The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hayashida, K.
Right arrow Articles by Lipsky, P. E
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hayashida, K.
Right arrow Articles by Lipsky, P. E
The Journal of Immunology, 2000, 164: 1110-1116.
Copyright © 2000 by The American Association of Immunologists

Rheumatoid Arthritis Synovial Stromal Cells Inhibit Apoptosis and Up-Regulate Bcl-xL Expression by B Cells in a CD49/CD29-CD106-Dependent Mechanism1

Kenji Hayashida*, Yasunori Shimaoka{dagger}, Takahiro Ochi{dagger} and Peter E Lipsky2,*

* University of Texas Southwestern Medical Center, Dallas, TX 75235; and {dagger} Osaka University Medical School, Osaka, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inflammatory sites, such as rheumatoid arthritis (RA) synovial tissue, contain large numbers of activated B cells and plasma cells. However, the mechanisms maintaining B cell viability and promoting their differentiation are not known, but interactions with stromal cells may play a role. To examine this, purified human peripheral B cells were cultured with a stromal cell line (SCL) derived from RA synovial tissue, and the effects on apoptosis and expression of Bcl-2-related proteins were analyzed. As a control, B cells were also cultured with SCL from osteoarthritis synovium or skin fibroblasts. B cells cultured with medium alone underwent spontaneous apoptosis. However, B cells cultured with RA SCL cells exhibited less apoptosis and greater viability. Although SCL from osteoarthritis synovium and skin fibroblasts also rescued B cells from apoptosis, they were less effective than RA SCL. B cell expression of Bcl-xL was markedly increased by RA SCL in a contact-dependent manner, whereas B cell expression of Bcl-2 was unaffected. Protection of B cells from apoptosis and up-regulation of Bcl-xL by RA SCL were both blocked by mAbs to CD106 (VCAM-1), but not CD54 (ICAM-1). Furthermore, cross-linking of CD49d/CD29 (very late Ag-4) on the surface of B cells rescued them from apoptosis and up-regulated Bcl-xL expression. These results indicate that SCL derived from RA synovial tissue play a role in promoting B cell survival by inducing Bcl-xL expression and blocking B cell apoptosis in a CD49d/CD29-CD106-dependent manner.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The synovial tissue in rheumatoid arthritis (RA)3 is characterized by infiltration with a variety of inflammatory cells, including T cells, B cells, and plasma cells (1). The lymphocyte accumulation in synovial tissue might be induced by an increased migration from peripheral blood, proliferation of these cells in situ, and/or inhibition of cell death. Increased migration into the synovium has been suggested (2, 3), whereas local proliferation appears to be minimal (4). Programmed cell death is limited in the synovium and rarely involves lymphocytes (5). Therefore, the limited programmed cell death of lymphocytes may contribute to their accumulation in the synovium. A number of mechanisms have been proposed to account for the apparently diminished apoptosis of lymphocytes, including the action of cytokines (6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17), the presence of inhibitors of apoptosis, such as soluble CD95 and Fas ligand (18, 19), and the direct impact of cell-to-cell contact (20). Among the cells that appear to be active in blocking lymphocyte apoptosis is a population of stromal cells with the characteristics of thymus and bone marrow nurse cells (21, 22). Previous studies documented that these stromal cell lines (SCL) blocked B cell apoptosis in vitro (22). The current studies examined the mechanism by which B cells were rescued from apoptosis and demonstrated that SCL derived from RA synovium induced expression of the antiapoptotic protein, Bcl-xL, by a mechanism that involved cell-to-cell contact mediated by CD49d/CD29-CD106 interactions.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Antibodies and reagents

Biotinylated mouse anti-human CD19 mAb and mouse anti-human CD29 mAb (4B4) were purchased from Coulter (Miami, FL). Mouse anti-human CD20 mAb conjugated with PE, goat anti-mouse IgG conjugated with FITC, mouse anti-human CD14 mAb conjugated with FITC, goat anti-mouse IgG, and goat anti-rabbit IgG conjugated with HRP were obtained from Sigma (St. Louis, MO). Mouse anti-human CD49d mAb (HP2/1) and mouse anti-human CD106 mAb (1.G11B1) were purchased from Immunotech (Miami, FL) and Serotec (Oxford, U.K.), respectively. Mouse IgG1 (MOPC) mAb, mouse anti-human IgM heavy chain (DA4.4) conjugated with biotin, mouse anti-human CD11a mAb (TS1/22), and mouse anti-human CD18 mAb (TS1/18) were prepared from hybridoma cell lines purchased from American Type Culture Collection (Manassas, VA). Mouse anti-human CD54 mAb (R6.5) was a gift from Dr. R. Rothlein (Boehringer Ingelheim Pharmaceuticals, Ridgefield, CT). Rabbit anti-human Bcl-2 (C-21) and Bcl-xS/L (L-19) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Propidium iodide and streptavidin were purchased from Sigma. Triazol reagent, DNase I, and SuperScript II reverse transcriptase were obtained from Life Technologies (Frederick, MD). Taq polymerase was obtained from Promega (Madison, WI). Oligo(dT) and Ficoll/Isopaque were purchased from Pharmacia (Piscataway, NJ). DMEM with high glucose, RPMI 1640, and FBS were purchased from Life Technologies. The protein assay system, polyvinylidene difluoride membranes, and Zeta-Probe blotting membranes were purchased from Bio-Rad (Richmond, CA). ECL was purchased from Amersham (Aylesbury, U.K.).

Stromal cell lines and fibroblast lines

One RA SCL was established from synovium as previously described (22). In brief, synovial tissues of patients with RA who met American College of Rheumatology criteria (23) were obtained after obtaining informed consent and were dissociated with collagenase and trypsin. Dissociated single cells were cultured in DMEM supplemented with 10% FBS and 10% conditioned medium, which was prepared by incubation of PBMC from 10 healthy donors in RPMI 1640 medium with 10% FBS for 48 h. The cultures were then maintained for more than 2 mo, and the SCL were cloned by limiting dilution. Thereafter, clones were maintained and replenished with fresh DMEM with 10 or 20% FBS every 3–4 days. One clone (Sy 77) was used in the present experiments. A second RA SCL (RA6/1) was established from synovial tissue in a similar manner. After three to six passages, this RA SCL contained <2% CD14+ cells. An SCL was also established from osteoarthritis synovium (OA5/26) using the same procedure. Skin fibroblast lines (DT1 and FB-HG) were provided by Dr. Heather Wisbey (University of Texas Southwestern Medical Center, Dallas, TX) and Dr. Herman Girschick (University of Texas Southwestern Medical Center).

B cell separation

The PBMC were isolated from heparinized blood of healthy adult volunteers by density sedimentation using Ficoll/Isopaque. CD19-positive B cells were purified using the CEPRATE streptavidin column (CellPro, Bothell, WA), following staining of the cells with subsaturating concentrations of biotinylated mouse anti-human CD19 mAb. The resultant population of B cells contained >95% CD20-positive B cells.

B cell culture

B cells were cultured in various ways. When cultured alone, B cells (1 x 106) were cultured in 1 ml of RPMI 1640 medium (RPMI 1640 with 10% FBS, 200 U/ml of penicillin G, 10 µg/ml gentamicin, and 0.3 mg/ml L-glutamine) in 24-well culture plates. Alternatively, B cells (1 x 105) were cultured in 200 µl of RPMI 1640 medium in 96-well flat-bottom microtiter plates. In some experiments, B cells were stimulated with anti-IgM Ab. To accomplish this, B cells were incubated with 10 µg/ml of anti-human IgM Ab (DA4.4) conjugated with biotin for 30 min at 4°C and washed twice. Afterward, B cells (1 x 106 in wells of 24-well plates) were cultured for 1 h with streptavidin (10 µg/ml) to cross-link surface IgM, harvested, washed, and used for experiments. When SCLs and fibroblasts were incubated with B cells, they were initially cultured in 24-well culture plates by incubating SCL (4 x 104) in 1 ml of DMEM (high glucose DMEM including 10% FBS, 200 U/ml of penicillin G, 10 µg/ml gentamicin, and 0.3 mg/ml L-glutamine) for 1 wk. After this period of time, they became subconfluent, and B cells (1 x 106) were added in 1 ml of RPMI 1640 culture medium. After various periods of time, B cells were harvested by gentle pipetting. Contamination of harvested B cells with SCLs and fibroblasts could be determined by scatter properties using a flow cytometer and was always <0.5%. Alternatively, SCLs and fibroblasts (4 x 103) were cultured in 96-well flat-bottom microtiter plates for 1 wk, and then B cells (1 x 105) were added, incubated, and harvested as described above.

Direct cell-to-cell contact between B cells and SCL was blocked with a 0.4-µm pore size membrane (Falcon, Becton Dickinson, Franklin Lakes, NJ). For these experiments, SCL (4 x 104) were cultured as described above, and B cells (1 x 106) were added to culture contained in the membrane chamber. In the experiments examining the effect of blocking mAb, SCL (4 x 104) were cultured with 5 µg/ml of mAb for 60 min before addition of B cells as described above. In some experiments, B cells were stimulated with anti-CD11a/CD18 and/or CD49d/CD29 mAbs. For these experiments, 5 µg of rabbit anti-mouse IgG mAb were coated in the wells of 24-well culture plates by incubating them in Tris-HCl at pH 9.8 overnight. B cells (1 x 106) were incubated with 2 µg of mAbs for 30 min, washed once, added to the 24-well plates precoated with rabbit anti-mouse IgG, and cultured in RPMI medium as described above.

Analysis of viable cells

The numbers of viable cells were assessed microscopically after staining with trypan blue.

Detection of apoptosis

The hypotonic propidium iodide staining method was used to detect apoptosis of cells by flow cytometry (24). Harvested B cells were resuspended in hypotonic propidium iodide reagent (0.1% sodium citrate containing 50 µg/ml of propidium iodide and 0.1% Triton X-100). Within 60–120 min, the stained cells were analyzed by flow cytometry using the FACScan (Becton Dickinson), and the percentage of hypodiploid cells was determined.

Western blotting

Bcl-2-related protein expression was investigated by Western blotting. B cells (2 x 106), cultured as described above, were collected and lysed with extraction buffer (PBS with 1% Triton X-100, 5 mM EDTA, 100 µg/ml PMSF, 1 µg/ml leupeptin, and 0.225 U/ml aprotinin). After 2 h at 4°C, debris was eliminated by centrifugation at 15,000 rpm for 10 min, and the supernatant was collected. After measurement of protein concentration with a protein assay kit (Bio-Rad), each sample was adjusted to 4 µg/µl, then mixed with 2x sample loading buffer containing 2-ME (1.5 M) and SDS (4%), and stored at 4°C until analysis. Before analysis, the protein concentration of each sample was adjusted to 2 µg/µl. Forty micrograms of protein (20 µl of sample) was separated by 12% SDS-PAGE, transferred to polyvinylidene difluoride membranes, and blocked with 0.1% Tween and 5% skim milk overnight. The immunoblots were incubated with anti-Bcl-2 rabbit polyclonal Ab (1/50) or anti-Bcl-x rabbit polyclonal Ab (1/100) in PBS with 1% BSA for 1 h. Goat IgG F(ab')2 anti-rabbit IgG conjugated with HRP was used as a second Ab. All immunoblots were detected by enhanced chemiluminescence.

RNA isolation and RT-PCR

RNA was extracted from 1–2 x 106 B cells using Triazol reagent in accordance with the company’s instructions. One microgram of the extracted RNA was treated with DNase I to eliminate DNA and reverse transcribed by SuperScript II reverse transcriptase at 42°C for 70 min using oligo(dT). The PCR was conducted with Taq polymerase using 1–3 µl of cDNA (1.5 mM MgCl; annealing temperature, 56°C; 30–40 cycles). The primer pair for Bcl-2 was CAGAATCCTCTGGAACTTGAGG (5') and CTTCCAGACATTCGGAGACC (3'), that of Bcl-xS/L was GTGGAAGAGAACGGGGCTGAGG (5') and ATGTGGTGGAGCAGAGAAGG (3'), and that of G6PD was TGACCTCAGCTGCACATTCC (5') and CAGTGGCCAATAAGCTCTGG (3'). The PCR products were resolved by electrophoresis on 1.5% agarose gels and identified with ethidium bromide staining. In some cases, PCR-Southern hybridization was conducted. After denaturation of the gel in 1.5 M NaCl and 0.5 M NaOH for 30 min, the PCR products were transferred onto Zeta-Probe blotting membranes using a vacuum blotting apparatus. 32P-labeled probes (Bcl-2, GTGACTTCCGATCAGGAAGG; Bcl-xL, GGTATTGGTGAGTCGGATCG; GAPDH, CCTCCAGACCCTGCCTGAGC) specific for PCR products were used to detect PCR products by Southern hybridization. To adjust the amount of cDNA of each sample precisely, G6PD expression was examined first using 32–35 cycles of RT-PCR to amplify 1, 2, and 3 µl of cDNA. After resolving the PCR products on agarose gels and identifying the relevant bands with ethidium bromide, the optimal amounts of cDNA were determined. Bcl-2 and Bcl-xL expression in this amount of cDNA was examined using 32, 35, 38, and 40 cycles of PCR amplification, and the results in the linear part of the amplification curve are reported in the figures.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The SCL from RA synovium can rescue B cells from apoptosis

When cultured alone, B cells spontaneously underwent apoptosis and died (Fig. 1Go). However, when B cells were cultured with RA SCL, apoptosis was blocked, and B cell viability was preserved. In each experiment (Table IGo) significant differences in viability and apoptosis between B cells cultured with medium alone and those with RA SCL were noted after 6 days of incubation. However, in some experiments (Expt. 2), but not others (Expt. 1 and 3), differences in viability were not seen on day 3. Similarly, significant differences between apoptosis noted in cultures with and without SCL were not always noted on day 3. To determine whether RA SCL were unique in their ability to promote the viability of B cells, the activities of a variety of other cell lines were tested (Fig. 2Go). All the cell lines rescued B cells from apoptosis to varying degrees, but the viability-promoting activity of RA SCL was significantly better than those of the other cell lines.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 1. The SCL derived from RA synovial tissue rescue peripheral B cells from apoptosis. Peripheral B cells (1 x 105) were cultured with or without RA SCL (Sy77; 4 x 103) in 96-well microtiter plates. After various lengths of culture, B cells were harvested with gentle pipetting, and the percentages of viable cells (A) and apoptotic cells (B and C) were determined as described in Materials and Methods. Data are the mean ± SEM of five cultures from one of four independent experiments with similar results. *, p < 0.05; **, p < 0.01 (using Student’s t test).

 

View this table:
[in this window]
[in a new window]
 
Table I. RA SCL rescues B cell apoptosis1

 


View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 2. The RA SCL rescue B cells from apoptosis more effectively than other cell lines. Peripheral B cells (1 x 105) were cultured with various SCLs or fibroblasts (4 x 103) in 96-well microtiter plates. After 4 days of culture, B cells were harvested with gentle pipetting, and the percentages of viable cells (A) and apoptotic cells (B) were determined as described in Materials and Methods. Data are the mean ± SEM of five cultures from one of two independent experiments with similar results. Sy77, RA synovial stromal cell clone; RA6/1, RA synovial cell line; OA5/26, OA synovial cell line; DT1 and FB-HG, fibroblast cell line from human skin. *, p < 0.05; **, p < 0.01 (using Student’s t test).

 
Bcl-X is up-regulated by B cells cultured with RA SCL

To determine whether rescue from apoptosis reflected up-regulation of antiapoptotic proteins, expression of Bcl-2 related proteins was investigated before severe apoptosis (Fig. 3GoA). B cell expression of Bcl-2 protein was unchanged as a result of culture with or without SCL. In contrast, Bcl-xL protein was not detected in fresh B cells, but was markedly up-regulated within 1 day of culture with SCL, but not when B cells were cultured alone. Increased B cell viability and decreased apoptosis were again observed upon coculture with SCL on day 3, but the changes were less marked because of the short length of the incubation. RA-SCL also rescued anti-IgM-stimulated B cells from apoptosis (Fig. 3GoB). Moreover, RA-SCL up-regulated Bcl-xL, but not Bcl-2, expression by anti-IgM-stimulated B cells. Finally, the impact of coculture with other cell lines on B cell expression of Bcl-xL was examined (Fig. 4Go). Bcl-xL expression was more markedly up-regulated by coculture with RA-SCL. These results show that RA SCL can induce Bcl-xL protein expression in resting and stimulated B cells more effectively than in other cell lines tested and, in addition, can rescue B cells from apoptosis more effectively.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 3. The RA SCL induce Bcl-xL expression by B cells. A, After B cells (1 x 106) were cultured with RA SCL (Sy77; 4 x 104) for 1 or 3 days, expression of Bcl-2 and Bcl-xL proteins (40 µg of each sample) was examined with Western blotting and compared with that by fresh B cells. Percentages of viable and apoptotic cells were assessed at the same time as described in Materials and Methods. Representative data from one of five similar experiments with similar results are shown. B, After B cells (1 x 106) stimulated by cross-linking IgM Ab or control Ab were cultured with RA SCL (Sy77; 4 x 104) for 3 days, expression of Bcl-2 and Bcl-xL proteins (40 µg of each sample) was examined with Western blotting. Percentages of viable and apoptotic cells were assessed at the same time as described in Materials and Methods. Representative data from one of two experiments with similar results are shown.

 


View larger version (60K):
[in this window]
[in a new window]
 
FIGURE 4. The RA SCL rescue B cell from apoptosis more effectively than other cell lines. After B cells (1 x 106) were cultured with various cell lines (4 x 104) for 3 days, expression of Bcl-2 and Bcl-xL proteins (40 µg of each sample) was examined with Western blotting. Percentages of viable and apoptotic cells were assessed at the same time as described in Materials and Methods. Representative data from one of two experiments with similar results are shown. Sy77, RA synovial stromal cell clone; RA6/1, RA synovial cell line; OA5/26, OA synovial cell line; DT1 and FB-HG, fibroblast lines from human skin.

 
Direct contact is necessary for RA SCL-mediated rescue of B cell from apoptosis and induction of Bcl-xL in B cells

As shown in Fig. 5Go, both up-regulation of Bcl-xL and rescue of B cells from apoptosis were inhibited when direct contact between RA SCL and B cells was blocked by interposition of a 0.4-µm pore size membrane. Importantly, B cells in the upper chamber could not be rescued from apoptosis by soluble factors even when they were generated by RA SCL cultured with B cells in the lower chamber. It should be noted that the effect of the membrane separation appeared to be somewhat greater for up-regulation of Bcl-xL than for rescue from apoptosis, in that there was minimal up-regulation of Bcl-xL when the cells were separated, but there was some rescue from apoptosis. These results indicate that direct cell-to-cell contact between B cells and SCL cells is importantly involved in both up-regulation of Bcl-xL by B cells and rescue from apoptosis, with the former more dependent than the latter.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 5. Cell contact is required to induce Bcl-xL and rescue B cells from apoptosis. B cells (1 x 106) and SCL (4 x 104) were cultured together or separated by a 0.4-µm pore size membrane. Where indicated B cells (1 x 106) were added to the bottom chamber with SCL to examine the influence of soluble factor induced after mixed culture. After a 3-day culture, B cells were analyzed for expression of Bcl-2 and Bcl-xL protein and were assessed for viability and apoptosis. Representative data from one of four similar experiments with similar results are shown.

 
Interactions mediated by CD106 (VCAM-1) and CD49d/CD29 (VLA-4) play a significant role in the rescue of B cells from apoptosis and induction of Bcl-xL

The RA SCL expresses both CD54 and CD106 (22). Blocking CD54-mediated interactions with an mAb that blocks binding of both CD11a/CD18 and CD11b/CD18, had no effect on the ability of SCL to up-regulate B cell Bcl-xL and rescue B cells from apoptosis (Fig. 6Go). By contrast, an mAb to CD106 inhibited both SCL-induced up-regulation of Bcl-xL and rescue of B cells from apoptosis, but not completely.



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 6. Roles of CD54 (ICAM-1) and CD106 (VCAM-1) in SCL-mediated up-regulation of Bcl-xL and inhibition of B cell apoptosis. B cells (1 x 106) were cultured with or without SCL (4 x 104) for 2 days in the presence or the absence of mAbs to CD54 and/or CD106. Afterward, B cells were analyzed for Bcl-2 and Bcl-xL expression and for viability and apoptosis. Representative data from one of three experiments with similar results are shown.

 
Cross-linking CD49/CD29 rescues B cells from apoptosis and induces Bcl-x mRNA and protein

Cross-linking CD49d/CD29 with mAb up-regulated Bcl-xL mRNA and protein in the absence of RA SCL and also rescued B cells from apoptosis. Cross-linking CD11a/CD18 modestly rescued B cells from apoptosis, but had no impact on expression of Bcl-xL (Fig. 7Go). Because of the smaller amount of Bcl-xL induced by cross-linking CD49d/CD29, it was only detected with a more prolonged exposure. In this circumstance, some Bcl-xL expression could also be detected in B cells cultured with medium alone (Expt. 1). It should be noted that mRNA and protein expressions were regulated in a qualitatively similar manner, although the quantitative effects were markedly different, with a much greater impact on mRNA levels noted. This suggests that there may be translational or post-translational regulation of Bcl-xL expression in these cells that is controlled differently from the regulation of mRNA levels.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 7. Stimulation by VLA-4 can induce Bcl-xL protein and mRNA in B cells. B cells (1 x 106) were cultured for 3 days with mAbs to CD11a/CD18 and/or CD29/CD49d in 24-well culture plates coated with rabbit anti-mouse IgG. Afterward, the expression of Bcl-2 and Bcl-xL protein was assessed by Western blotting, and the percentages of viable and apoptotic cells were measured as described in Materials and Methods, and mRNA for Bcl-2, Bcl-xL, and G6PD were assessed by RT-PCR as described in Materials and Methods. The results of Southern blotting are shown in Expt. 1, and the expression of PCR products by ethidium bromide staining is shown in Expt. 2. One to three micrograms of cDNA was used for each amplification. The number of PCR cycles was modified to ensure that the PCR products obtained were from the linear phase of amplification. The cycle number of each PCR is shown in the figure. Representative data from two of five experiments with similar results are shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results of this study indicate that SCL derived from RA synovial tissue can induce Bcl-xL and rescue peripheral blood B cells from apoptosis, and this ability of RA SCL is greater than that of OA SCL and skin fibroblasts. The data also indicate that a direct physical interaction between RA SCL and B cells mediated by the coreceptor pair VCAM-1 and VLA-4 provides signals that induce Bcl-xL and plays a role in the rescue of B cells from programmed cell death. A similar phenomenon in the rheumatoid synovium may contribute to the local accumulation and activation of B cells at this inflammatory site.

It has become apparent that maintenance of the viability of resting B cells is a dynamic process, involving the active countering of proapoptotic mechanisms. One of the major mechanisms to maintain the viability of lymphocytes involves the activity of the Bcl-2 family of molecules that inhibit programmed cell death following mitochondrial disruption (25). Previous results had indicated that a population of SCL isolated from bone marrow or rheumatoid synovium could prevent apoptosis of resting B cells and also stimulate their differentiation into Ab-forming cells (22). These SCL constitutively expressed VCAM-1 (22). The current studies demonstrate that engagement of B cell VLA-4 by VCAM-1 expressed on SCL up-regulates Bcl-xL, an antiapoptotic Bcl-2 family member, and protects resting B cells from programmed cell death. These results are the first demonstration that engagement of VLA-4 on B cells can induce Bcl-xL and also the first mechanistic explanation of the means by which interaction with SCL can protect B cells from apoptosis.

In RA synovial tissue, minimal apoptosis of lymphocytes has been noted despite intensive infiltration (5). Previous reports have suggested that soluble factors produced by RA synovial fibroblasts might promote the viability of synovial T cells (26). However, the previous studies clearly showed that the viability of resting B cells could be maintained not by fibroblast cell lines, but, rather, by a specific population of synovial SCL (22). Moreover, the maintenance of B cell viability could not be explained by soluble factors produced by SCL. In the current studies, soluble factors produced by RA SCL could maintain B cell viability modestly, although the major contribution of RA SCL to the rescue of B cells from apoptosis involved direct cell-to-cell contact mediated by VCAM-1.

The mechanism, by which B cells are rescued from apoptosis, has been extensively investigated in secondary lymphoid tissue (20, 27, 28, 29). In germinal centers, B cell expression of Bcl-xL is increased (20, 30). Various combinations of surface molecules and cytokines have been reported to induce Bcl-xL in B cells or B cell lines. In peripheral B cells, CD40 ligand (CD154) and IL-13 can induce Bcl-xL (31). CD40 ligand and IgM cross-linking can also induce Bcl-xL on tonsil B cells and/or WEHI-231 cells (27, 32), whereas the combination of the polyclonal activator, SAC, and IL-10 can also induce Bcl-xL on tonsil B cells (29). Finally, anti-IgM stimulation induced Bcl-xL protein and rescued murine A20 cells from apoptosis (33). Besides interactions with Ag and activated T cells, direct contact with follicular dendritic cells (FDC) could contribute to B cell survival. In this regard, FDC and SCL have certain similarities, including the constitutive expression of the adhesion molecules, ICAM-1 and VCAM-1, and their involvement in spontaneous interactions with B cells (22). Because SCL do not express CD40 ligand (22), the possibility that adhesion molecules play a role in maintaining the viability of resting B cells was considered. The results of the mAb blocking experiments indicated that direct cell contact with SCL through VCAM-1-VLA-4 interactions is important in rescuing resting B cells from apoptosis. In view of the central importance of VCAM-1-VLA-4 interactions between B cells and FDC (34, 35, 36), a similar process could be involved in up-regulating Bcl-xL and protecting against apoptosis in the germinal center. We have previously noted the functional and phenotypic similarities between SCL and FDC. However, there are differences between these cell types, including the observation that SCLs do not express CD21 and CD35 on their surface.

It should be noted that the finding that VCAM-1-mediated interactions could not block B cell apoptosis completely suggested that other mechanisms could be involved. SCL are known to produce IL-6, IL-8, GM-CSF, G-CSF, and hyaluronic acid and might also express surface molecules such as CD157 that could contribute to B cell survival (22, 37). Despite the possible contributions of these other molecules, it is clear that VCAM-1-VLA-4 interactions play a central role in the SCL-dependent rescue of resting B cells from apoptosis.

Bcl-xL expression is largely regulated at the level of gene transcription (25). In this regard, it has been reported that leukemia inhibitory factor induced Bcl-xL via the gp130 and STAT1 signaling pathway in cardiac myocytes (38). In addition, an erythropoietin-stimulated Jak2 kinase-initiated signal pathway has been reported to inhibit radiation-induced apoptosis and induce Bcl-xL in the DA3 murine myeloid cell line (39). However, there were no previous reports of a relationship between Bcl-xL expression and VLA-4 stimulation. VLA-4 stimulation has been reported to result in phosphorylation of focal adhesion kinase, which can then activate phosphatidylinositol 3-kinase and the generation of PIP3 (40, 41, 42). Subsequently, Akt (activated form serine/threonine kinase) can be phosphorylated and activated, and provide a cell survival signal (43). Besides this putative pathway of activation, the promoter region of human and mouse Bcl-xL contains several transcription binding sites, including sites for Ets-1, AP-4, NF-E2, Lyf-1, AP-1, Oct-1, GATA-1, and Evi-1, which are candidates to be involved in up-regulation of transcription (44). Current studies are focusing on the mechanism of Bcl-xL up-regulation following VLA-4 engagement.

Synovial stromal cells in RA have many potential functions. These cells induce B cell activation and Ig production and also secrete many cytokines and chemokines related to inflammation (22, 37, 45, 46, 47, 48). Additionally, they can protect naive B cells from apoptosis by the VLA-4-VCAM-1-dependent mechanism, as described here. These finding suggest that synovial stromal cells may play a central role in propagating the inflammatory response characteristic of RA, especially the accumulation of B cells and their activation to produce Ig locally within the synovium.


    Acknowledgments
 
We thank Dr. Amrie C. Grammer for her careful review of the manuscript.


    Footnotes
 
1 This work was supported by National Institutes of Health Specialized Center of Research Grant AR-39169 and the program for Promotion of Fundamental Studies in Health Science of the Organization for Drug ADR Relief, Research and Development Promotion and Product Review of Japan. Back

2 Address correspondence and reprint requests to Dr. Peter E. Lipsky, Department of Internal Medicine, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75235-8884. E-mail address: Back

3 Abbreviations used in this paper: RA, rheumatoid arthritis; SCL, stromal cell line; OA, osteoarthritis; VLA-4, very late Ag-4; FDC, follicular dendritic cells. Back

Received for publication April 27, 1999. Accepted for publication October 26, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Harris, E. D.. 1990. Rheumatoid arthritis: pathology and implications for therapy. N. Engl. J. Med. 322:1277.[Medline]
  2. McInnes, I. B., J. Al-Mughales, M. Field, B. P. Leung, F. P. Huang, R. Dixon, R. D. Sturrock, P. C. Wilkinson, F. Y. Liew. 1996. The role of interleukin-15 in T-cell migration and activation in rheumatoid arthritis. Nat. Med. 2:175.[Medline]
  3. Iannone, F., V. M. Corrigall, G. H. Kingsley, G. S. Panayi. 1994. Evidence for the continuous recruitment and activation of T cells into the joints of patients with rheumatoid arthritis. Eur. J. Immunol. 24:2706.[Medline]
  4. Qu, Z., C. H. Garcia, L. M. O’Rourke, S. R. Planck, M. Kohli, J. T. Rosenbaum. 1994. Local proliferation of fibroblast-like synoviocytes contributes to synovial hyperplasia. Arthritis Rheum. 37:212.[Medline]
  5. Firestein, G. S., M. Yeo, N. J. Zvaifler. 1995. Apoptosis in rheumatoid arthritis synovium. J. Clin. Invest. 96:1631.
  6. Gomez, J., A. Gonzalez, C. Martinez-A, A. Rebollo. 1998. IL-2-induced cellular events. Crit. Rev. Immunol. 18:185.[Medline]
  7. Lichtenstein, A., Y. Tu, C. Fady, R. Vescio, J. Berenson. 1995. Interleukin-6 inhibits apoptosis of malignant plasma cells. Cell. Immunol. 162:248.[Medline]
  8. Schwarze, M. M., R. G. Hawley. 1995. Prevention of myeloma cell apoptosis by ectopic bcl-2 expression or interleukin 6-mediated up-regulation of bcl-xL. Cancer Res. 55:2262.[Abstract/Free Full Text]
  9. Armant, M., G. Delespesse, M. Sarfati. 1995. IL-2 and IL-7 but not IL-12 protect natural killer cells from death by apoptosis and up-regulate bcl-2 expression. Immunology 85:331.[Medline]
  10. Vella, A. T., S. Dow, T. A. Potter, J. Kappler, P. Marrack. 1998. Cytokine-induced survival of activated T cells in vitro and in vivo. Proc. Natl. Acad. Sci. USA 95:3810.[Abstract/Free Full Text]
  11. Yonish-Rouach, E., D. Resnitzky, J. Lotem, L. Sachs, A. Kimchi, M. Oren. 1991. Wild-type p53 induces apoptosis of myeloid leukaemic cells that is inhibited by interleukin-6. Nature 352:345.[Medline]
  12. Teague, T. K., P. Marrack, J. W. Kappler, A. T. Vella. 1997. IL-6 rescues resting mouse T cells from apoptosis. J. Immunol. 158:5791.[Abstract]
  13. Cohen, S. B., J. B. Crawley, M. C. Kahan, M. Feldmann, B. M. Foxwell. 1997. Interleukin-10 rescues T cells from apoptotic cell death: association with an upregulation of Bcl-2. Immunology 92:1.[Medline]
  14. Poe, J. C., Jr D. H. Wagner, R. W. Miller, R. D. Stout, J. Suttles. 1997. IL-4 and IL-10 modulation of CD40-mediated signaling of monocyte IL-1{beta} synthesis and rescue from apoptosis. J. Immunol. 159:846.[Abstract]
  15. Meazza, R., S. Basso, A. Gaggero, D. Detotero, L. Trentin, R. Pereno, B. Azzarone, S. Ferrini. 1998. Interleukin (IL)-15 induces survival and proliferation of the growth factor-dependent acute myeloid leukemia M-07e through the IL-2 receptor {beta}/{gamma}. Int. J. Cancer 78:189.[Medline]
  16. Dooms, H., M. Desmedt, S. Vancaeneghem, P. Rottiers, V. Goossens, W. Fiers, J. Grooten. 1998. Quiescence-inducing and antiapoptotic activities of IL-15 enhance secondary CD4+ T cell responsiveness to antigen. J. Immunol. 161:2141.[Abstract/Free Full Text]
  17. Adachi, S., M. Kubota, Y. W. Lin, A. Okuda, K. Matsubara, Y. Wakazono, H. Hirota, K. Kuwakado, Y. Akiyama. 1994. In vivo administration of granulocyte colony-stimulating factor promotes neutrophil survival in vitro. Eur. J. Haematol. 53:129.[Medline]
  18. Suda, T., H. Hashimoto, M. Tanaka, T. Ochi, S. Nagata. 1997. Membrane Fas ligand kills human peripheral blood T lymphocytes, and soluble Fas ligand blocks the killing. J. Exp. Med. 186:2045.[Abstract/Free Full Text]
  19. Hashimoto, H., M. Tanaka M, T. Suda, T. Tomita, K. Hayashida, E. Takeuchi, M. Kaneko, H. Takano, S. Nagata, T. Ochi. 1998. Soluble Fas ligand in the joints of patients with rheumatoid arthritis and osteoarthritis. Arthritis Rheum. 41:657.[Medline]
  20. Koopman, G., R. M. J. Keehnen, E. Lindhout, W. Newman, Y. Shimizu, G. A. van Seventer, C. de Groot, S. T. Pals. 1994. Adhesion through the LFA-1 (CD11a/CD18)-ICAM-1 (CD54) and the VLA-4 (CD49d)-VCAM-1 (CD106) pathways prevents apoptosis of germinal center B cells. J. Immunol. 152:3760.[Abstract]
  21. Pezzano, M., Y. Li, D. Philip, C. Omene, M. Cantey, G. Saunders, J. C. Guyden. 1995. Thymic nurse cell rescue of early CD4+ CD8+ thymocytes from apoptosis. Cell. Mol. Biol. 41:1099.
  22. Shimaoka, Y., J. F. Attrep, T. Hirano, K. Ishihara, R. Suzuki, T. Toyosaki, T. Ochi, P. E. Lipsky. 1998. Nurse-like cells from bone marrow and synovium of patients with rheumatoid arthritis promote survival and enhance function of human B cells. J. Clin. Invest. 102:606.[Medline]
  23. Arnett, F. C., S. M. Edworthy, D. A. Bloch, D. J. McShane, J. F. Fries, N. S. Cooper, L. A. Healey, S.R. Kaplan, M.H. Liang, H.S. Luthra, et al 1988. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum. 31:315.[Medline]
  24. Nicoletti, I., G. Migliorati, M. C. Pagliacci, F. Grignani, C. Riccardi. 1991. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J. Immunol. Methods 139:271.[Medline]
  25. Adams, J. M., S. Cory. 1998. Apoptosis: the Bcl-2 protein family: arbiters of cell survival. Science 281:1322.[Abstract/Free Full Text]
  26. Salmon, M., D. Scheel-Toellner, A. P. Huissoon, D. Pilling, N. Shamsadeen, H. Hyde, A. D. D’Angeac, P. A. Bacon, P. Emery, N. Akbar. 1997. Inhibition of T cell apoptosis in rheumatoid synovium. J. Clin. Invest. 99:439.[Medline]
  27. Tuscano, J. M., K. M. Druey, A. Riva, J. Pena, C. B. Thompson, J. H. Kehrl. 1996. Bcl-x rather than Bcl-2 mediates CD40-dependent centrocyte survival in the germinal center. Blood 88:1359.[Abstract/Free Full Text]
  28. Zhang, X., L. Li, J. Choe, S. Krajewski, J. C. Reed, C. Thompson, Y. S. Choi. 1996. Up-regulation of Bcl-XL expression protects CD40-activated human B cells from Fas-mediated apoptosis. Cell. Immunol. 173:149.[Medline]
  29. Li, L., S. Krajewski, J. C. Reed, Y. S. Choi. 1997. The apoptosis and proliferation of SAC-activated B cells by IL-10 are associated with changes in Bcl-2, Bcl-xL, and Mcl-1 expression. Cell. Immunol. 178:33.[Medline]
  30. Krajewski, S., M. Krajewska, A. Shabaik, H. G. Wang, S. Irie, L. Fong, J. C. Reed. 1994. Immunohistochemical analysis of in vivo patterns of Bcl-x expression. Cancer Res. 54:5501.[Abstract/Free Full Text]
  31. Lomo, J., H. K. Blomhoff, S. E. Jacobsen, S. Krajewski, J. C. Reed, E. B. Smeland. 1997. Interleukin-13 in combination with CD40 ligand potently inhibits apoptosis in human B lymphocytes: upregulation of Bcl-xL and Mcl-1. Blood 89:4415.[Abstract/Free Full Text]
  32. Choi, M. S. K., L. H. Boise, A. R. Gottschalk, J. Quintans, C. B. Thompson, G. G. B. Klaus. 1995. The role of bcl-xL in CD40-mediated rescue from anti-u-induced apoptosis in WEHI-231 B lymphoma cells. Eur. J. Immunol. 25:1352.[Medline]
  33. Bras, A., C. Martinez-A, E. Baixeras. 1997. B cell receptor cross-linking prevents Fas-induces cell death by inactivating the IL-1{beta}-converting enzyme protease and regulation Bcl-2/Bcl-x expression. J. Immunol. 159:3168.[Abstract]
  34. Clark, E. A. K. H., A. M. Grabstein, M. Gown, T. Skelly, T. Hirano Kaisho, G. L. Shu. 1995. Activation of B lymphocyte maturation by a human follicular dendritic cell line, FDC-1. J. Immunol. 155:545.[Abstract]
  35. Freedman, A. S., J. M. Munro, G. E. Rice, M. P. Bevilacqua, C. Morimoto, B. W. McIntyre, K. Rhynhart, J. S. Pober, L. M. Nadler. 1990. Adhesion of human B cells to germinal centers in vitro involves VLA-4 and INCAM-110. Science 249:1031.
  36. Koopman, G., H. K. Parmentier, H. J. Schuurman, W. Newman, C. J. L. M. Meijer, S. T. Pals. 1991. Adhesion of human B cells to follicular dendritic cells involves both the lymphocyte function associated antigen 1/intercellular adhesion molecule 1 and very late antigen 4/vascular adhesion molecule 1 pathways. J. Exp. Med. 173:1297.[Abstract/Free Full Text]
  37. Takeuchi, E., T. Tomita, T. Toyosaki-Maeda, M. Kaneko, H. Takano, H. Hashimoto, K. Sugamoto, R. Suzuki, T. Ochi. 1999. Establishment and characterization of nurse cell-like stromal cell lines from synovial tissues of patients with rheumatoid arthritis. Arthritis Rheum. 42:221.[Medline]
  38. Fujio, Y., K. Kunisada, H. Hirota, K. Yamauchi-Takahira, T. Kishimoto. 1997. Signals through gp130 upregulate bcl-x gene expression via STAT1-binding cis-element in cardiac myocytes. J. Clin. Invest. 99:2898.[Medline]
  39. Quelle, F. W., J. Wang, J. Feng, D. Wang, J. L. Cleveland, J. N. Ihle, G. P. Zambetti. 1998. Cytokine rescue of p53-dependent apoptosis and cell cycle arrest is mediated by distinct Jak kinase signaling pathways. Gene Dev. 12:1099.[Abstract/Free Full Text]
  40. Sato, T., K. Tachibana, Y. Nojima, N. D’Avirro, C. Moromoto. 1995. Role of the VLA-4 molecule in T cell costimulation; Identification of the tyrosine phosphorylation pattern induced by the ligation of VLA-4. J. Immunol. 155:2938.[Abstract]
  41. Maguire, J. E., K. M. Danahey, L. C. Burkly, G. A. van Sevevter. 1995. T cell receptor- and {beta}1 integrin-mediated signals synergize to induce tyrosine phosphorylation of focal adhesion kinase (pp125FAK) in human T cells. J. Exp. Med. 182:2079.[Abstract/Free Full Text]
  42. Chen, H. C., J. L. Guan. 1994. Association of focal adhesion kinase with its potential substrate phosphatidylinositol 3-kinase. Proc. Natl. Acad. Sci. USA 91:10148.[Abstract/Free Full Text]
  43. Kennedy, S. G., A. J. Wagner, S. D. Conzen, J. Jordan, A. Bellacosa, P. N. Tsichlis, N. Hay. 1997. The PI3-kinase/Akt signaling pathway delivers an anti-apoptotic signal. Genes Dev. 11:701.[Abstract/Free Full Text]
  44. Grillot, D. A. M., M. Gonzale-Gracia, D. Ekhterae, L. Duan, N. Inohara, S. Ohta, M. Seldin, G. Nunez. 1997. Genomic organization, promoter region analysis, and chromosome localization of the mouse bcl-X gene. J. Immunol. 158:4750.[Abstract]
  45. Dechanet, J., P. Merville, I. Durand, J. Banchereau, P. Miossec. 1995. The ability of synoviocytes to support terminal differentiation of activated B cells may explain plasma cell accumulation in rheumatoid synovium. J. Clin. Invest. 95:456.
  46. Robinson, E., E. C. Keystone, T. J. Schall, N. Gillett, E. N. Fish. 1995. Chemokine expression in rheumatoid arthritis (RA): evidence of RANTES and macrophage inflammatory protein (MIP)-1{beta} production by synovial T cells. Clin. Exp. Immunol. 101:398.[Medline]
  47. Hosaka, S., T. Akahoshi, C. Wada, H. Kondo. 1994. Expression of the chemokine superfamily in rheumatoid arthritis. Clin. Exp. Immunol. 97:451.[Medline]
  48. Rathanaswami, P., M. Hachicha, M. Sadick, T. J. Schall, S. R. McColl. 1993. Expression of the cytokine RANTES in rheumatoid synovial fibroblasts: differential regulation of RANTES and interleukin-8 genes by inflammatory cytokines. J. Biol. Chem. 268:5834.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
B. Zheng, E. Marinova, K. Switzer, D. Wansley, H. He, R. Bheekha-Escura, T. W. Behrens, and S. Han
Overexpression of BclXL in B Cells Promotes Th1 Response and Exacerbates Collagen-Induced Arthritis
J. Immunol., November 15, 2007; 179(10): 7087 - 7092.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. Sonnet, P. Lafuste, L. Arnold, M. Brigitte, F. Poron, F. Authier, F. Chretien, R. K. Gherardi, and B. Chazaud
Human macrophages rescue myoblasts and myotubes from apoptosis through a set of adhesion molecular systems
J. Cell Sci., June 15, 2006; 119(12): 2497 - 2507.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Jimenez-Boj, K. Redlich, B. Turk, B. Hanslik-Schnabel, A. Wanivenhaus, A. Chott, J. S. Smolen, and G. Schett
Interaction between Synovial Inflammatory Tissue and Bone Marrow in Rheumatoid Arthritis
J. Immunol., August 15, 2005; 175(4): 2579 - 2588.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
D. L. Olson, L. C. Burkly, D. R. Leone, B. M. Dolinski, and R. R. Lobb
Anti-{alpha}4 integrin monoclonal antibody inhibits multiple myeloma growth in a murine model
Mol. Cancer Ther., January 1, 2005; 4(1): 91 - 99.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
E. Rosati, R. Sabatini, E. Ayroldi, A. Tabilio, A. Bartoli, S. Bruscoli, C. Simoncelli, R. Rossi, and P. Marconi
Apoptosis of human primary B lymphocytes is inhibited by N-acetyl-L-cysteine
J. Leukoc. Biol., July 1, 2004; 76(1): 152 - 161.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. Xiao, X. Zhang, K. K. Mann, S. Jodo, L. Li, W. N. Jarjour, A. Marshak-Rothstein, D. H. Sherr, and S.-T. Ju
Changes in sensitivity of peripheral lymphocytes of autoimmune gld mice to FasL-mediated apoptosis reveal a mechanism for the preferential deletion of CD4-CD8-B220+ T cells
Int. Immunol., May 1, 2004; 16(5): 759 - 766.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. T. de la Fuente, B. Casanova, J. V. Moyano, M. Garcia-Gila, L. Sanz, J. Garcia-Marco, A. Silva, and A. Garcia-Pardo
Engagement of {alpha}4{beta}1 integrin by fibronectin induces in vitro resistance of B chronic lymphocytic leukemia cells to fludarabine
J. Leukoc. Biol., March 1, 2002; 71(3): 495 - 502.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Tsukada, J. A. Burger, N. J. Zvaifler, and T. J. Kipps
Distinctive features of "nurselike" cells that differentiate in the context of chronic lymphocytic leukemia
Blood, February 1, 2002; 99(3): 1030 - 1037.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hayashida, K.
Right arrow Articles by Lipsky, P. E
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hayashida, K.
Right arrow Articles by Lipsky, P. E


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS