|
|
||||||||
,
Departments of
*
Microbiology and
Internal Medicine, University of Iowa, Iowa City, IA 52242; and
Veterans Affairs Medical Center, Iowa City, IA 52242
| Abstract |
|---|
|
|
|---|
B in 293 kidney
epithelial cells, no such effect was seen in B cells, suggesting that
TRAF6 has cell-type-specific functions. | Introduction |
|---|
|
|
|---|
B (9, 12, 13). However, when lymphocytes are examined, evidence has been
presented that TRAFs may neither associate with TNFR family molecules
in resting cells nor activate NF-
B in a constitutive fashion
(14), and TRAF function may thus have cell-type-specific
features.
TRAF6 consists of 522 amino acids and has a m.w. of 57,00. It shares
30% sequence identity with other TRAFs in the TRAF-C and the
Zn-binding domains (11). A role for TRAF6 in activation of
NF-
B has been reported for various receptors such as CD40
(12), IL-1 receptor (11), and hToll receptor
(15). TRAF6 has also been reported to stimulate
extracellular signal-related kinase activation in CD40 signaling along
a ras-independent pathway (16). However, all of these
experiments were done using transient transfection of non-B cells, and,
as described above, their results may not be applicable to the
functions of TRAF6 in response to CD40 signaling in B lymphocytes. We
have used two alternative approaches to study the physiologic role of
TRAF6 in CD40 signaling to B cells. In the first approach, we produced
and stably expressed in mouse B cell lines a human CD40 molecule with
two cytoplasmic domain point mutations (hCD40EEAA); this mutant fails
to bind TRAF6, while showing normal association with TRAFs 2 and 3. In
the second approach, we inducibly expressed in B cells a transfected
dominant-negative (DN) TRAF6 molecule which contains only the
C-terminal TRAF-binding domain of TRAF6. Using these complementary
approaches, we find that TRAF6 association with CD40 is important for
CD40-induced IL-6 and Ig secretion as well as B7-1 up-regulation.
Interestingly, however, CD40-mediated activation of NF-
B and c-Jun
kinase in B cells was unaffected by disrupting the CD40-TRAF6
association.
| Materials and Methods |
|---|
|
|
|---|
Mouse B cell lines CH12.LX (17) and M12.4.1 (18) were cultured in RPMI 1640 supplemented with 10% FCS, 10 µM 2-ME, and antibiotics [B cell medium (BCM) 10]. Transfected B cells were cultured in BCM-10 supplemented with 400 µg/ml geneticin (Life Technologies, Grand Island, NY). Chinese hamster ovary cells (CHO-K1) obtained from the American Type Culture Collection (Manassas, VA) were cultured in DMEM (high glucose) supplemented with 10% FCS, 10 µM 2-ME, 1x MEM non-essential amino acids (Sigma, St. Louis, MO), and antibiotics (MEM culture medium (MCM)-10). CHO cells transfected with a plasmid encoding the mouse CD40 ligand CD154 (19) were cultured in MCM-10 supplemented with 1 mg/ml geneticin. CHO cells transfected with a plasmid encoding human CD154 were a kind gift from Dr. Amelia Black (IDEC Pharmaceuticals, San Diego, CA) and were cultured in CHO-S-SFM II (Life Technologies) supplemented with 50 nM methotrexate. Embryonic kidney epithelial cell lines 293 and 293-T were cultivated in MCM-10.
Construction of DNTRAF6 and hCD40EEAA
Flag-tagged DNTRAF6 consists of the C-terminal 228 amino acids of TRAF6, corresponding to the TRAF-binding domain but lacking the Zn fingers and the RING finger. DNTRAF6 and WTTRAF6 were prepared by PCR amplification of cDNA from M12 cells. For DNTRAF6, CCGTCGACATGGAAACTATCAAACAGTTGGAGAGTC and CCTCTAGATTGAACACAAGTACATGGACGC primers and for wild-type (WT) TRAF6, GGGTCGACATGAGTCTCTTAAACTGTGAGAAC and CCGAATGGTCCGTTTGAGCTC primers were used, and cDNA from M12.4.1 was used as a template. Amplified cDNA was inserted into the mammalian expression vector pRSV.5(neo) (20) for constitutive expression or the plasmid pOPRSVI.mcs1 (19) for inducible expression of DNTRAF6. Mutant hCD40EEAA, in which two glutamic acid residues at positions 232 and 235 were substituted by alanines, was PCR amplified using oligonucleotide primers containing appropriately positioned point mutations and phCD40.neo (21) as a template. The PCR product was inserted into pRSV.5(neo). DNA sequencing confirmed that all PCR products were free of any undesired mutations. FLAG-tagged TRAF2 and hemagglutinin (HA)-tagged TRAF3 constructs have been described previously (22).
