. The total amount of DNA transfected into 293 cells was always adjusted to 8 µg with a control expression vector. Viable M12.4.1 and 293 cells (5 x 105) were stimulated in triplicate 24 h after transfection with 1 µg/ml anti-mCD40, anti-hCD40, or isotype control Ab for 24 h at 37°C. Cells were assayed for luciferase activity, as described previously (14), with a luminometer (TD-20/20; Turner Designs, Sunnyvale, CA) immediately after the addition of 100 µl of 1 mM luciferin. {beta}-gal activity was assayed using a Galacto-Light-Plus assay system (Tropix, Bedford, MA) and was used to normalize luciferase activity to correct for transfection efficiency.

Assays for activity of c-Jun kinase

M12.4.1 transfectants (2 x 106) were stimulated with 1 µg/ml anti-mCD40, anti-hCD40, or isotype control Ab for 5 min or with 0.6 M sorbitol for 20 min at 37°C and c-Jun kinase activity was measured as described previously (27). Samples were resolved by SDS-PAGE, and phosphorylated c-Jun was visualized by autoradiography.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of hCD40EEAA and DNTRAF6 in B cells

An inducible expression system was used for DNTRAF6 to enable comparison of various functions of the same transfected B cell clone in the presence or absence of DNTRAF6 expression, as well as to avoid any long-term toxic effects of constitutive expression of a negative signaling protein. DNTRAF6 expression was induced in the mouse B cell lines M12.LAC and CH12.LAC by incubation with IPTG for 24–48 h (Fig. 1Go). Expression of DNTRAF6 had no effect on expression of CD40 (data not shown). hCD40EEAA was expressed constitutively in M12.4.1 and CH12.LX transfectants. The level of expression of the mutant hCD40 molecule was determined by flow cytometry (Fig. 1Go). Clones were selected for expression similar to that of WThCD40 on previously transfected subclones (last panel).



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 1. Expression of DNTRAF6 and hCD40EEAA in B cells. A, CH12.LAC and M12.LAC DNTRAF6-inducible transfectants were incubated in the presence or absence of 100 µM IPTG for 48 h. Cells were then permeabilized and stained with 1 µg/ml anti-FLAG Ab followed by 1 µg/ml of anti-mouse-IgG-FITC. B, WThCD40 and hCD40EEAA transfectants were stained with anti-hCD40 or isotype control Ab followed by staining with FITC-secondary Ab. Data are representative of several clones. Heavy lines represent staining with isotype control Ab or without IPTG induction in the case of DNTRAF6. Thin lines represent staining with anti-hCD40 Ab or cells induced with IPTG in the case of DNTRAF6.

 
hCD40EEAA binds TRAFs 2 and 3, but not TRAF6

The cytoplasmic domain of CD40 has an overlapping binding site for TRAFs 2, 3, and 5, and a distinct binding site for TRAF6 (10). Pullen et al. (10) have reported that an 8-mer peptide, QEPQEINF, derived from amino acids 231–238 of hCD40 binds TRAF6. To analyze the specific role of TRAF6 binding in CD40-mediated signaling to B cells, we generated an hCD40 mutant molecule in which two glutamic acid residues at position 232 and 235 were substituted with alanines. We determined the ability of this molecule to bind TRAFs 2, 3, and 6 in comparison to the WThCD40 molecule. We were unable to immunoblot for endogenous WTTRAF6 during our binding experiments because commercially available Abs to mouse TRAF6 showed no reactivity on Western blots. To circumvent this problem, we transiently expressed our DNTRAF6 construct for these experiments. We coexpressed either WT or hCD40EEAA with TRAFs 2 and 3 or DNTRAF6 in an epithelial cell line, 293-T, immunoprecipitated hCD40, and blotted for the different TRAFs. Association of TRAFs 2 and 3 with hCD40EEAA was similar to that of WThCD40. However, DNTRAF6 did not associate with hCD40EEAA (Fig. 2Go).



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 2. hCD40EEAA binds TRAFs 2 and 3, but not TRAF6. 293-T cells were transfected with 2.5 µg each of indicated DNA constructs. After 48 h, cells were lysed, and the lysates were immunoprecipitated with anti-hCD40 Ab. A separate sample of each culture was stained with anti-CD40 mAb, and flow cytometry was performed to ensure similar CD40 expression (data not shown). The immunoprecipitated samples were run on an SDS gel and a Western blot was performed with either anti-FLAG (for TRAFs 2 and 6) or anti-HA Ab (for TRAF3). Results are representative of two similar experiments.

 
TRAF6 is involved in CD40-mediated IL-6 secretion in B cells

CD40 signaling has been shown to induce IL-6 secretion in B cells (4), including the mouse B cell line CH12.LX (19). Previous studies in our laboratory have found that a deletion mutant of CD40, lacking 32 amino acids from the cytoplasmic tail (hCD40{Delta}32), cannot bind TRAFs 2 and 3 (22). However, hCD40{Delta}32 induces IL-6 secretion comparable to that induced by WThCD40 (28). The TRAF6 binding site in hCD40{Delta}32 is still intact, but a further-truncated molecule, hCD40{Delta}55, cannot induce IL-6 secretion and lacks the TRAF6 binding site (28). Thus, we postulated that CD40-mediated IL-6 secretion might require TRAF6. Data presented in Fig. 3GoA show that hCD40EEAA stimulated 75% less IL-6 secretion upon engagement with CHO-hCD154 cells as compared with IL-6 secreted upon engagement of the WThCD40 molecule. IL-6 production induced via WThCD40 is always considerably higher than that induced by mouse CD40, as we have previously shown (28). Two likely possibilities account for this. First, the expression of human CD40 molecules achieved via transfection is always significantly higher than that of endogenous mouse CD40 on our B cell subclones, and, second, for unknown reasons, the expression of human CD154 on the transfected CHO cells we use for a stimulus for IL-6 production is higher than the maximum expression of mouse CD154 we could achieve on CHO transfectants. Thus, a combination of lower amounts of stimulating ligand and lower receptor expression may account for the lower IL-6 production. Importantly, however, both of these transfectants secreted comparable levels of IL-6 when stimulated with CHO-mouse CD154 cells. This control indicates that the two cell lines are similar in their inherent ability to secrete IL-6 in response to a mouse CD40 signal. A similar although less pronounced defect was seen in CH12.LAC cells inducibly expressing DNTRAF6. IL-6 secretion was reproducibly ~25% lower when expression of DNTRAF6 was induced by IPTG (Fig. 3GoB). The more dramatic effect seen with hCD40EEAA compared with DNTRAF6 may reflect the complete lack of TRAF6 binding to hCD40EEAA compared with the competition for TRAF6 binding achievable using DNTRAF6. Because presently there is not a reliable Ab which detects endogenous TRAF6 in cells, we were unable to determine the relative level of expression of transfected DNTRAF6 vs endogenous WTTRAF6 in the B cells, and therefore cannot precisely quantitate the degree of competition that DNTRAF6 provides for endogenous TRAF6 binding to CD40.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 3. TRAF6 is involved in CD40-mediated IL-6 secretion in B cells. CH12.LX mouse B cells stably transfected with indicated hCD40 constructs (A) or CH12.LX.Lac transfected with inducible DNTRAF6 (B) were incubated with CHO cells expressing hCD40L, mCD40L, or empty vector and with IPTG as indicated for 48 h. The supernatants were then assayed for secreted IL-6 by ELISA. Similar results were obtained in two additional experiments and two additional experiments with a second CH12.hCD40EEAA clone.

 
TRAF6 plays a role in CD40-mediated Ab secretion in B cells

CD40 signaling leads to Ab secretion in CH12.LX cells and can synergize with B cell Ag receptor (BCR) signaling to enhance Ab secretion (29). There are no previous reports on the role of TRAF6 in CD40-mediated Ab secretion. However, it has been previously shown that both CD40 signals and exogenously added IL-6 induce CH12.LX to secrete Ab, and both signals are enhanced by BCR signaling (19, 30). Thus, it was of interest to determine whether TRAF6 is also involved in CD40-mediated Ab production. CH12.LX cells expressing either WThCD40 or hCD40EEAA were stimulated through their endogenous mCD40 molecules or through the transfected hCD40 molecule in the presence or absence of Ag, and Ab-secreting cells were enumerated as plaque-forming cells on a lawn of sheep RBC. Ab secretion stimulated by hCD40EEAA was decreased ~75% in comparison to that stimulated in cells expressing WThCD40 (Fig. 4GoA). However, the ability of hCD40EEAA transfectants to secrete IgM in response to mCD40 was normal. We also saw synergy with BCR signaling by hCD40EEAA, but it was not enough to reverse the signaling defect. Similarly, when CH12.LAC cells inducibly expressing DNTRAF6 were stimulated with anti-mCD40 Ab in the presence of IPTG, Ab secretion was 75% lower (Fig. 4GoB) compared with the uninduced cells. Once again, synergy with BCR signaling was seen but was not sufficient to reverse the signaling defect. Thus, TRAF6 binding is important for CD40-mediated Ab secretion in B cells.



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 4. TRAF6 plays a role in CD40-mediated Ab secretion in B cells. CH12.LX mouse B cells stably transfected with the indicated hCD40 molecules (A) or CH12.LX.Lac cells transfected with inducible DNTRAF6 (B) were incubated with the indicated stimuli for 72 h (A), or 24 h with IPTG + an additional 48 h with stimuli (B), as described in Materials and Methods. Data are presented as the number of IgM-secreting cells [plaque-forming cells (pfc)]/106 viable cells. Similar results were obtained in two additional experiments and two additional experiments with a second CH12.hCD40EEAA clone.

 
To further pursue the potential relationship between IL-6 and Ab secretion, CH12.LX cells were incubated in the presence of CD154 or IL-6 along with either blocking or nonblocking mAbs specific for mouse IL-6. An IL-6 blocking Ab (20F3) decreased Ab secretion by B cells by ~50% when cells were incubated with CD154 (Fig. 5GoA), whereas the isotype-matched non-blocking anti-IL-6 mAb (32C11) had no effect. Addition of exogenous IL-6 alone also induced Ab secretion by B cells but it was much lower compared with cells stimulated with CD154. This suggests that CD40-mediated Ab secretion by CH12.LX cells is driven in part, although not entirely, by secreted IL-6. To test whether a causal relationship exists between TRAF6-mediated IL-6 secretion and Ab secretion, cells expressing DNTRAF6 were incubated with anti-mCD40 Ab and either exogenously added IL-6 or IL-6-blocking Ab. Induced expression of DNTRAF6 decreased Ab secretion, which was restored to normal levels when exogenous IL-6 was also included (Fig. 5GoB). Furthermore, when DNTRAF6 expression was induced, concurrent addition of the IL-6-blocking mAb did not further reduce the IgM secretion stimulated through CD40. These results are consistent with the hypothesis that TRAF6 mediates its effects on CD40-stimulated Ig secretion principally through its effects on IL-6 production by the B cell.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 5. TRAF6 mediates its effects on CD40-stimulated Ig secretion principally through regulation of IL-6 production by the B cells. CH12.LX.Lac cells transfected with inducible DNTRAF6 (A) or CH12.LX mouse B cells (B) were incubated with the indicated stimuli for 72 h (B) or 24 h with IPTG plus an additional 48 h with stimuli (A), as described in Materials and Methods. Control plaque-forming cells (pfc) in the absence of 1C10 in A were <5000/106 viable cells. Data are presented as the number of IgM-secreting cells (pfc)/106 viable cells (mean ± SE of replicate cultures). Similar results were obtained in two additional experiments.

 
Up-regulation of surface molecules by hCD40EEAA

We have previously demonstrated that CD40 stimulation of M12.4.1 leads to up-regulation of a number of B cell surface molecules including adhesion molecules and the costimulatory molecule B7-1 (21). Thus, we compared surface molecule up-regulation in B cells stimulated through either the endogenous mCD40 molecule or the transfected hCD40 molecule. CD40-mediated up-regulation of B7-1 was decreased by 50% upon stimulation through hCD40EEAA as compared with the endogenous mCD40 stimulation (Fig. 6Go). Up-regulation of LFA-1, ICAM-1, and Fas was unaffected (data not shown). Induced expression of DNTRAF6 in M12.4.1 transfectants did not result in any significant effect on up-regulation of these surface molecules including B7-1 (data not shown). As discussed above, this may be due to insufficient competition for endogenous WTTRAF6 by the DNTRAF6, particularly as the effect of the hCD40EEAA mutation was less drastic on B7 up-regulation than on IL-6 and Ab secretion, suggesting that B7 up-regulation may be less dependent upon TRAF6.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 6. TRAF6 is important in CD40-mediated up-regulation of B7-1 in B cells. M12.4.1 mouse B cells stably transfected with the indicated hCD40 molecules were stimulated with anti-mCD40, anti-hCD40, or isotype control Ab for 72 h at 37°C. Surface expression of B7-1was determined by flow cytometry. Results represent mean fluorescence intensity minus staining of cells stimulated with isotype control Ab. Similar results were obtained in three additional experiments with two different M12.hCD40EEAA clones.

 
TRAF6 does not play a demonstrable role in CD40-mediated NF-{kappa}B activation in B cells

TRAF6 has been reported to be involved in CD40-mediated NF-{kappa}B activation (16, 31). However, these studies were performed in either 293 kidney epithelial cells or in Jurkat T cells, cell lines which normally do not express CD40. In addition, although studies in 293 cells indicated that TRAF2 also plays an important role in CD40-mediated NF-{kappa}B activation (9), subsequent experiments performed in mice (32, 33) and in B lymphocytes (14) showed that in cells which normally express CD40, TRAF2 is not required for CD40-mediated NF-{kappa}B activation. Thus, to study the role of TRAF6 in CD40-mediated NF-{kappa}B activation in B cells, we first examined nuclear translocation of NF-{kappa}B in M12.4.1 cells expressing hCD40EEAA. Nuclear translocation of NF-{kappa}B in M12.4.1 cells was similar in cells stimulated through endogenous mCD40 or the transfected hCD40EEAA molecule (Fig. 7GoA). Also, no difference in NF-{kappa}B translocation was seen when M12.4.1 cells were induced to express DNTRAF6 compared with the uninduced cells (Fig. 7GoB). Similar results were seen using CH12.LX cells (data not shown).



View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 7. TRAF6 does not play a critical role in CD40-mediated NF-{kappa}B translocation in B cells. A, M12.4.1 parent cells or cells stably expressing WThCD40 or hCD40EEAA were stimulated with anti-mCD40 (M), anti-hCD40 (H), or isotype control Ab (C) for 1.5 h and lysed, and nuclear extracts were prepared as described in Materials and Methods. Nuclear extracts were incubated with the labeled probe, and the samples were resolved on a native PAGE and visualized by autoradiography. Competitor probes were incubated with the nuclear extracts from cells stimulated with anti-hCD40 Ab, and they included 40x excess WT NF{kappa}B (Cc) and mutant NF{kappa}B that harbors a single-point mutation in the NF{kappa}B binding site (Mc). The first lane contains probe alone. B, M12.LAC cells transfected with DNTRAF6 were incubated in the presence or absence of IPTG for 24 h to induce expression of DNTRAF6. Cells were stimulated as above. Data are representative of two similar experiments; similar results were obtained with CH12.LX cells.

 
To measure CD40-mediated NF-{kappa}B-induced transcription, M12.4.1 transfectants expressing hCD40EEAA or WThCD40 were transiently transfected with a NF-{kappa}B reporter construct and then stimulated through the endogenous mCD40 or the hCD40 molecule. No difference in activation of the reporter gene was seen by hCD40 signaling vs mCD40 signaling (Fig. 8GoA). Once again, similar results were obtained with M12.4.1 inducibly expressing DNTRAF6 (Fig. 8GoB). This strongly suggests that TRAF6 does not have a critical role in CD40-mediated activation of NF-{kappa}B in B lymphocytes. These results are in direct contrast to what has been reported previously in non-B cells (31); therefore, we repeated our experiments in 293 epithelial cells. Transient expression of DNTRAF6 alone in 293 cells decreased NF-{kappa}B activation below the basal level. Expression of WTTRAF6 or WThCD40 increased NF-{kappa}B activation, and coexpression of both gave an additive effect (Fig. 8GoC). Interestingly, although overexpression of hCD40EEAA alone gave lower activation of the NF-{kappa}B reporter than did WThCD40, there was still a cooperative effect with TRAF6, although hCD40EEAA does not detectably bind TRAF6. These findings suggest that TRAF6 function in CD40-mediated signaling differs at least partially between B lymphocytes and epithelial or T cells, and reinforces the need to study CD40 signaling in lymphocytes to completely understand its function in these cells.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 8. TRAF6 influences CD40-mediated NF-{kappa}B-induced transcription in epithelial, but not B cells. M12.4.1 cells stably transfected with the indicated hCD40 molecules (A) or M12.4.1Lac stably transfected with inducible DNTRAF6 induced for 24 h (B) were transiently transfected with 5 µg of CMV-{beta}-gal construct and 10 µg of a luciferase NF-{kappa}B reporter construct. 293 cells (C) were transiently transfected with 5 µg of either DNTRAF6 or WTTRAF6, 1 µg of WThCD40/hCD40EEAA where indicated, and 1 µg each of CMV-{beta}-gal and luciferase NF-{kappa}B reporter construct. Total amount of DNA was adjusted with empty vector to 8 µg. Twenty-four-hour posttransfection cells were stimulated with anti-mCD40, anti-hCD40, or isotype control Ab for 24 h at 37°C. Cells were lysed and assayed for luciferase activity. {beta}-gal activity was used to normalize luciferase activity to correct for transfection efficiency. Error bars represent SEM. Data are representative of two similar experiments.

 
CD40-mediated c-Jun kinase activation is independent of TRAF6 association

CD40 is known to activate c-Jun NH2-terminal kinase (JNK) in B cells (23). To determine the role of TRAF6 in CD40-mediated JNK activation, M12.4.1 cells expressing hCD40EEAA were stimulated through the endogenous mCD40 or through the transfected hCD40EEAA. JNK activation was comparable when cells were stimulated through either receptor showing that CD40-mediated activation of JNK was independent of TRAF6 (Fig. 9GoA). Similar results were obtained in M12.4.1 cells inducibly expressing DNTRAF6 (Fig, 9B). Similar results were found in CH12.LX cells (data not shown).



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 9. CD40-mediated c-Jun kinase activation in B cells is independent of TRAF6 association. M12.4.1 cells stably transfected with the indicated hCD40 molecules (A) or M12.4.1Lac stably transfected with inducible DNTRAF6 induced for 24 h (B) were stimulated with anti-mCD40 (M), anti-hCD40 (H), isotype control Ab (C), or 0.6 M sorbitol (S) and lysed. An in vitro kinase assay was performed with the lysates, and the phosphorylated c-Jun was visualized by autoradiography. Arrowheads indicate phospho-c-Jun. Similar results were obtained in two additional experiments and in CH12.LX cells.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TRAF6 has been reported to play a role in signaling via CD40 (16, 31), IL-1R (11), and hToll-like receptor (15). Reports studying TRAF6 have largely been restricted to studying the potential role of TRAF6 in transcription factor activation (11, 15, 16) and have largely been performed in either 293 kidney epithelial cells or Jurkat T cells, neither of which normally express CD40. However, because we are interested in understanding how CD40 delivers its important activation signals to B lymphocytes, we wished to study the role of TRAF6 in CD40-mediated signaling in B cells. We adopted two different complementary approaches to accomplish this. In the first approach, we inducibly expressed DNTRAF6 in two different B cell lines and compared various functions of the B cells with or without expression of DNTRAF6. In the second approach, we tested signaling via a transfected mutant of hCD40 which does not bind TRAF6 but binds TRAFs 2 and 3 normally, and used signaling via the endogenous mouse CD40 molecule as an internal control. The collective results obtained using both approaches showed that TRAF6 plays a role in CD40-mediated IL-6 secretion, differentiation, and up-regulation of B7 in B cells, functions previously not tested for the TRAF6 molecule.

Our results further reveal a connection between CD40-mediated IL-6 production and Ab secretion, linked by a requirement for TRAF6 binding to CD40. Previous reports, including those from our own laboratory, have linked IL-6 with B cell differentiation (30, 34, 35, 36, 37). Other reports have shown that IL-6 secretion is induced by CD40 signaling in B cells (4, 19), and have suggested a connection between CD40-mediated IL-6 production and the induction of B cell differentiation (38, 39). Data presented here show that preventing TRAF6 from binding to CD40 decreased both IL-6 secretion (Fig. 3Go) and Ab secretion (Figs. 4Go and 5Go) by ~75%. That this similarity in effect is likely to be causal rather than coincidental is demonstrated by the findings that addition of exogenous IL-6 reversed the inhibition of differentiation seen when CD40 is stimulated in cells induced to express DNTRAF6, but exogenous IL-6 did not further increase CD40-mediated Ab secretion in cells that do not express DNTRAF6. Consistent with these findings, addition of blocking Ab to IL-6 did not further decrease DNTRAF6-induced inhibition of differentiation. Data in Fig. 5Go also show that CD40-mediated Ab secretion is partially TRAF6 and IL-6 independent. Addition of saturating amounts of exogenous IL-6 could not produce the same amount of Ab secretion as the CD40 signal itself, nor could inhibition of either IL-6 secretion (Fig. 5Go) or TRAF6 binding (Fig. 4Go) completely eliminate CD40-mediated Ab secretion. In addition, CD40 molecules which cannot detectably bind TRAF6 (hCD40EEAA) were still able to stimulate IL-6 production above basal levels (Fig. 3Go). Although this result may indicate that hCD40EEAA is able to bind an undetectable but biologically significant amount of TRAF6, it is at least as likely that CD40-stimulated IL-6 production is partially TRAF6 independent.

A major function attributed to TRAF molecules, based principally upon studies performed in transiently transfected 293 epithelial cells, has been the activation of the transcription factor NF-{kappa}B, and several studies have reported that TRAF6 plays a role in CD40-mediated activation of NF-{kappa}B in 293 cells (16, 31). Although we could reproduce these results in 293 cells, our experiments in B cells indicate the lack of a critical role for TRAF6 in CD40-mediated NF-{kappa}B activation (Figs. 7Go and 8Go). While this manuscript was in preparation, Lomaga et al. (40) reported that CD40-mediated proliferation and NF-{kappa}B activation were impaired in splenocytes obtained from TRAF6-deficient mice. However, these mice have low perinatal and postnatal survival, and before death show enlarged spleens. The number, developmental stage, subset composition, or phenotype (including level of CD40 expression) of B cells in the TRAF6-/- mice was not described. Thus, it is difficult to know whether their loss of NF-{kappa}B activation is a direct or indirect effect of TRAF6 deficiency. TRAF6-induced JNK activation in 293 epithelial cells has also been reported (41, 42). However, our results suggest that CD40-mediated JNK activation in B cells does not absolutely require TRAF6 binding.

We believe the most likely explanation for the partial discordance in the results of CD40-signaling assays in various cells is that different cell types have overlapping but distinct CD40-signaling pathways. This explanation is consistent with previous findings that TRAF2 appears to be very important for NF-{kappa}B activation in non-B cells (9) but not in B cells (14, 32, 33). In addition, TRAF molecules associate constitutively with TNFR family molecules in transiently transfected 293 cells, but this does not appear to be the case in B cells (43). This distinction between CD40 function on cells that normally express it and those that do not may have considerable functional significance. CD40 was originally identified as an Ag expressed on normal B cells and malignant bladder carcinoma cells (44), and CD40 expression has been reported on melanoma cells (45) as well as prostate, renal, and cervical carcinomas (46, 47, 48). This raises the intriguing possibility that when CD40 expression is induced on nonhematopoietic cells, particularly those of epithelial origin, cell type-specific consequences of CD40 signaling may contribute to cellular transformation.

The two most reproducible early signaling events documented in B cells following CD40 engagement are the activation of JNK and activation of NF-{kappa}B, neither of which were noticeably affected in our study by preventing TRAF6 from binding to CD40. However, a loss or decrease in TRAF6 binding was clearly able to inhibit CD40-mediated IL-6 secretion, differentiation, and B7 up-regulation, indicating that TRAF6 participates significantly in CD40 signaling. Other events reported to result from CD40 signaling to B cells include activation of protein tyrosine kinases (49, 50), phosphatidyl inositol 3-kinase, phospholipase C{gamma}2 (50), and Jak 3 (51). Determining which of these events is triggered by TRAF6 will be the subject of future investigation.


    Acknowledgments
 
We thank Luis Ramirez for technical assistance.


    Footnotes
 
1 This work was supported by grants to G.A.B. from the National Institutes of Health (AI28847, CA66570) and the Veterans Administration (Merit Review 383). S.V.J. received support from National Institutes of Health Postdoctoral Training Grant T32 AI07260. B.S.H. was supported by an Arthritis Foundation Postdoctoral Fellowship. Core support was provided by National Institutes of Health Grant DK25295 to the University of Iowa Diabetes and Endocrinology Research Center. Back

2 Address correspondence and reprint requests to Dr. Gail A. Bishop, University of Iowa, Department of Microbiology, 3-570 BSB, Iowa City, IA 52242. E-mail address: Back

3 Abbreviations used in this paper: TNFR, TNF receptor; BCM, B cell medium; DN, dominant negative; h, human; m, mouse; HA, hemagglutinin; IPTG, isopropylthio-{beta}-D-galactoside; {beta}-gal, {beta}-galactosidase; CHO, Chinese hamster ovary; BCR, B cell Ag receptor; JNK, c-Jun NH2-terminal kinase; TRAF, TNF receptor-associated factor; WT, wild type; MCM, MEM culture medium. Back

Received for publication July 16, 1999. Accepted for publication October 28, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Stamenkovic, I., E. A. Clark, B. Seed. 1989. A B-lymphocyte activation molecule related to the nerve growth factor receptor and induced by cytokines in carcinomas. EMBO J. 8:1403.[Medline]
  2. Banchereau, J., F. Bazan, D. Blanchard, F. Briére, J. P. Galizzi, C. van Kooten, Y. J. Liu, F. Rousset, S. Saeland. 1994. The CD40 antigen and its ligand. Annu. Rev. Immunol. 12:881.[Medline]
  3. Hodgkin, P. D., L. C. Yamashita, R. L. Coffman, M. R. Kehry. 1990. Separation of events mediating B cell proliferation and Ig production by using T cell membranes and lymphokines. J. Immunol. 145:2025.[Abstract]
  4. Clark, E. A., G. Shu. 1990. Association between IL-6 and CD40 signaling: IL-6 induces phosphorylation of CD40 receptors. J. Immunol. 145:1400.[Abstract]
  5. Shapira, S. K., D. Vercelli, H. H. Jabara, S. M. Fu, R. S. Geha. 1992. Molecular analysis of the induction of IgE synthesis in human B cells by IL-4 and engagement of CD40 antigen. J. Exp. Med. 175:289.[Abstract/Free Full Text]
  6. Ranheim, E. A., T. J. Kipps. 1993. Activated T cells induce expression of B7/BB1 on normal or leukemic B cells through a CD40-dependent signal. J. Exp. Med. 177:925.[Abstract/Free Full Text]
  7. Barrett, T. B., G. Shu, E. A. Clark. 1991. CD40 signaling activates CD11a/CD18 (LFA-1)-mediated adhesion in B cells. J. Immunol. 146:1722.[Abstract]
  8. Schattner, E. J., K. B. Eldon, D.-H. Yoo, J. Tumang, P. H. Krammer, M. K. Crow, S. M. Friedman. 1995. CD40 ligation induces Fas expression on human B lymphocytes and facilitates apoptosis through the Fas pathway. J. Exp. Med. 182:1557.[Abstract/Free Full Text]
  9. Rothe, M., V. Sarma, V. M. Dixit, D. V. Goeddel. 1995. TRAF2-mediated activation of NF-{kappa}B by TNF receptor 2 and CD40. Science 269:1424.[Abstract/Free Full Text]
  10. Pullen, S. S., H. G. Miller, D. S. Everdeen, T. T. A. Dang, J. J. Crute, M. R. Kehry. 1998. CD40-TRAF interactions: regulation of CD40 signaling through multiple TRAF binding sites and TRAF hetero-oligomerization. Biochemistry 37:11836.[Medline]
  11. Cao, Z., J. Xiong, M. Takeuchi, T. Kurama, D. V. Goeddel. 1996. TRAF6 is a signal transducer for IL-1. Nature 383:443.[Medline]
  12. Ishida, T., T. Tojo, T. Aoki, N. Kobayashi, T. Ohishi, T. Watanabe, T. Yamamoto, J.-I. Inoue. 1996. TRAF5, a novel TNF-R-associated factor family protein, mediates CD40 signaling. Proc. Natl. Acad. Sci. USA 93:9437.[Abstract/Free Full Text]
  13. Nakano, H., H. Oshima, W. Chung, L. Williams-Abbott, C. F. Ware, H. Yagita, K. Okumura. 1996. TRAF5, an activator of NF-{kappa}B and putative signal transducer for the LT-{beta} receptor. J. Biol. Chem. 271:14661.[Abstract/Free Full Text]
  14. Hsing, Y., B. S. Hostager, G. A. Bishop. 1997. Characterization of CD40 signaling determinants regulating NF-{kappa}B activation in lymphocytes. J. Immunol. 159:4898.[Abstract]
  15. Muzio, M., G. Natoli, S. Saccani, M. Levrero, A. Mantovani. 1998. The human Toll signaling pathway: divergence of NF-{kappa}B and JNK/SAPK activation upstream of TRAF6. J. Exp. Med. 187:2097.[Abstract/Free Full Text]
  16. Kashiwada, M., Y. Shirakata, J. Inoue, H. Nakano, K. Okazaki, K. Okumura, T. Yamamoto, H. Nagaoka, T. Takemori. 1998. TRAF6 stimulates ERK activity in CD40 signaling along a ras-independent pathway. J. Exp. Med. 187:237.[Abstract/Free Full Text]
  17. Bishop, G. A., G. Haughton. 1986. Induced differentiation of a transformed clone of Ly-1+ B cells by clonal T cells and antigen. Proc. Natl. Acad. Sci. USA 83:7410.[Abstract/Free Full Text]
  18. Hamano, T., K. J. Kim, W. M. Leiserson, R. Asofsky. 1982. Establishment of B cell hybridomas with B cell surface antigens. J. Immunol. 129:1403.[Abstract]
  19. Busch, L. K., G. A. Bishop. 1999. The EBV transforming protein, LMP1, mimics and cooperates with CD40 signaling in B lymphocytes. J. Immunol. 162:2555.[Abstract/Free Full Text]
  20. Long, E. O., S. Rosen-Bronson, D. R. Karp, M. Malnati, R. P. Sekaly, D. Jaraquemada. 1991. Efficient cDNA expression vectors for stable and transient expression of HLA-DR in transfected fibroblast and lymphoid cells. Hum. Immunol. 31:229.[Medline]
  21. Hostager, B. S., Y. Hsing, D. E. Harms, G. A. Bishop. 1996. Different CD40-mediated signaling events require distinct CD40 structural features. J. Immunol. 157:1047.[Abstract]
  22. Hostager, B. S., G. A. Bishop. 1999. Cutting edge: contrasting roles of TRAF2 and TRAF3 in CD40-mediated B lymphocyte activation. J. Immunol. 162:6307.[Abstract/Free Full Text]
  23. Hsing, Y., G. A. Bishop. 1999. Requirement for NF-{kappa}B activation by a distinct subset of CD40-mediated effector functions in B lymphocytes. J. Immunol. 162:2804.[Abstract/Free Full Text]
  24. Bishop, G. A., J. A. Frelinger. 1989. Haplotype-specific differences in signaling by transfected class II molecules to a Ly-1+ B-cell clone. Proc. Natl. Acad. Sci. USA 86:5933.[Abstract/Free Full Text]
  25. Mercolino, T. J., L. W. Arnold, G. Haughton. 1986. Phosphatidyl choline is recognized by a series of Ly-1+ murine B cell lymphomas specific for erythrocyte membranes. J. Exp. Med. 163:155.[Abstract/Free Full Text]
  26. Bishop, G. A.. 1991. Requirements of class II-mediated B cell differentiation for class II crosslinking and cAMP. J. Immunol. 147:1107.[Abstract]
  27. Latinis, K. M., G. A. Koretzky. 1996. Fas ligation induces apoptosis and JNK activation independently of CD45 and Lck in human T cells. Blood 87:871.[Abstract/Free Full Text]
  28. Baccam, M., G. A. Bishop. 1999. CD154, but not anti-CD40 mAbs, induces NF-{kappa}B independent B cell IL-6 production. Eur. J. Immunol. 29:3855.[Medline]
  29. Bishop, G. A., W. D. Warren, M. T. Berton. 1995. Signaling via MHC class II molecules and antigen receptors enhances the B cell response to gp39/CD40 ligand. Eur. J. Immunol. 25:1230.[Medline]
  30. Jambou, R. C., J. N. Snouwaert, G. A. Bishop, J. R. Stebbins, J. A. Frelinger, D. M. Fowlkes. 1988. High level expression of a bioengineered, cysteine-free hepatocyte stimulating factor (IL-6)-like protein. Proc. Natl. Acad. Sci. USA 85:9426.[Abstract/Free Full Text]
  31. Ishida, T., S. Mizushima, S. Azuma, N. Kobayashi, T. Tojo, K. Suzuki, S. Aizawa, T. Watanabe, G. Mosialos, E. Kieff, T. Yamamoto, J. Inoue. 1996. Identification of TRAF6, a novel TRAF protein that mediates signaling from an amino-terminal domain of the CD40 cytoplasmic region. J. Biol. Chem. 271:28745.[Abstract/Free Full Text]
  32. Yeh, W., A. Shahinian, D. Speiser, J. Kraunus, F. Billia, A. Wakeham, J. L. de la Pampa, D. Ferrick, B. Hum, N. Iscove, et al 1997. Early lethality, functional NF-{kappa}B activation, and increased sensitivity to TNF-induced cell death in TRAF2-deficient mice. Immunity 7:715.[Medline]
  33. Lee, S. Y., A. Reichlin, A. Santana, K. A. Sokol, M. C. Nussenzweig, Y. Choi. 1997. TRAF2 is essential for JNK but not NF-{kappa}B activation and regulates lymphocyte proliferation and survival. Immunity 7:701.
  34. Muraguchi, A., T. Hirano, B. Tang, T. Matsuda, Y. Horii, K. Nakajima, T. Kishimoto. 1988. The essential role of BSF-2/IL-6 for the terminal differentiation of B cells. J. Exp. Med. 167:332.[Abstract/Free Full Text]
  35. Goldstein, H., D. Koerholz, L. Chesky, X.-D. Fan, J. L. Ambrus. 1990. Divergent activities of protein kinases in IL-6-induced differentiation of a human B cell line. J. Immunol. 145:952.[Abstract]
  36. Hirano, T., S. Akira, T. Taga, T. Kishimoto. 1990. Biological and clinical aspects of IL-6. Immunol. Today 11:443.[Medline]
  37. Ramsay, A. J., A. J. Husband, I. A. Ramshaw, S. Bao, K. I. Matthaei, G. Koehler, M. Kopf. 1994. The role of IL-6 in mucosal IgA antibody responses in vivo. Science 264:561.[Abstract/Free Full Text]
  38. Burdin, N., C. Van Kooten, L. Galibert, J. S. Abrams, J. Wijdenes, J. Banchereau, F. Rousset. 1995. Endogenous IL-6 and IL-10 contribute to the differentiation of CD40-activated human B lymphocytes. J. Immunol. 154:2533.[Abstract]
  39. Urashima, M., D. Chauhan, M. Hatziyanni, A. Ogata, D. Hollenbaugh, A. Aruffo, K. C. Anderson. 1996. CD40L triggers IL-6 mediated B cell differentiation. Leuk. Res. 20:507.[Medline]
  40. Lomaga, M. A., W. C. Yeh, I. Sarosi, G. S. Duncan, C. Furlonger, A. Ho, S. Morony, C. Capparelli, G. Van, S. Kaufman, et al 1999. TRAF6 deficiency results in osteopetrosis and defective IL-1, CD40, and LPS signaling. Genes Dev. 13:1015.[Abstract/Free Full Text]
  41. Song, H. Y., C. H. Régnier, C. J. Kirschning, D. V. Goeddel, M. Rothe. 1997. TNF-mediated kinase cascades: bifurcation of NF-{kappa}B and JNK/SAPK pathways at TRAF2. Proc. Natl. Acad. Sci. USA 94:9792.[Abstract/Free Full Text]
  42. Baud, V., Z. Liu, B. Bennett, N. Suzuki, Y. Xia, M. Karin. 1999. Signaling by proinflammatory cytokines: oligmerization of TRAF2 and TRAF6 is sufficient for JNK and IKK activation and target gene induction via an amino-terminal effector domain. Genes Dev. 13:1297.[Abstract/Free Full Text]
  43. Kuhné, M. R., M. Robbins, J. E. Hambor, M. F. Mackey, Y. Kosaka, T. Nishimura, J. P. Gigley, R. J. Noelle, D. M. Calderhead. 1997. Assembly and regulation of the CD40 receptor complex in human B cells. J. Exp. Med. 186:337.[Abstract/Free Full Text]
  44. Paulie, S., B. Ehlin-Henriksson, H. Mellstedt, H. Koho, H. Ben-Aissa, P. Perlmann. 1985. A p50 surface antigen restricted to human urinary bladder carcinomas and B lymphocytes. Cancer Immunol. Immunother. 20:23.[Medline]
  45. van den Oord, J., A. Maes, M. Stas, J. Nuyts, S. Battocchio, A. Kasran, M. Garmyn, I. De Wever, C. De Wolf-Peeters. 1997. CD40 is a prognostic marker in primary cutaneous malignant melanoma. Am. J. Pathol. 149:1953.[Abstract]
  46. Rokhlin, O. W., G. A. Bishop, B. S. Hostager, T. J. Waldschmidt, S. P. Sidorenko, N. Pavloff, M. C. Kiefer, S. R. Umansky, R. A. Glover, M. B. Cohen. 1997. Fas-mediated apoptosis in human prostatic carcinoma cell lines. Cancer Res. 57:1758.[Abstract/Free Full Text]
  47. Kluth, B., S. Hess, H. Engelmann, S. Schafnitzel, G. Reithmüller, H. E. Feucht. 1997. Endothelial expression of CD40 in renal cell carcinoma. Cancer Res. 57:891.[Abstract/Free Full Text]
  48. Altenburg, A., S. E. Baldus, H. Smola, H. Pfister, S. Hess. 1999. CD40L-CD40 interaction induces chemokines in cervical carcinoma cells in synergism with IFN-{gamma}. J. Immunol. 162:4140.[Abstract/Free Full Text]
  49. Lapointe, R., R. Lemieux, M. Olivier, A. Darveau. 1996. Tyrosine kinase and cAMP-dependent protein kinase activities in CD40-activated human B lymphocytes. Eur. J. Immunol. 26:2376.[Medline]
  50. Ren, C. L., T. Morio, S. M. Fu, R. S. Geha. 1994. Signal transduction via CD40 involves activation of lyn kinase and phosphatidylinositol-3-kinase, and phosphorylation of phospholipase C{gamma}2. J. Exp. Med. 179:673.[Abstract/Free Full Text]
  51. Hanissian, S. H., R. S. Geha. 1997. Jak3 is associated with CD40 and is critical for CD40 induction of gene expression in B cells. Immunity 6:379.[Medline]



This article has been cited by other articles:


Home page
BloodHome page
A. L. Peters, R. M. Plenge, R. R. Graham, D. M. Altshuler, K. L. Moser, P. M. Gaffney, and G. A. Bishop
A novel polymorphism of the human CD40 receptor with enhanced function
Blood, September 1, 2008; 112(5): 1863 - 1871.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. L. Rowland, M. M. Tremblay, J. M. Ellison, L. L. Stunz, G. A. Bishop, and B. S. Hostager
A Novel Mechanism for TNFR-Associated Factor 6-Dependent CD40 Signaling
J. Immunol., October 1, 2007; 179(7): 4645 - 4653.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. E. Munroe and G. A. Bishop
A Costimulatory Function for T Cell CD40
J. Immunol., January 15, 2007; 178(2): 671 - 682.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. M. Andrade, M. Wessendarp, J.-A. C. Portillo, J.-Q. Yang, F. J. Gomez, J. E. Durbin, G. A. Bishop, and C. S. Subauste
TNF Receptor-Associated Factor 6-Dependent CD40 Signaling Primes Macrophages to Acquire Antimicrobial Activity in Response to TNF-{alpha}
J. Immunol., November 1, 2005; 175(9): 6014 - 6021.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. R. Moore and G. A. Bishop
Differential Regulation of CD40-Mediated TNF Receptor-Associated Factor Degradation in B Lymphocytes
J. Immunol., September 15, 2005; 175(6): 3780 - 3789.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Mukundan, G. A. Bishop, K. Z. Head, L. Zhang, L. M. Wahl, and J. Suttles
TNF Receptor-Associated Factor 6 Is an Essential Mediator of CD40-Activated Proinflammatory Pathways in Monocytes and Macrophages
J. Immunol., January 15, 2005; 174(2): 1081 - 1090.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. A. Green, C. L. Ahonen, W. J. Cook, and W. R. Green
CD40-Associated TRAF 6 Signaling Is Required for Disease Induction in a Retrovirus-Induced Murine Immunodeficiency
J. Virol., June 1, 2004; 78(11): 6055 - 6060.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Reyes-Moreno, J. Girouard, R. Lapointe, A. Darveau, and W. Mourad
CD40/CD40 Homodimers Are Required for CD40-induced Phosphatidylinositol 3-Kinase-dependent Expression of B7.2 by Human B Lymphocytes
J. Biol. Chem., February 27, 2004; 279(9): 7799 - 7806.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. A. Haxhinasto and G. A. Bishop
Synergistic B Cell Activation by CD40 and the B Cell Antigen Receptor: ROLE OF B LYMPHOCYTE ANTIGEN RECEPTOR-MEDIATED KINASE ACTIVATION AND TUMOR NECROSIS FACTOR RECEPTOR-ASSOCIATED FACTOR REGULATION
J. Biol. Chem., January 23, 2004; 279(4): 2575 - 2582.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. S. Hostager, S. A. Haxhinasto, S. L. Rowland, and G. A. Bishop
Tumor Necrosis Factor Receptor-associated Factor 2 (TRAF2)-deficient B Lymphocytes Reveal Novel Roles for TRAF2 in CD40 Signaling
J. Biol. Chem., November 14, 2003; 278(46): 45382 - 45390.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-J. Yeo, J.-G. Yoon, and A.-K. Yi
Myeloid Differentiation Factor 88-dependent Post-transcriptional Regulation of Cyclooxygenase-2 Expression by CpG DNA: TUMOR NECROSIS FACTOR-{alpha} RECEPTOR-ASSOCIATED FACTOR 6, A DIVERGING POINT IN THE Toll-LIKE RECEPTOR 9-SIGNALING
J. Biol. Chem., October 17, 2003; 278(42): 40590 - 40600.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Baccam, S.-Y. Woo, C. Vinson, and G. A. Bishop
CD40-Mediated Transcriptional Regulation of the IL-6 Gene in B Lymphocytes: Involvement of NF-{kappa}B, AP-1, and C/EBP
J. Immunol., March 15, 2003; 170(6): 3099 - 3108.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. M. Propst, K. Estell, and L. M. Schwiebert
CD40-mediated Activation of NF-kappa B in Airway Epithelial Cells
J. Biol. Chem., September 27, 2002; 277(40): 37054 - 37063.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Hull, G. McLean, F. Wong, P. J. Duriez, and A. Karsan
Lipopolysaccharide Signals an Endothelial Apoptosis Pathway Through TNF Receptor-Associated Factor 6-Mediated Activation of c-Jun NH2-Terminal Kinase
J. Immunol., September 1, 2002; 169(5): 2611 - 2618.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. A. Haxhinasto, B. S. Hostager, and G. A. Bishop
Cutting Edge: Molecular Mechanisms of Synergy Between CD40 and the B Cell Antigen Receptor: Role for TNF Receptor-Associated Factor 2 in Receptor Interaction
J. Immunol., August 1, 2002; 169(3): 1145 - 1149.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. A. Bishop, B. S. Hostager, and K. D. Brown
Mechanisms of TNF receptor-associated factor (TRAF) regulation in B lymphocytes
J. Leukoc. Biol., July 1, 2002; 72(1): 19 - 23.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. D. Brown, B. S. Hostager, and G. A. Bishop
Regulation of TRAF2 Signaling by Self-induced Degradation
J. Biol. Chem., May 24, 2002; 277(22): 19433 - 19438.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Mann, F. Oakley, P. W. M. Johnson, and D. A. Mann
CD40 Induces Interleukin-6 Gene Transcription in Dendritic Cells. REGULATION BY TRAF2, AP-1, NF-kappa B, AND CBF1
J. Biol. Chem., May 3, 2002; 277(19): 17125 - 17138.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
T. Yasui, M. Muraoka, Y. Takaoka-Shichijo, I. Ishida, N. Takegahara, J. Uchida, A. Kumanogoh, S. Suematsu, M. Suzuki, and H. Kikutani
Dissection of B cell differentiation during primary immune responses in mice with altered CD40 signals
Int. Immunol., March 1, 2002; 14(3): 319 - 329.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. K. Busch and G. A. Bishop
Multiple Carboxyl-Terminal Regions of the EBV Oncoprotein, Latent Membrane Protein 1, Cooperatively Regulate Signaling to B Lymphocytes Via TNF Receptor-Associated Factor (TRAF)-Dependent and TRAF-Independent Mechanisms
J. Immunol., November 15, 2001; 167(10): 5805 - 5813.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. D. Brown, B. S. Hostager, and G. A. Bishop
Differential Signaling and Tumor Necrosis Factor Receptor-associated Factor (TRAF) Degradation Mediated by CD40 and the Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1)
J. Exp. Med., April 16, 2001; 193(8): 943 - 954.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. A. Bishop, Y. Hsing, B. S. Hostager, S. V. Jalukar, L. M. Ramirez, and M. A. Tomai
Molecular Mechanisms of B Lymphocyte Activation by the Immune Response Modifier R-848
J. Immunol., November 15, 2000; 165(10): 5552 - 5557.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jalukar, S. V.
Right arrow Articles by Bishop, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jalukar, S. V.
Right arrow Articles by Bishop, G. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS