| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Immunology and
Centre for Rheumatic Diseases, University of Glasgow, Glasgow, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, TNF-
, and IL-6 than the controls.
Interestingly, IL-18-treated mice produced more TNF- and IL-6, but
less IFN-, compared with mice treated with IL-12. Furthermore,
splenic macrophages from DBA/1 mice cultured in vitro with IL-18, but
not IL-12, produced substantial amounts of TNF-. Mice treated with
IL-18 or IL-18 plus IL-12 produced markedly more IgG1 and IgG2a
anti-collagen Ab compared with controls, whereas IL-12 treatment
only led to an enhanced IgG2a response. Together these results
demonstrate that IL-18 can promote collagen-induced inflammatory
arthritis through mechanisms that may be distinct from those induced by
IL-12. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(IL-1Rrp)
and nonbinding ß (AcPL) signaling chains (6, 7) that are
widely expressed on cells implicated in both innate and specific immune
responses. The synthesis of IL-18 has been described by various cell
types, including macrophages, dendritic cells, Kupffer cells,
keratinocytes, articular chondrocytes, and osteoblasts
(8, 9, 10, 11, 12), and in adrenal cortex and pituitary gland
(13).
IL-18 induces the proliferation of and promotes IFN-, TNF-, and
GM-CSF production by Th1 clones (14). IL-18 promotes T
cell and NK cell cytotoxicity and directly induces IFN- production
by NK cells (15). Such in vitro Th1 specificity is
relative. Several recent data suggest that IL-18-mediated effects on T
cells, in the absence of IL-12, may extend beyond Th1 differentiation
to include type 2 response activation (16, 17). Thus,
IL-18 enhances IL-13 mRNA expression in Th2 and NK cells
(17). The direct effects of IL-18 on macrophage function
have received less attention. IL-18 and IL-12 together induce IFN-
production by murine bone marrow-derived macrophages, whereas
activation of human macrophages in PBMC cultures was effected by IL-18
through T cell- and NK cell-derived TNF- production (18, 19).
In vivo, IL-18 exerts synergy with IL-12 to promote the development of Th1 responses. IL-18-deficient mice exhibit impaired Th1 responses to intracellular bacteria, including Propionibacterium acnes, Mycobacterium bovis, and Staphylococcus aureus and parasites, such as Leishmania major (15, 20). Such responses are further impaired in IL-12/IL-18 double-knockout mice (15). IL-18 is also implicated in protective immunity during murine Cryptococcus neoformans or Yersinia infections (21, 22). IL-18 mRNA is up-regulated in diabetic NOD mice, and the murine IL-18 gene maps to the Idd2 susceptibility locus, suggesting a potential role in Th1-mediated autoimmunity (23). However, IL-18 supplementation in nonobese diabetic (NOD) mice retarded the clinical onset of hyperglycemia and modified the transition from Th2 to Th1 cytokine mRNA expression in pancreatic islets (24). Moreover, IL-18 has also been shown to enhance Th2 cytokine production, eosinophilia, and allergic sensitization in a ragweed Ag-induced allergy model (16). Thus, commensurate with the emerging complexity of its functional effects in vitro, the role of IL-18 in murine autoimmune models is unclear.
Collagen-induced arthritis (CIA) represents an ideal opportunity to
explore the diverse inflammatory effects of IL-18 in an inducible,
autoimmune model. CIA has proven a useful surrogate in which to
investigate the role of cytokines in RA, particularly in defining key
roles for TNF- and IL-1. Considerable data implicate Th1 responses
in the pathogenesis of CIA (25). Thus, the incidence and
severity of CIA are reduced in IL-12-deficient mice (26).
Neutralizing anti-IL-12 Abs ameliorate the onset and progression of
disease (27, 28, 29), particularly in synergy with
anti-TNF- Abs (29). However, IL-12 probably has a
biphasic role, such that low dose, early administration of IL-12 is
proinflammatory, whereas high dose or chronic administration may be
anti-inflammatory through an IL-10-dependent mechanism
(30). We recently detected IL-18 in RA synovial membrane
and demonstrated that rIL-18 together with type II collagen can promote
clinically detectable, inflammatory arthritis in DBA/1 mice. Moreover,
synovial macrophages expressed IL-18R and produced TNF- in direct
response to IL-18 in vitro (1). In the present study we
have extended these observations to compare the capacities of IL-18,
IL-12, and their combination to promote CIA, and thereafter, we have
defined mechanisms by which such arthritis is induced. Our data
demonstrate that IL-18 can promote erosive CIA, which is histologically
indistinguishable from that induced by collagen in CFA. The mechanisms
implicated differ significantly from those induced by IL-12. These data
identify IL-18 as a potential proinflammatory cytokine in inflammatory
arthritis.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Male DBA/1 mice obtained from Harlan Olac (Bicester, U.K.) were
used at 8–10 wk of age. Murine rIL-12 was provided by Genetics
Institute (Cambridge, MA). Recombinant IL-18 was generated as follows.
Total RNA was extracted from J774 cells stimulated for 18 h with
100 U/ml IFN- (provided by Dr. G. A. Adolf, Bender Wien,
Austria) and LPS (1 µg/ml; Sigma, Poole, U.K.) using the Trizol
reagent (Life Technologies, Paisley, U.K.). RNA was transcribed into
cDNA using SuperScript II reverse transcriptase (Life Technologies)
according to a standard protocol. Primer set pairs designed from murine
IL-18 sequence data were used to clone IL-18 from the cDNA (sense,
GACACCATGGGCCGACTTCACTGTACAACCGC; antisense,
CCTAAGATCTATGTAAGTTAGTGAGAGTGAAC; Genosys, Cambs, U.K.). The PCR
product was confirmed by sequencing, cloned into the pQE-30 expression
vector (Qiagen, Dorking, U.K.), and expressed in Escherichia
coli M15 (Qiagen). Following induction with
isopropyl-D-thiogalactoside (BioLine, London,
U.K.), IL-18 was extracted under native conditions and purified as a
6x histidine-tagged fusion protein using a nickel agarose purification
system (Qiagen) according to the manufacturer’s recommendations.
Purity was analyzed by SDS-PAGE and Coomassie blue staining, which
showed a single protein band at 19 kDa. Biologic activity was
determined by IFN- induction from murine whole spleen cell cultures.
Cytokines used for in vitro assays were free of LPS as assessed by the
Limulus amebocyte assay (Sigma). In some experiments murine
IL-18 (R & D Systems, Oxon, U.K.) was used with similar results.
Induction of CIA and assessment of arthritis
CIA was elicited in mice as previously described (31). Briefly, mice were immunized by intradermal injection of 200 µg of acidified type II collagen (Sigma) in emulsified CFA or IFA (both from Difco, Detroit, MI). Collagen (200 µg in PBS) was given again on day 21 by i.p. injection. Mice were monitored for signs of arthritis as previously described (31). Scores were assigned based on erythema, swelling, or loss of function present in each paw on a scale of 0–3, giving a maximum score of 12/mouse. Paw thickness was measured with a dial caliper (Kroeplin, Munich, Germany). For histologic assessment, mice were sacrificed, the hind limbs were removed and fixed in 10% neutral-buffered formalin, and 5-µm sections were stained with hematoxylin and eosin (Sigma). The quantification of arthritis was by treatment-blind observer, and a histologic score was assigned to each joint based on the degree of inflammation, synovial hyperplasia, and erosion as described previously (32).
Administration of cytokines
Mice received daily i.p. injections of IL-12, IL-18, or both (all at 100 ng) diluted in PBS supplemented with 0.1% BSA for 5 consecutive days, while control mice received PBS/0.1% BSA only. Cytokine treatment was scheduled 1 day before the primary and secondary immunizations with collagen (days -1 to 4 and days 20–24). The IL-12 dose was determined based on from previous studies that documented biphasic effects of IL-12, such that higher doses could exert anti-inflammatory effects through IL-10 induction (30).
Collagen-specific in vitro culture
Spleens and draining lymph nodes were removed on days 24, 42, and 73 after primary immunization. Single-cell suspensions were prepared and cultured in triplicate at 2 x 106 cells/ml in RPMI 1640 supplement with 100 IU/ml penicillin, 100 µg/ml streptomycin, 25 mM HEPES buffer, and 10% FCS (all from Life Technologies) at 37°C in 5% CO2. Cells were stimulated with graded concentrations of type II collagen in flat-bottom 96-well plates (Nunc, Roskilde, Denmark). Supernatants were collected after 48 or 72 h and stored at -20°C until assay for cytokine concentration. Proliferation assays were performed in parallel cultures in U-bottom 96-well plates (Nunc) for 96 h and were pulsed with [3H]thymidine (Amersham, Aylesbury, U.K.) during the last 6 h of culture. Plates were then harvested and measured for incorporation of radioactivity as previously described (33).
Measurement of cytokines and serum anti-collagen Ab levels
All cytokines and anti-collagen Ab levels were detected by
ELISA as described previously (31). The Ab pairs were as
follows: TNF-, IFN- (Genzyme, Cambridge, MA), IL-4, IL-5, IL-6,
and IL-10 (PharMingen, San Diego, CA), and assays were performed
according to the manufacturers’ instructions. Detection limits were as
follows: IL-4, IL-5, IL-6, and TNF-, 10 pg/ml; and IL-10 and
IFN-, 40 pg/ml. Serum anti-collagen II Ab titers in pooled sera
(n = 5) were detected with biotin-conjugated
anti-mouse IgG1 or IgG2a (PharMingen) followed by conjugated avidin
peroxidase (Sigma) and developed with tetramethylbenzidine substrate
(Kirkegaard & Perry, Gaithersburg, MD).
Spleen macrophage culture and FACS analysis
Spleen macrophages were enriched by adherence as described
previously (34). Additional characterization by FACS was
conducted on enriched spleen macrophages using FITC-conjugated
anti-CD4, anti-CD8 (both from Sigma), anti-CD19, and
anti-NK (both from PharMingen) Abs to confirm the purity of the
enriched macrophage population. Cells were <2%
CD4+, CD8+, or
CD19+ and <1% NK+.
Enriched macrophages were cultured in supplemented RPMI 1640 medium at
2 x 106 cells/ml in flat-bottom 96-well
plates (Nunc) in the presence of either IL-12 or IL-18 (both at 100
ng/ml) for 48 h, and supernatants were stored at -20°C until
assay of cytokines. For intracellular staining, enriched macrophages
were suspended at 2 x 106 cells/ml and
stimulated with IL-12 or IL-18 (100 ng/ml) in the presence of brefeldin
A (Sigma) for 4 h. Cells were then washed, fixed with 2%
paraformaldehyde, permeabilized with 0.5% saponin (both Sigma),
stained with PE-conjugated anti-mouse TNF- or PE-conjugated rat
anti-mouse IgG1 isotype control (both from PharMingen), and
analyzed on a FACScaliber flow cytometer (Becton Dickinson, Mountain
View, CA).
Statistical analysis
Statistical analysis was performed using Minitab software (State
Collage, PA) for Macintosh. Clinical and histologic scores were
analyzed with the nonparametric Mann-Whitney U test.
Differences between cumulative incidences at a given time point were
analyzed by the 
2 contingency analysis.
Cytokine and collagen-specific IgG levels were compared using
Student’s t test. Bonferonni’s correction for multiple
comparison was applied as appropriate.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To determine whether IL-18 might promote collagen-specific
articular immunopathology, we administered rIL-18 immediately before
and during initial collagen priming (days 0–4) and challenge (days
20–24). In the absence of cytokine administration (saline recipients,
n = 29), male DBA/1 mice primed with type II bovine
collagen in IFA developed only low levels of arthritis (Fig. 1
). In contrast, mice that received IL-18
(n = 38) developed severe inflammatory, polyarticular
arthritis onset from day 29, involving up to 87% of animals by day 69.
The incidence of arthritis was comparable to that achieved by
administration of IL-12 (n = 27) in a similar regimen.
Combination of IL-12 and IL-18 (n = 27) did not
significantly enhance the incidence of arthritis (Fig. 1A).
The severity of arthritis was measured by sequential estimation of the
articular index and was compared for involved animals within each
group. Disease severity was higher throughout in all cytokine-treated
groups compared with saline-treated collagen/IFA controls
(p < 0.05; Fig. 1B). Moreover,
IL-12/IL-18 induced significantly more severe arthritis than did IL-12
alone. Disease severity after IL-18 administration was intermediate
between that in IL-12- and IL-12/IL-18-treated groups (Fig. 1B). By day 73 the incidence and severity of CIA in all
cytokine-treated groups were equivalent to those observed in positive
control mice primed with collagen in CFA on day 1 (n =
16; data not shown).
|
). Significantly higher
levels of inflammation, synovial hypertrophy, and cartilage erosion
were evident in IL-12/IL-18 than in IL-12 recipients, comparable to
those seen in positive control mice, which were primed with
collagen/CFA. Changes in IL-18-treated mice were again intermediate.
Together, these data clearly indicate that IL-18 alone is sufficient to
induce inflammatory arthritis in IFA/collagen-primed mice. Furthermore,
IL-18 significantly enhanced the efficacy of IL-12 administration
in vivo.
|
Th1 and Th2 cytokine expression was first assessed in serum and
thereafter in vitro. To compare the sequential expressions of cytokines
in serum, arthritic mice of equivalent articular index (between groups)
were selected from each treatment group during the acute (day 29) and
established (day 42) phases of disease. IL-4, IL-5, and IL-10 were not
detected throughout, confirming the expected absence of a significant
Th2 response. In contrast, during the acute phase, elevated levels of
IFN- were present in sera in IL-12- and IL-18-treated mice. These
levels were further enhanced in the IL-12/IL-18 recipients. Of
interest, IL-12 treatment induced higher levels of IFN- than did
IL-18 administration alone (Fig. 3A). These high levels of
IFN- expression were maintained into the chronic phase, by which
time levels in IL-18 recipients were similar to those in IL-12-treated
mice, although levels in the IL-12/IL-18 group remained significantly
higher (Fig. 3B).
|
production by LNC was significantly elevated in IL-12- and
IL-12/IL-18-treated, but not IL-18-treated, mice (Fig. 4). However, by day 42 levels of IFN-
production in response to collagen in IL-18-treated mice were
equivalent to those in IL-12/IL-18- and IL-12-treated mice. These data
reflected the expression of IFN- detected in sera (Fig. 3
, A and B). Collagen-driven cellular proliferation
was equivalent in all cytokine-treated groups (Fig. 4). Together, these
data show that IL-18 administration facilitated the development of a
Th1 response to collagen, although the kinetics were apparently delayed
in comparison with IL-12 and IL-12/IL-18 recipient groups. This did
not, however, correlate with a delay in clinical disease onset,
suggesting that IL-18-mediated effects beyond Th1 cell induction.
|
was easily detected in
sera of IL-18-treated mice (Fig. 3C), whereas lower levels
were present in IL-12 recipients. Synergistic enhancement of serum
TNF- levels was evident in IL-12/IL-18-treated mice. In chronic
phase, TNF- levels in IL-18-treated mice were further enhanced,
comparable by then with those in IL-12/IL-18 recipients (Fig. 3D). However, TNF- levels remained significantly lower in
IL-12 recipients. The pattern of serum IL-6 expression was similar to
that of TNF-, with significantly lower levels detected in
IL-12-treated mice compared with IL-18 and IL-12/IL-18 recipients at
both time points (Fig. 3, E and F). IL-12 (p70)
was not detected in sera from any group. We next investigated monokine
production in vitro by lymph node cells. On day 24, higher levels of
spontaneous and collagen-inducible TNF- and IL-6 production by LNC
were evident from IL-12/IL-18-treated than from single cytokine-treated
mice (Fig. 5). Paradoxically, although
TNF- was produced in response to collagen in both IL-12 and IL-18
recipients, higher levels of TNF- were produced in the former.
Because higher levels of serum TNF- and IL-6 were evident on day 29
in IL-18 recipients compared with IL-12-treated mice (Fig. 3, C and E), this observation probably reflects the
high levels of IFN- induced in vitro in LNC from the IL-12-treated
mice (Fig. 4). By day 42, IL-18-treated mice exhibited high levels of
TNF- and IL-6 production, which were by then comparable with those
in IL-12/IL-18- and IL-12-treated mice. In vitro cytokine production
was greater in all cytokine-treated mice than in saline-treated
IFA/collagen controls. By day 74, IL-6 and TNF- production was
reduced and equivalent to that in collagen/IFA controls (Fig. 5). These
data together indicate that IL-12 and IL-18 induced differential
cytokine production by monocyte populations, suggesting again that
their functional activities in vivo may not be identical.
|
and TNF- expression in vivo. Membrane-bound and
intracellular TNF- expression in macrophage-enriched spleen cell
populations from DBA/1 mice was determined by FACS analysis after
stimulation for 4 h with 100 ng/ml of either IL-12 or IL-18 in the
presence of brefeldin A to prevent secreted cytokine-mediated
interactions. TNF- expression was significantly enhanced by the
presence of IL-18, but not IL-12 (Fig. 6A). In parallel cultures
maintained without brefeldin A, secreted TNF- was higher in
IL-18-treated than in IL-12-treated or medium control cultures (Fig. 6B). Similar data were obtained when responses in adherent
spleen cells from arthritic and naive mice were compared, although
baseline TNF- secretion was higher in the former (data not shown).
IL-18 did not induce detectable IL-10 production, indicating that its
effects on macrophages are selective and probably proinflammatory.
These data clearly demonstrate that IL-18, but not IL-12, can
directly promote TNF- production, independent of IFN- production
and provide a rationale for the enhanced TNF- levels detected in
IL-18-treated mice.
|
Finally, we sought evidence for anti-collagen Ab production.
As expected, collagen-specific IgG2a Abs, which are typically produced
during a Th1 response, were detected in the sera of IL-12-, IL-18-, and
IL-12/IL-18-treated mice on day 42 (Fig. 7B). However, titers of
collagen-specific IgG1 were also elevated in IL-18 and IL-12/IL-18
recipients compared with PBS recipient controls (Fig. 7A).
In contrast, IgG1 Abs were not elevated in IL-12-treated mice. Thus,
IL-18 may promote Ab responses through pathways that are not strictly
Th1 cell regulated in vivo.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
IL-18 has been identified as a critical regulatory factor in the
evolution of Th1 immune responses, usually acting in synergy with IL-12
(15). However, the mechanisms by which IL-18 promoted
articular inflammation in the present study were unlikely to be fully
explained by synergy with endogenous expression of IL-12. Key
differences emerged on comparing IL-12- and IL-18-treated mice. The
kinetics of IFN- induction by collagen were delayed in IL-18
recipient mice, since only by day 42 did IL-18-treated mice exhibit an
IFN- response comparable with that of IL-12 recipients. TNF-
levels were consistently higher in serum of IL-18-treated mice than in
that of IL-12-treated mice. This may reflect a direct effect of IL-18
on TNF- production. Of interest, IL-18, but not IL-12, directly
induced high levels of TNF- production by macrophages in vitro, with
no apparent effect on IL-10 production. However, indirect effects
mediated through promotion of T cell/dendritic cell interactions
(9) are also possible and may explain the sustained
effects of IL-18 on cytokine expression and disease onset (usually
after day 29) despite the cessation of cytokine administration after
day 24. Finally, the isotype of the anti-collagen Ab response in
IL-18 recipients was not restricted to IgG2a, suggesting effects beyond
Th1-mediated B cell help. Together, these data suggest effects for
IL-18 in vivo in the development of inflammatory arthritis that extend
beyond T cell differentiation.
IL-12 administration has previously been shown to promote the
development of CIA (27, 30, 35). We have now demonstrated
that addition of IL-18 to IL-12 significantly enhanced the severity of
erosive disease progression. Our data suggest that enhanced Th1
responses to collagen were present early in combination
cytokine-treated mice, associated with high levels of TNF-
production. The mechanism of such synergy between IL-12 and IL-18 in
vivo is unknown at present, but may include enhanced IL-18R expression
by IL-12 (36, 37), enhanced TNF- production through
direct effects of IL-18, and accelerated Ig production by IL-18 in both
IgG1 and IgG2a subclasses. The role of Th1 responses in CIA, and in
particular the contribution of IL-12, continue to be debated. Type 1
cytokines predominate during disease development (25), and
administration of type 2 cytokines, including IL-4 and IL-10, is
generally beneficial, indicating that Th1 responses are important
(32, 38). However, IL-12 exhibits biphasic effects during
CIA (27, 30), perhaps through differential IL-10
induction, and in IFNR-deficient mice it is proinflammatory through
IFN--independent pathways (39). Similarly, on collagen
challenge, a proportion of IL-12-deficient mice develop arthritis,
clearly suggesting that IL-12-independent pathways exist
(26).
TNF- production is of paramount importance in RA
(40, 41, 42). Several studies have now demonstrated the
efficacy of TNF- blockade in murine arthritis models and in RA,
confirming the pivotal importance of this cytokine (29, 43, 44, 45). Those factors that, in turn, drive TNF- production
in RA are less clear. IL-18 can induce significant TNF- expression
in synovial membrane cultures in synergy with IL-12 and IL-15
(1). Such TNF- is induced both through direct effects
on macrophages and through T cell activation. Others have demonstrated
similar enhancement of monokine expression by IL-18 through
CD14-negative cells in human peripheral blood (19).
Together with the results of the present study, this suggests that
cytokines such as IL-18 may promote TNF- production with consequent
articular inflammation and destruction. In comparison with the
relatively restricted expression of IL-12 and its receptor, the broad
distribution of IL-18 in macrophages, dendritic cells, chondrocytes,
and synovial fibroblasts together with the presence of IL-18R on
macrophages, Th1 cells, and NK cells suggest that IL-18 mediates an
important general role in early immune regulation. Our data suggest
that such effects may be of relevance in chronic autoimmune disorders
beyond RA to include inflammatory bowel disease, in which IL-18 has
also been detected (2, 3).
IL-18 retarded the effect of Th2 to Th1 transition in NOD mice (24). CIA differs from this model, in that IL-18 administration can be precisely timed with Ag priming and challenge. However, because mature Th1 cells continue to express IL-18R, whereas Th2 cells do not (37), the net effect of IL-18 in chronic lesions in which activated memory T cells predominate is likely to be proinflammatory. The present study clearly demonstrates that such proinflammatory potential can promote tissue destruction. IL-18 should therefore be regarded as a potential therapeutic target in RA synovitis and in other chronic autoimmune diseases in which similar pathophysiologic pathways are implicated.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Iain B. McInnes, Centre for Rheumatic Diseases, Department of Medicine, Glasgow Royal Infirmary, 10 Alexandra Parade, Glasgow, U.K. G31 2ER.
3 Abbreviations used in this paper: ICE, IL-1ß-converting enzyme; RA, rheumatoid arthritis; CIA, collagen-induced arthritis; LNC, lymph node cultures.
Received for publication November 29, 1999. Accepted for publication March 27, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-inducing factor and regulates LPS-induced IFN- production. Nature 386:619.[Medline]
production by T cells. Nature 378:88.[Medline]
-inducing factor) messenger RNA and functional protein by murine keratinocytes. J. Immunol. 159:298.[Abstract]
-inducing factor) is produced by osteoblasts and acts via granulocyte/macrophage colony-stimulating factor and not via interferon- to inhibit osteoclast formation. J. Exp. Med. 185:1005. inducing factor in the adrenal cortex. J. Biol. Chem. 272:2035. production by IL-12 and IL-18. Curr. Opin. Immunol. 10:259.[Medline]
-inducing factor (IL-18) increases allergic sensitization, serum IgE, Th2 cytokines, and airway eosinophilia in a mouse model of allergic asthma. J. Immunol. 164:2701. upon combined stimulation with interleukin (IL)-12 and IL-18: a novel pathway of autocrine macrophage activation. J. Exp. Med. 187:2103.-inducing factor) induces IL-8 and IL-1ß via TNF production from non-CD14+ human blood mononuclear cells. J. Clin. Invest. 101:711.[Medline]
production. J. Immunol. 159:5528.[Abstract]
-inducing factor) regulates early cytokine production in, and promotes resolution of, bacterial infection in mice. J. Immunol. 160:299.. Arthritis Rheum. 42:100.[Medline]
-chain administration prevents murine collagen-induced arthritis: a role for IL-15 in development of antigen-induced immunopathology. J. Immunol. 160:5654. production in rheumatoid arthritis. Nat. Med. 3:189.[Medline]
production. J. Immunol. 161:3400. receptor-deficient mice. J. Immunol. 158:5507.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  Y. Y. Wan and R. A. Flavell How Diverse--CD4 Effector T Cells and their Functions J Mol Cell Biol, October 1, 2009; 1(1): 20 - 36. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M B Nickdel, P Conigliaro, G Valesini, S Hutchison, R Benson, R V Bundick, A J Leishman, I B McInnes, J M Brewer, and P Garside Dissecting the contribution of innate and antigen-specific pathways to the breach of self-tolerance observed in a murine model of arthritis Ann Rheum Dis, June 1, 2009; 68(6): 1059 - 1066. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Sattler, U. Wagner, M. Rossol, J. Sieper, P. Wu, A. Krause, W. A. Schmidt, S. Radmer, S. Kohler, C. Romagnani, et al. Cytokine-induced human IFN-{gamma}-secreting effector-memory Th cells in chronic autoimmune inflammation Blood, February 26, 2009; 113(9): 1948 - 1956. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P I Sidiropoulos, G Goulielmos, G K Voloudakis, E Petraki, and D T Boumpas Inflammasomes and rheumatic diseases: evolving concepts Ann Rheum Dis, October 1, 2008; 67(10): 1382 - 1389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W Niedbala, B Cai, X Wei, A Patakas, B P Leung, I B McInnes, and F Y Liew Interleukin 27 attenuates collagen-induced arthritis Ann Rheum Dis, October 1, 2008; 67(10): 1474 - 1479. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Xu, H.-R. Jiang, P. Kewin, Y. Li, R. Mu, A. R. Fraser, N. Pitman, M. Kurowska-Stolarska, A. N. J. McKenzie, I. B. McInnes, et al. IL-33 exacerbates antigen-induced arthritis by activating mast cells PNAS, August 5, 2008; 105(31): 10913 - 10918. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-M. Dai, Z.-Z. Shan, H. Xu, and K. Nishioka Cellular targets of interleukin-18 in rheumatoid arthritis Ann Rheum Dis, November 1, 2007; 66(11): 1411 - 1418. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Brenner, H.-C. Meng, N. C. Yarlett, B. Joe, M. M. Griffiths, E. F. Remmers, R. L. Wilder, and P. S. Gulko The Non-MHC Quantitative Trait Locus Cia5 Contains Three Major Arthritis Genes That Differentially Regulate Disease Severity, Pannus Formation, and Joint Damage in Collagen- and Pristane-Induced Arthritis J. Immunol., June 15, 2005; 174(12): 7894 - 7903. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S-M Dai, K Nishioka, and K Yudoh Interleukin (IL) 18 stimulates osteoclast formation through synovial T cells in rheumatoid arthritis: comparison with IL1{beta} and tumour necrosis factor {alpha} Ann Rheum Dis, November 1, 2004; 63(11): 1379 - 1386. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T Rooney, E Murphy, M Benito, P Roux-Lombard, O FitzGerald, J-M Dayer, and B Bresnihan Synovial tissue interleukin-18 expression and the response to treatment in patients with inflammatory arthritis Ann Rheum Dis, November 1, 2004; 63(11): 1393 - 1398. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. P. Leung, D. Xu, S. Culshaw, I. B. McInnes, and F. Y. Liew A Novel Therapy of Murine Collagen-Induced Arthritis with Soluble T1/ST2 J. Immunol., July 1, 2004; 173(1): 145 - 150. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Maffia, J. M. Brewer, J. A. Gracie, A. Ianaro, B. P. Leung, P. J. Mitchell, K. M. Smith, I. B. McInnes, and P. Garside Inducing Experimental Arthritis and Breaking Self-Tolerance to Joint-Specific Antigens with Trackable, Ovalbumin-Specific T Cells J. Immunol., July 1, 2004; 173(1): 151 - 156. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Bossu, D. Neumann, E. Del Giudice, A. Ciaramella, I. Gloaguen, G. Fantuzzi, C. A. Dinarello, E. Di Carlo, P. Musiani, P. L. Meroni, et al. IL-18 cDNA vaccination protects mice from spontaneous lupus-like autoimmune disease PNAS, November 25, 2003; 100(24): 14181 - 14186. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F Y Liew, X-Q Wei, and I B McInnes Role of interleukin 18 in rheumatoid arthritis Ann Rheum Dis, November 1, 2003; 62(90002): ii48 - 50. [Full Text] [PDF]
|
|
|
|
|
|
C. A. Cannetti, B. P. Leung, S. Culshaw, I. B. McInnes, F. Q. Cunha, and F. Y. Liew IL-18 Enhances Collagen-Induced Arthritis by Recruiting Neutrophils Via TNF-{alpha} and Leukotriene B4 J. Immunol., July 15, 2003; 171(2): 1009 - 1015. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. K. Banda, A. Vondracek, D. Kraus, C. A. Dinarello, S.-H. Kim, A. Bendele, G. Senaldi, and W. P. Arend Mechanisms of Inhibition of Collagen-Induced Arthritis by Murine IL-18 Binding Protein J. Immunol., February 15, 2003; 170(4): 2100 - 2105. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Gracie, S. E. Robertson, and I. B. McInnes Interleukin-18 J. Leukoc. Biol., February 1, 2003; 73(2): 213 - 224. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. K. Takahashi, T. Morichika, H. Iwagaki, T. Yoshino, R. Tamura, S. Saito, S. Mori, T. Akagi, N. Tanaka, and M. Nishibori Effect of {beta}2-Adrenergic Receptor Stimulation on Interleukin-18-Induced Intercellular Adhesion Molecule-1 Expression and Cytokine Production J. Pharmacol. Exp. Ther., February 1, 2003; 304(2): 634 - 642. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. P. Leung, N. Sattar, A. Crilly, M. Prach, D. W. McCarey, H. Payne, R. Madhok, C. Campbell, J. A. Gracie, F. Y. Liew, et al. A Novel Anti-Inflammatory Role for Simvastatin in Inflammatory Arthritis J. Immunol., February 1, 2003; 170(3): 1524 - 1530. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Komai-Koma, J. A. Gracie, X.-q. Wei, D. Xu, N. Thomson, I. B. McInnes, and F. Y. Liew Chemoattraction of Human T Cells by IL-18 J. Immunol., January 15, 2003; 170(2): 1084 - 1090. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. P. Leung, M. Conacher, D. Hunter, I. B. McInnes, F. Y. Liew, and J. M. Brewer A Novel Dendritic Cell-Induced Model of Erosive Inflammatory Arthritis: Distinct Roles for Dendritic Cells in T Cell Activation and Induction of Local Inflammation J. Immunol., December 15, 2002; 169(12): 7071 - 7077. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ariel, D. Novick, M. Rubinstein, C. A. Dinarello, O. Lider, and R. Hershkoviz IL-12 and IL-18 induce MAP kinase-dependent adhesion of T cells to extracellular matrix components J. Leukoc. Biol., July 1, 2002; 72(1): 192 - 198. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.B. Sugerman, N.W. Savage, L.J. Walsh, Z.Z. Zhao, X.J. Zhou, A. Khan, G.J. Seymour, and M. Bigby THE PATHOGENESIS OF ORAL LICHEN PLANUS Critical Reviews in Oral Biology & Medicine, July 1, 2002; 13(4): 350 - 365. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Esfandiari, I. B. McInnes, G. Lindop, F.-P. Huang, M. Field, M. Komai-Koma, X.-q. Wei, and F. Y. Liew A Proinflammatory Role of IL-18 in the Development of Spontaneous Autoimmune Disease J. Immunol., November 1, 2001; 167(9): 5338 - 5347. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Neighbors, X. Xu, F. J. Barrat, S. R. Ruuls, T. Churakova, R. Debets, J. F. Bazan, R. A. Kastelein, J. S. Abrams, and A. O'Garra A Critical Role for Interleukin 18 in Primary and Memory Effector Responses to Listeria monocytogenes That Extends Beyond Its Effects on Interferon {gamma} Production J. Exp. Med., August 6, 2001; 194(3): 343 - 354. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. C. Park, J. C. M. Morel, M. A. Amin, M. A. Connors, L. A. Harlow, and A. E. Koch Evidence of IL-18 as a Novel Angiogenic Mediator J. Immunol., August 1, 2001; 167(3): 1644 - 1653. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-q. Wei, B. P. Leung, H. M. L. Arthur, I. B. McInnes, and F. Y. Liew Reduced Incidence and Severity of Collagen-Induced Arthritis in Mice Lacking IL-18 J. Immunol., January 1, 2001; 166(1): 517 - 521. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. B. Joosten, F. A. J. van de Loo, E. Lubberts, M. M. A. Helsen, M. G. Netea, J. W. M. van der Meer, C. A. Dinarello, and W. B. van den Berg An IFN-{gamma}-Independent Proinflammatory Role of IL-18 in Murine Streptococcal Cell Wall Arthritis J. Immunol., December 1, 2000; 165(11): 6553 - 6558. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. M. Morel, C. C. Park, J. M. Woods, and A. E. Koch A Novel Role for Interleukin-18 in Adhesion Molecule Induction through NFkappa B and Phosphatidylinositol (PI) 3-Kinase-dependent Signal Transduction Pathways J. Biol. Chem., September 28, 2001; 276(40): 37069 - 37075. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