Generation of mouse B cell transfectants
M12.4.1 and CH12.LX stable transfectants constitutively
expressing lac repressor (LacI) have been described previously
(19, 23). Super transfection of CH12.LAC and M12.LAC with
DNTRAF6 and transfection of CH12.LX and M12.4.1 with hCD40EEAA
constructs was conducted using electroporation as previously described
(24). Geneticin-resistant clones were analyzed for
expression of DNTRAF6 and hCD40EEAA using intracellular or surface
membrane immunofluorescence staining, with analysis by flow cytometry
on a FACScan (Becton Dickinson, Mountain View, CA) flow cytometer, as
described (21, 22). Induction of inducible DNTRAF6
expression was accomplished by incubation of transfectants with 100
µM isopropylthio-
-D-galactoside (IPTG) for 48 h
as described previously (19, 23). Generation of B cell
transfectants expressing WThCD40 has been described previously
(21).
Abs and reagents
A mAb specific for the FLAG epitope tag was purchased from
Eastman Kodak (New Haven, CT). Anti-HA epitope tag Ab was purchased
from Babco (Richmond, CA). Anti-mouse IgG-HRP was purchased from
Bio-Rad (Hercules, CA). Recombinant mouse IL-6 and the mAbs 16/10A1
(fluorescein-conjugated anti-mouse B7-1, hamster IgG), G235-2356
(antitrinitrophenyl, isotype control, hamster IgG), Jo2 (anti-mouse
Fas, hamster IgG) were purchased from PharMingen (San Diego, CA). Goat
anti-hamster IgG-FITC was purchased from Jackson ImmunoResearch
Laboratories (West Grove, PA). MOPC-21, streptavidin-HRP, and luciferin
were purchased from Sigma (St. Louis, MO). Goat anti-mouse
IgG1-FITC and goat anti-rat IgG-FITC were purchased from Southern
Biotechnology Associates (Birmingham, AL). The following hybridomas
were purchased from the American Type Culture Collection (ATCC) or were
generous gifts from the indicated individuals: G285 (anti-human
CD40, mouse IgG1; ATCC); M17/4.4.11.9 (anti-mouse LFA-1
, rat
IgG2a; ATCC); YN1/1.74 (anti-mouse ICAM-1, rat IgG2a; ATCC);
UC8169 (hamster IgG, isotype control; ATCC); 20F3.11 and 32C11.4
(anti-mouse IL-6, rat IgG; ATCC); 1C10 (anti-mouse CD40, rat
IgG2a) from Dr. Frances Lund (Trudeau Institute, Saranac Lake, NY), and
EM95.3 (anti-mouse IgE, rat IgG2a) from Dr. Thomas Waldschmidt
(University of Iowa, Iowa City, IA).
Binding studies
Transient transfection of 293-T cells was performed by calcium phosphate precipitation (22) with the indicated constructs. Cells were harvested 3648 h after transfection and lysed in 400 µl of lysis buffer [1% Triton X-100, 150 mm NaCl, 20 mM HEPES (pH 7.0), 0.4 mM EDTA, and protease inhibitors; Boehringer Mannheim, Indianapolis, IN] for 30 min on ice. The lysates were centrifuged at 14, 000 x g for 15 min at 4°C, and 370 µl of the supernatants was immunoprecipitated with anti-hCD40-coated protein G-agarose beads for 1.5 h at 4°C. The beads were washed four times with lysis buffer, resolved by SDS-PAGE, and protein bands were transferred to nitrocellulose. Subsequent immunoblotting was performed with anti-FLAG mAb (for TRAFs 2 and 6) or anti-HA (for TRAF3) Ab followed by HRP-labeled goat anti-mouse IgG Ab, as previously described. Protein bands were visualized using a chemiluminescent detection system (Pierce, Rockford, IL).
Analysis of surface molecule up-regulation
M12.4.1 transfectants (105) expressing DNTRAF6 (induced with 100 µM IPTG for 24 h) or hCD40EEAA were stimulated with 2 µg of anti-CD40 mAbs or isotype control Ab for 72 h in a volume of 2 ml. Surface expression of B7-1, ICAM-1, LFA-1, and Fas was determined by flow cytometry as described previously (21).
IL-6 secretion
Transfected CH12.LX cells (1 x 105) plus untransfected CHO-K1, CHO-mouse CD154, or CHO-hCD154 cells were cocultured at a ratio of B cells:CHO cell (4:1) with or without IPTG in BCM-10 for 48 h, and the supernatants were quantitated for secreted IL-6 by ELISA as described (19). Values given represent the mean ± SE of triplicate wells. Exogenous IL-6 (10 ng/ml) and anti-IL-6 mAbs (10 µg/ml) were used at previously determined saturating concentrations.
Ab secretion assay
CH12.LX cells express surface and secreted IgM specific for phosphatidylcholine, an Ag found on the surface of sheep RBC (25). IgM secretion by CH12.LX transfectants was determined as described previously (26). Briefly, cells were preincubated with or without 100 µM IPTG for 24 h for transfectants expressing inducible DNTRAF6 followed by incubation with the indicated stimuli for 48 h. Cells expressing hCD40EEAA were stimulated for a total of 72 h. To study the role of IL-6 in Ab secretion, cells were stimulated in the presence or absence of either blocking or nonblocking IL-6 Abs or in the presence of exogenous recombinant mouse IL-6. The number of IgM-secreting cells/106 viable recovered cells was enumerated as cells able to form lytic plaques on a lawn of sheep RBC as described (26). Sheep erythrocytes used as a source of phosphatidylcholine Ag were purchased from Elmira Biologicals (Iowa City, IA).
Nuclear protein extraction and EMSA
Both nuclear protein extraction and EMSA were performed as
described previously (14). Briefly,
107 viable cells, previously induced with 100
µM IPTG for 48 h when indicated, were stimulated with 1 µg/ml
of anti-CD40 Ab or isotype control Ab for 1.5 h at a
concentration of 106 cells/ml. Cells were lysed
and nuclear extracts were prepared as described previously
(14). The extracts were stored at -70°C in the presence
of protease inhibitors (Mini Complete; Boehringer Mannheim). The
double-stranded NF-
B probe, previously described (14),
was end labeled with [
-32P]ATP using T4
polynucleotide kinase. A total of 5 µg of nuclear extract was
incubated with 0.250.5 ng of probe for 30 min at room temperature.
The samples were resolved on a 5% native polyacrylamide gel at a
constant current of 20 mA. The gel was dried and exposed to x-ray film
overnight at -70°C.
Reporter gene assay
M12.4.1 stable transfectants (induced for 24 h with 100
µM IPTG in the case of cells expressing DNTRAF6) were transiently
transfected by electroporation with 5 µg of CMV-
-galactosidase
(
-gal) construct and 10 µg of a luciferase reporter construct
(4xI
B-Luc) under the control of four NF-
B binding sites and a
minimal promoter as previously described (14). 293 cells
were transiently transfected with 1 µg each of CMV-
-gal construct
and 4xI
B-Luc construct, 5 µg of various TRAF6 expression vectors,
and 1 µg of WT hCD40 construct by calcium phosphate precipitation.
The total amount of DNA transfected into 293 cells was always adjusted
to 8 µg with a control expression vector. Viable M12.4.1 and 293
cells (5 x 105) were stimulated in
triplicate 24 h after transfection with 1 µg/ml anti-mCD40,
anti-hCD40, or isotype control Ab for 24 h at 37°C. Cells
were assayed for luciferase activity, as described previously
(14), with a luminometer (TD-20/20; Turner Designs,
Sunnyvale, CA) immediately after the addition of 100 µl of 1 mM
luciferin.
-gal activity was assayed using a Galacto-Light-Plus
assay system (Tropix, Bedford, MA) and was used to normalize luciferase
activity to correct for transfection efficiency.
Assays for activity of c-Jun kinase
M12.4.1 transfectants (2 x 106) were stimulated with 1 µg/ml anti-mCD40, anti-hCD40, or isotype control Ab for 5 min or with 0.6 M sorbitol for 20 min at 37°C and c-Jun kinase activity was measured as described previously (27). Samples were resolved by SDS-PAGE, and phosphorylated c-Jun was visualized by autoradiography.
| Results |
|---|
|
|
|---|
An inducible expression system was used for DNTRAF6 to enable
comparison of various functions of the same transfected B cell clone in
the presence or absence of DNTRAF6 expression, as well as to avoid any
long-term toxic effects of constitutive expression of a negative
signaling protein. DNTRAF6 expression was induced in the mouse B cell
lines M12.LAC and CH12.LAC by incubation with IPTG for 2448 h (Fig. 1
). Expression of DNTRAF6 had no effect
on expression of CD40 (data not shown). hCD40EEAA was expressed
constitutively in M12.4.1 and CH12.LX transfectants. The level of
expression of the mutant hCD40 molecule was determined by flow
cytometry (Fig. 1
). Clones were selected for expression similar to that
of WThCD40 on previously transfected subclones (last
panel).
|
The cytoplasmic domain of CD40 has an overlapping binding site for
TRAFs 2, 3, and 5, and a distinct binding site for TRAF6
(10). Pullen et al. (10) have reported that an 8-mer
peptide, QEPQEINF, derived from amino acids 231238 of hCD40 binds
TRAF6. To analyze the specific role of TRAF6 binding in CD40-mediated
signaling to B cells, we generated an hCD40 mutant molecule
in which two glutamic acid residues at position 232 and 235 were
substituted with alanines. We determined the ability of this molecule
to bind TRAFs 2, 3, and 6 in comparison to the WThCD40 molecule. We
were unable to immunoblot for endogenous WTTRAF6 during our
binding experiments because commercially available Abs to mouse TRAF6
showed no reactivity on Western blots. To circumvent this problem, we
transiently expressed our DNTRAF6 construct for these experiments. We
coexpressed either WT or hCD40EEAA with TRAFs 2 and 3 or DNTRAF6 in an
epithelial cell line, 293-T, immunoprecipitated hCD40, and blotted
for the different TRAFs. Association of TRAFs 2 and 3 with
hCD40EEAA was similar to that of WThCD40. However, DNTRAF6 did not
associate with hCD40EEAA (Fig. 2
).
|
CD40 signaling has been shown to induce IL-6 secretion in B cells
(4), including the mouse B cell line CH12.LX
(19). Previous studies in our laboratory have found that a
deletion mutant of CD40, lacking 32 amino acids from the cytoplasmic
tail (hCD40
32), cannot bind TRAFs 2 and 3 (22).
However, hCD40
32 induces IL-6 secretion comparable to that induced
by WThCD40 (28). The TRAF6 binding site in hCD40
32 is
still intact, but a further-truncated molecule, hCD40
55, cannot
induce IL-6 secretion and lacks the TRAF6 binding site
(28). Thus, we postulated that CD40-mediated IL-6
secretion might require TRAF6. Data presented in Fig. 3
A show that hCD40EEAA
stimulated 75% less IL-6 secretion upon engagement with CHO-hCD154
cells as compared with IL-6 secreted upon engagement of the WThCD40
molecule. IL-6 production induced via WThCD40 is always considerably
higher than that induced by mouse CD40, as we have previously shown
(28). Two likely possibilities account for this. First,
the expression of human CD40 molecules achieved via transfection is
always significantly higher than that of endogenous mouse CD40 on our B
cell subclones, and, second, for unknown reasons, the expression of
human CD154 on the transfected CHO cells we use for a stimulus for IL-6
production is higher than the maximum expression of mouse CD154 we
could achieve on CHO transfectants. Thus, a combination of lower
amounts of stimulating ligand and lower receptor expression may account
for the lower IL-6 production. Importantly, however, both of these
transfectants secreted comparable levels of IL-6 when stimulated with
CHO-mouse CD154 cells. This control indicates that the two cell lines
are similar in their inherent ability to secrete IL-6 in response to a
mouse CD40 signal. A similar although less pronounced defect was seen
in CH12.LAC cells inducibly expressing DNTRAF6. IL-6 secretion was
reproducibly
25% lower when expression of DNTRAF6 was induced by
IPTG (Fig. 3
B). The more dramatic effect seen with hCD40EEAA
compared with DNTRAF6 may reflect the complete lack of TRAF6 binding to
hCD40EEAA compared with the competition for TRAF6 binding achievable
using DNTRAF6. Because presently there is not a reliable Ab which
detects endogenous TRAF6 in cells, we were unable to determine the
relative level of expression of transfected DNTRAF6 vs endogenous
WTTRAF6 in the B cells, and therefore cannot precisely
quantitate the degree of competition that DNTRAF6 provides for
endogenous TRAF6 binding to CD40.
|
CD40 signaling leads to Ab secretion in CH12.LX cells and can
synergize with B cell Ag receptor (BCR) signaling to enhance Ab
secretion (29). There are no previous reports on the role
of TRAF6 in CD40-mediated Ab secretion. However, it has been previously
shown that both CD40 signals and exogenously added IL-6 induce CH12.LX
to secrete Ab, and both signals are enhanced by BCR signaling
(19, 30). Thus, it was of interest to determine whether
TRAF6 is also involved in CD40-mediated Ab production. CH12.LX cells
expressing either WThCD40 or hCD40EEAA were stimulated through their
endogenous mCD40 molecules or through the transfected hCD40 molecule in
the presence or absence of Ag, and Ab-secreting cells were enumerated
as plaque-forming cells on a lawn of sheep RBC. Ab secretion stimulated
by hCD40EEAA was decreased
75% in comparison to that stimulated in
cells expressing WThCD40 (Fig. 4
A). However, the ability of
hCD40EEAA transfectants to secrete IgM in response to mCD40 was normal.
We also saw synergy with BCR signaling by hCD40EEAA, but it was not
enough to reverse the signaling defect. Similarly, when CH12.LAC cells
inducibly expressing DNTRAF6 were stimulated with anti-mCD40 Ab in
the presence of IPTG, Ab secretion was 75% lower (Fig. 4
B)
compared with the uninduced cells. Once again, synergy with BCR
signaling was seen but was not sufficient to reverse the signaling
defect. Thus, TRAF6 binding is important for CD40-mediated Ab secretion
in B cells.
|
50% when cells were incubated with CD154 (Fig. 5
|
We have previously demonstrated that CD40 stimulation of M12.4.1
leads to up-regulation of a number of B cell surface molecules
including adhesion molecules and the costimulatory molecule B7-1
(21). Thus, we compared surface molecule up-regulation in
B cells stimulated through either the endogenous mCD40 molecule or the
transfected hCD40 molecule. CD40-mediated up-regulation of B7-1 was
decreased by 50% upon stimulation through hCD40EEAA as compared with
the endogenous mCD40 stimulation (Fig. 6
). Up-regulation of LFA-1, ICAM-1, and
Fas was unaffected (data not shown). Induced expression of DNTRAF6 in
M12.4.1 transfectants did not result in any significant effect on
up-regulation of these surface molecules including B7-1 (data not
shown). As discussed above, this may be due to insufficient competition
for endogenous WTTRAF6 by the DNTRAF6, particularly as the effect of
the hCD40EEAA mutation was less drastic on B7 up-regulation than on
IL-6 and Ab secretion, suggesting that B7 up-regulation may be less
dependent upon TRAF6.
|
B
activation in B cells
TRAF6 has been reported to be involved in CD40-mediated NF-
B
activation (16, 31). However, these studies were performed
in either 293 kidney epithelial cells or in Jurkat T cells, cell lines
which normally do not express CD40. In addition, although studies in
293 cells indicated that TRAF2 also plays an important role in
CD40-mediated NF-
B activation (9), subsequent
experiments performed in mice (32, 33) and in B
lymphocytes (14) showed that in cells which normally
express CD40, TRAF2 is not required for CD40-mediated NF-
B
activation. Thus, to study the role of TRAF6 in CD40-mediated NF-
B
activation in B cells, we first examined nuclear translocation of
NF-
B in M12.4.1 cells expressing hCD40EEAA. Nuclear translocation of
NF-
B in M12.4.1 cells was similar in cells stimulated through
endogenous mCD40 or the transfected hCD40EEAA molecule (Fig. 7
A). Also, no difference in
NF-
B translocation was seen when M12.4.1 cells were induced to
express DNTRAF6 compared with the uninduced cells (Fig. 7
B).
Similar results were seen using CH12.LX cells (data not shown).
|
B-induced transcription, M12.4.1
transfectants expressing hCD40EEAA or WThCD40 were transiently
transfected with a NF-
B reporter construct and then stimulated
through the endogenous mCD40 or the hCD40 molecule. No difference in
activation of the reporter gene was seen by hCD40 signaling vs mCD40
signaling (Fig. 8
B in B
lymphocytes. These results are in direct contrast to what has been
reported previously in non-B cells (31); therefore, we
repeated our experiments in 293 epithelial cells. Transient expression
of DNTRAF6 alone in 293 cells decreased NF-
B activation below the
basal level. Expression of WTTRAF6 or WThCD40 increased NF-
B
activation, and coexpression of both gave an additive effect (Fig. 8
B reporter than did WThCD40,
there was still a cooperative effect with TRAF6, although hCD40EEAA
does not detectably bind TRAF6. These findings suggest that TRAF6
function in CD40-mediated signaling differs at least partially between
B lymphocytes and epithelial or T cells, and reinforces the need to
study CD40 signaling in lymphocytes to completely understand its
function in these cells.
|
CD40 is known to activate c-Jun NH2-terminal
kinase (JNK) in B cells (23). To determine the role of
TRAF6 in CD40-mediated JNK activation, M12.4.1 cells expressing
hCD40EEAA were stimulated through the endogenous mCD40 or through the
transfected hCD40EEAA. JNK activation was comparable when cells were
stimulated through either receptor showing that CD40-mediated
activation of JNK was independent of TRAF6 (Fig. 9
A). Similar results were
obtained in M12.4.1 cells inducibly expressing DNTRAF6 (Fig,
9B). Similar results were found in CH12.LX cells (data not
shown).
|
| Discussion |
|---|
|
|
|---|
Our results further reveal a connection between CD40-mediated IL-6
production and Ab secretion, linked by a requirement for TRAF6 binding
to CD40. Previous reports, including those from our own laboratory,
have linked IL-6 with B cell differentiation (30, 34, 35, 36, 37).
Other reports have shown that IL-6 secretion is induced by CD40
signaling in B cells (4, 19), and have suggested a
connection between CD40-mediated IL-6 production and the induction of B
cell differentiation (38, 39). Data presented here show
that preventing TRAF6 from binding to CD40 decreased both IL-6
secretion (Fig. 3
) and Ab secretion (Figs. 4
and 5
) by
75%. That
this similarity in effect is likely to be causal rather than
coincidental is demonstrated by the findings that addition of exogenous
IL-6 reversed the inhibition of differentiation seen when CD40 is
stimulated in cells induced to express DNTRAF6, but exogenous IL-6 did
not further increase CD40-mediated Ab secretion in cells that do not
express DNTRAF6. Consistent with these findings, addition of blocking
Ab to IL-6 did not further decrease DNTRAF6-induced inhibition of
differentiation. Data in Fig. 5
also show that CD40-mediated Ab
secretion is partially TRAF6 and IL-6 independent. Addition of
saturating amounts of exogenous IL-6 could not produce the same amount
of Ab secretion as the CD40 signal itself, nor could inhibition of
either IL-6 secretion (Fig. 5
) or TRAF6 binding (Fig. 4
) completely
eliminate CD40-mediated Ab secretion. In addition, CD40 molecules which
cannot detectably bind TRAF6 (hCD40EEAA) were still able to stimulate
IL-6 production above basal levels (Fig. 3
). Although this result may
indicate that hCD40EEAA is able to bind an undetectable but
biologically significant amount of TRAF6, it is at least as likely that
CD40-stimulated IL-6 production is partially TRAF6 independent.
A major function attributed to TRAF molecules, based principally upon
studies performed in transiently transfected 293 epithelial cells, has
been the activation of the transcription factor NF-
B, and several
studies have reported that TRAF6 plays a role in CD40-mediated
activation of NF-
B in 293 cells (16, 31). Although we
could reproduce these results in 293 cells, our experiments in B cells
indicate the lack of a critical role for TRAF6 in CD40-mediated NF-
B
activation (Figs. 7
and 8
). While this manuscript was in preparation,
Lomaga et al. (40) reported that CD40-mediated
proliferation and NF-
B activation were impaired in splenocytes
obtained from TRAF6-deficient mice. However, these mice have low
perinatal and postnatal survival, and before death show enlarged
spleens. The number, developmental stage, subset composition, or
phenotype (including level of CD40 expression) of B cells in the
TRAF6-/- mice was not described. Thus, it is
difficult to know whether their loss of NF-
B activation is a direct
or indirect effect of TRAF6 deficiency. TRAF6-induced JNK activation in
293 epithelial cells has also been reported (41, 42).
However, our results suggest that CD40-mediated JNK activation in B
cells does not absolutely require TRAF6 binding.
We believe the most likely explanation for the partial discordance in
the results of CD40-signaling assays in various cells is that different
cell types have overlapping but distinct CD40-signaling pathways. This
explanation is consistent with previous findings that TRAF2 appears to
be very important for NF-
B activation in non-B cells
(9) but not in B cells (14, 32, 33). In
addition, TRAF molecules associate constitutively with TNFR family
molecules in transiently transfected 293 cells, but this does not
appear to be the case in B cells (43). This distinction
between CD40 function on cells that normally express it and those that
do not may have considerable functional significance. CD40 was
originally identified as an Ag expressed on normal B cells and
malignant bladder carcinoma cells (44), and CD40
expression has been reported on melanoma cells (45) as
well as prostate, renal, and cervical carcinomas (46, 47, 48).
This raises the intriguing possibility that when CD40 expression is
induced on nonhematopoietic cells, particularly those of epithelial
origin, cell type-specific consequences of CD40 signaling may
contribute to cellular transformation.
The two most reproducible early signaling events documented in B cells
following CD40 engagement are the activation of JNK and activation of
NF-
B, neither of which were noticeably affected in our study by
preventing TRAF6 from binding to CD40. However, a loss or decrease in
TRAF6 binding was clearly able to inhibit CD40-mediated IL-6 secretion,
differentiation, and B7 up-regulation, indicating that TRAF6
participates significantly in CD40 signaling. Other events reported to
result from CD40 signaling to B cells include activation of protein
tyrosine kinases (49, 50), phosphatidyl inositol 3-kinase,
phospholipase C
2 (50), and Jak 3 (51).
Determining which of these events is triggered by TRAF6 will be the
subject of future investigation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Gail A. Bishop, University of Iowa, Department of Microbiology, 3-570 BSB, Iowa City, IA 52242. E-mail address: ![]()
3 Abbreviations used in this paper: TNFR, TNF receptor; BCM, B cell medium; DN, dominant negative; h, human; m, mouse; HA, hemagglutinin; IPTG, isopropylthio-
-D-galactoside;
-gal,
-galactosidase; CHO, Chinese hamster ovary; BCR, B cell Ag receptor; JNK, c-Jun NH2-terminal kinase; TRAF, TNF receptor-associated factor; WT, wild type; MCM, MEM culture medium. ![]()
Received for publication July 16, 1999. Accepted for publication October 28, 1999.
| References |
|---|
|
|
|---|
B by TNF receptor 2 and CD40. Science 269:1424.
B and putative signal transducer for the LT-
receptor. J. Biol. Chem. 271:14661.
B activation in lymphocytes. J. Immunol. 159:4898.[Abstract]
B and JNK/SAPK activation upstream of TRAF6. J. Exp. Med. 187:2097.
B activation by a distinct subset of CD40-mediated effector functions in B lymphocytes. J. Immunol. 162:2804.
B independent B cell IL-6 production. Eur. J. Immunol. 29:3855.[Medline]
B activation, and increased sensitivity to TNF-induced cell death in TRAF2-deficient mice. Immunity 7:715.[Medline]
B activation and regulates lymphocyte proliferation and survival. Immunity 7:701.
B and JNK/SAPK pathways at TRAF2. Proc. Natl. Acad. Sci. USA 94:9792.
. J. Immunol. 162:4140.
2. J. Exp. Med. 179:673.This article has been cited by other articles:
![]() |
A. L. Peters, R. M. Plenge, R. R. Graham, D. M. Altshuler, K. L. Moser, P. M. Gaffney, and G. A. Bishop A novel polymorphism of the human CD40 receptor with enhanced function Blood, September 1, 2008; 112(5): 1863 - 1871. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Rowland, M. M. Tremblay, J. M. Ellison, L. L. Stunz, G. A. Bishop, and B. S. Hostager A Novel Mechanism for TNFR-Associated Factor 6-Dependent CD40 Signaling J. Immunol., October 1, 2007; 179(7): 4645 - 4653. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Munroe and G. A. Bishop A Costimulatory Function for T Cell CD40 J. Immunol., January 15, 2007; 178(2): 671 - 682. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Andrade, M. Wessendarp, J.-A. C. Portillo, J.-Q. Yang, F. J. Gomez, J. E. Durbin, G. A. Bishop, and C. S. Subauste TNF Receptor-Associated Factor 6-Dependent CD40 Signaling Primes Macrophages to Acquire Antimicrobial Activity in Response to TNF-{alpha} J. Immunol., November 1, 2005; 175(9): 6014 - 6021. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Moore and G. A. Bishop Differential Regulation of CD40-Mediated TNF Receptor-Associated Factor Degradation in B Lymphocytes J. Immunol., September 15, 2005; 175(6): 3780 - 3789. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Mukundan, G. A. Bishop, K. Z. Head, L. Zhang, L. M. Wahl, and J. Suttles TNF Receptor-Associated Factor 6 Is an Essential Mediator of CD40-Activated Proinflammatory Pathways in Monocytes and Macrophages J. Immunol., January 15, 2005; 174(2): 1081 - 1090. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Green, C. L. Ahonen, W. J. Cook, and W. R. Green CD40-Associated TRAF 6 Signaling Is Required for Disease Induction in a Retrovirus-Induced Murine Immunodeficiency J. Virol., June 1, 2004; 78(11): 6055 - 6060. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Reyes-Moreno, J. Girouard, R. Lapointe, A. Darveau, and W. Mourad CD40/CD40 Homodimers Are Required for CD40-induced Phosphatidylinositol 3-Kinase-dependent Expression of B7.2 by Human B Lymphocytes J. Biol. Chem., February 27, 2004; 279(9): 7799 - 7806. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Haxhinasto and G. A. Bishop Synergistic B Cell Activation by CD40 and the B Cell Antigen Receptor: ROLE OF B LYMPHOCYTE ANTIGEN RECEPTOR-MEDIATED KINASE ACTIVATION AND TUMOR NECROSIS FACTOR RECEPTOR-ASSOCIATED FACTOR REGULATION J. Biol. Chem., January 23, 2004; 279(4): 2575 - 2582. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Hostager, S. A. Haxhinasto, S. L. Rowland, and G. A. Bishop Tumor Necrosis Factor Receptor-associated Factor 2 (TRAF2)-deficient B Lymphocytes Reveal Novel Roles for TRAF2 in CD40 Signaling J. Biol. Chem., November 14, 2003; 278(46): 45382 - 45390. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-J. Yeo, J.-G. Yoon, and A.-K. Yi Myeloid Differentiation Factor 88-dependent Post-transcriptional Regulation of Cyclooxygenase-2 Expression by CpG DNA: TUMOR NECROSIS FACTOR-{alpha} RECEPTOR-ASSOCIATED FACTOR 6, A DIVERGING POINT IN THE Toll-LIKE RECEPTOR 9-SIGNALING J. Biol. Chem., October 17, 2003; 278(42): 40590 - 40600. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Baccam, S.-Y. Woo, C. Vinson, and G. A. Bishop CD40-Mediated Transcriptional Regulation of the IL-6 Gene in B Lymphocytes: Involvement of NF-{kappa}B, AP-1, and C/EBP J. Immunol., March 15, 2003; 170(6): 3099 - 3108. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Propst, K. Estell, and L. M. Schwiebert CD40-mediated Activation of NF-kappa B in Airway Epithelial Cells J. Biol. Chem., September 27, 2002; 277(40): 37054 - 37063. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hull, G. McLean, F. Wong, P. J. Duriez, and A. Karsan Lipopolysaccharide Signals an Endothelial Apoptosis Pathway Through TNF Receptor-Associated Factor 6-Mediated Activation of c-Jun NH2-Terminal Kinase J. Immunol., September 1, 2002; 169(5): 2611 - 2618. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Haxhinasto, B. S. Hostager, and G. A. Bishop Cutting Edge: Molecular Mechanisms of Synergy Between CD40 and the B Cell Antigen Receptor: Role for TNF Receptor-Associated Factor 2 in Receptor Interaction J. Immunol., August 1, 2002; 169(3): 1145 - 1149. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Bishop, B. S. Hostager, and K. D. Brown Mechanisms of TNF receptor-associated factor (TRAF) regulation in B lymphocytes J. Leukoc. Biol., July 1, 2002; 72(1): 19 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Brown, B. S. Hostager, and G. A. Bishop Regulation of TRAF2 Signaling by Self-induced Degradation J. Biol. Chem., May 24, 2002; 277(22): 19433 - 19438. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mann, F. Oakley, P. W. M. Johnson, and D. A. Mann CD40 Induces Interleukin-6 Gene Transcription in Dendritic Cells. REGULATION BY TRAF2, AP-1, NF-kappa B, AND CBF1 J. Biol. Chem., May 3, 2002; 277(19): 17125 - 17138. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yasui, M. Muraoka, Y. Takaoka-Shichijo, I. Ishida, N. Takegahara, J. Uchida, A. Kumanogoh, S. Suematsu, M. Suzuki, and H. Kikutani Dissection of B cell differentiation during primary immune responses in mice with altered CD40 signals Int. Immunol., March 1, 2002; 14(3): 319 - 329. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. K. Busch and G. A. Bishop Multiple Carboxyl-Terminal Regions of the EBV Oncoprotein, Latent Membrane Protein 1, Cooperatively Regulate Signaling to B Lymphocytes Via TNF Receptor-Associated Factor (TRAF)-Dependent and TRAF-Independent Mechanisms J. Immunol., November 15, 2001; 167(10): 5805 - 5813. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Brown, B. S. Hostager, and G. A. Bishop Differential Signaling and Tumor Necrosis Factor Receptor-Associated Factor (Traf) Degradation Mediated by Cd40 and the Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (Lmp1) J. Exp. Med., April 16, 2001; 193(8): 943 - 954. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Bishop, Y. Hsing, B. S. Hostager, S. V. Jalukar, L. M. Ramirez, and M. A. Tomai Molecular Mechanisms of B Lymphocyte Activation by the Immune Response Modifier R-848 J. Immunol., November 15, 2000; 165(10): 5552 - 5557. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |