The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Faas, S. J.
Right arrow Articles by Rother, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Faas, S. J.
Right arrow Articles by Rother, R. P.
The Journal of Immunology, 2000, 164: 6340-6348.
Copyright © 2000 by The American Association of Immunologists

Primary Structure and Functional Characterization of a Soluble, Alternatively Spliced Form of B7-11

Susan J. Faas, Michelle A. Giannoni, Angela P. Mickle, Cheri L. Kiesecker, Deborah J. Reed, Dayang Wu, William L. Fodor, John P. Mueller2, Louis A. Matis and Russell P. Rother3

Alexion Pharmaceuticals, New Haven, CT 06511


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recent studies have suggested that soluble forms of B7-1 and B7-2 may exist, but transcripts that code for these molecules have not been previously described. In this study, we report the cloning and characterization of an alternatively spliced soluble form of porcine B7-1 (sB7-1) that lacks exons coding for both the transmembrane and cytoplasmic domains. Northern blot analysis of RNA from alveolar macrophages revealed an approximate 3:1 ratio of the transmembrane form of B7-1 mRNA relative to sB7-1 mRNA. Porcine B7-1 was present on the surface of both B and T cells following stimulation with PMA/ionomycin. A histidine-tagged form of porcine sB7-1 (sB7-1-His) interacted with both CD28 and CTLA-4, and effectively blocked IL-2 production from human responder cells stimulated with PHA and either porcine or human stimulator cells. In addition, sB7–1-His inhibited human T cell proliferation in response to porcine or human peripheral blood leukocytes. This study is the first report of an alternatively spliced form of B7 that codes for a soluble protein. Furthermore, these data demonstrate that porcine B7-1 interacts with the human receptors CD28 and CTLA-4, suggesting a potential role for this molecule in pig to human xenotransplantation. Possible physiological functions for the soluble form of B7-1 are discussed.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In addition to TCR-mediated Ag recognition, T cell activation is dependent on signals generated by interactions between T cell costimulatory molecules and their ligands expressed on APCs (1). The related proteins CD28 and CTLA-4 have been shown to play critical roles in the regulation of T cell activation via interactions with B7 ligands expressed on various APCs (2, 3). The B7 molecules, B7-1 and B7-2, are type I transmembrane glycoproteins containing an Ig V region-like domain, an Ig C region-like domain, and a short cytoplasmic tail (3, 4). CD28-B7 interactions amplify T cell activation signals, and TCR Ag recognition in the absence of CD28 engagement may result in anergy (2, 3, 5, 6). Conversely, B7 signaling through CTLA-4 down-regulates T cell activation, as evidenced by the finding that CTLA-4-deficient mice experience profound peripheral lymphoid expansion (7, 8, 9, 10).

It has been suggested that naturally occurring soluble forms of both B7-1 and B7-2 may exist. For example, one study identified a soluble factor in the medium from primary porcine endothelial cells that mediates T cell activation (11). It was hypothesized that this soluble factor is porcine B7-2 based on the observations that its activity is CD28 dependent and that B7-1 mRNA is not detectable in these cells. An additional report demonstrated detectable levels of soluble human B7-1 in the synovial fluid of arthritic patients (12). However, it has not been determined whether these putative soluble forms of B7-1 and B7-2 are encoded from alternatively spliced messages or derived from full-length molecules on the cell surface through enzymatic cleavage or cell death.

Several alternate transcripts exist for B7-1 and B7-2. For example, multiple murine B7-2 alternatively spliced products have been identified (13). Additionally, an alternatively spliced form of murine B7-1 lacking the Ig C region-like extracellular domain has been described (14). Resolution of the B7-1 genomic organization in mouse and human indicates that both the transmembrane and cytoplasmic domains are encoded by separate exons, making it possible to exclude these regions without disrupting the extracellular domains (15, 16). Further analysis of the murine B7-1 genomic organization identified an additional exon that encodes an alternative cytoplasmic domain, confirming the presence of at least one downstream splice site (17). Taken together, these studies support the possibility that soluble B7 molecules could be generated through alternative splicing.

In this study, we describe the cloning of the porcine B7-1 homologue. Furthermore, this is the first study of an alternatively spliced form of B7-1 that encodes a soluble protein lacking both the transmembrane and cytoplasmic domains. Soluble porcine B7-1 (sB7-1)4 maintains its ability to bind both CTLA-4 and CD28 and can function to abrogate human T cell activation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abs and recombinant proteins

Various mAbs reactive with porcine cell surface markers were purchased from VMRD (Pullman, WA), including anti-CD3 (clone 8E6), anti-IgM (clone PG145A), anti-class I (clone PT85A), and anti-class II (clone MSA3). The anti-porcine B7-2 mAb was generated at Alexion Pharmaceuticals (New Haven, CT). The functionally blocking anti-CD28 mAb 9.3 was a kind gift of Dr. Carl June (Department of Molecular and Cellular Engineering, University of Pennsylvania, Philadelphia, PA), and the anti-CD59 mAb MEM43 was obtained from Biodesign International (Kennebunkport, ME). Rabbit antiserum directed against porcine B7-1 was generated by repeated s.c. immunization with sB7-1 containing six histidine residues (sB7-1-His), according to methods routinely performed at Cocalico (Reamstown, PA). The IgG fractions from preimmune and immune sera were purified by passage over a protein A-Sepharose column (Pharmacia, Piscataway, NJ). The rabbit anti-histidine polyclonal IgG was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). FITC-conjugated goat anti-rabbit and goat anti-mouse, and PE-labeled goat anti-rabbit secondary reagents were obtained from Zymed (South San Francisco, CA). Human CTLA-4Ig was purchased from Ancell (Bayport, MN), while recombinant porcine P-selectin-His was cloned and purified at Alexion Pharmaceuticals.

Cells and cell lines

To purify PBL, heparinized porcine peripheral blood was obtained from adult swine (Cocalico). Human peripheral blood was collected from healthy adult volunteers by venipuncture. Blood samples from either species were diluted 1/2 with HBSS (Life Technologies, Grand Island, NY), and the mononuclear fraction containing PBL was obtained by centrifugation over a Ficoll density gradient (Lymphocyte Separation Medium; Cellgro, Herndon, VA). Low density cells were collected from the interface and washed repeatedly in PBS containing 5% heat-inactivated bovine FCS (HyClone, Logan, UT). Viable cells were enumerated by trypan blue exclusion. The human T cell line, Jurkat, and the human B cell line, Raji, were obtained from American Type Culture Collection (Manassas, VA). Porcine aortic endothelial cells (PAEC) were purchased from Cell Systems (Kirkland, WA).

Cloning of porcine B7-1

Total RNA was prepared from freshly isolated porcine PBL using the acid/guanidinium thiocyanate technique (18). Ten micrograms of total RNA were heated at 65°C for 3 min, quenched on ice, and subjected to first strand cDNA synthesis for 1 h at 37°C in the following 100 µl reaction mixture: 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 10 mM dithiothreitol, 0.20 mM of each dNTP, 0.5 µg oligo(dT16), and 20 U of avian myeloblastosis virus reverse transcriptase (Seikagaku, Rockville, MD). The following oligonucleotide primers synthesized at Oligos Etc. (Wilsonville, OR) were generated from regions of high homology between human and mouse B7-1 sequence: 1) 5'-TGGCCCGAGTATAAGAACCGGAC-3' and 2) 5'-TCAGTTTCAGGATCTTGGGAAA-3'. A 5-µl aliquot of the cDNA pool was used as a template in a 100 µl PCR reaction under the following reaction conditions: 50 mM KCl, 10 mM Tris-HCl (pH 9), 1.5 mM MgCl2, 0.1% (w/v) gelatin, 1% Triton X-100, 200 µM each dNTP, 2.5 U Taq DNA polymerase (Perkin-Elmer Cetus, Norwalk, CT), and 25 pmol of each primer. PCR amplification was performed for 30 cycles (94°C for 1 min, 50°C for 1 min, 72°C for 1 min), followed by a 1 cycle extension step at 72°C for 10 min. The resulting 338-bp fragment was cloned into the pCR2.1 vector using the T/A cloning system, as described by the manufacturer (Invitrogen, San Diego, CA) and identified by sequence analysis as a B7-1 homologue. Two gene-specific oligonucleotides were derived from the porcine B7-1 sequence, and a 250-bp fragment was generated by PCR. This DNA fragment was used to screen a {lambda}gt10 porcine macrophage library (a generous gift from Dr. Michael Murtaugh, Department of Veterinary PathoBiology, University of Minnesota, St. Paul, MN).

To screen the {lambda}gt10 porcine macrophage library, approximately 1 x 106 phage were isolated on nitrocellulose filters (Schleicher & Schuell, Keene, NH). Filters were denatured for 1.5 min (1.5 M NaCl and 0.5 N NaOH), neutralized for 5 min (1.5 M NaCl and .05 M Tris, pH 8.5), rinsed in 3x SSC, air dried, and UV cross-linked in a UV Stratalinker 2400 (Stratagene, La Jolla, CA). Filters were then prehybridized in BSA/SDS buffer (1% BSA, 7% SDS, 0.5 M sodium phosphate buffer, pH 6.8, and 1 mM EDTA) for 2 h at 65°C before addition of the porcine B7-1 fragment, previously labeled with {alpha}-32P (NEN, Pittsburgh, PA) using the Prime-It II random primer kit (Stratagene) to a sp. act. of 1 x 109 cpm/µg of DNA. Membranes were hybridized at 60°C overnight and subsequently washed using the following conditions: two 30-min washes with 2x SSC/0.1% SDS at room temperature, one 30-min wash with 0.5x SSC/0.1% SDS at 50°C, and one 30-min wash with 0.2x SSC/0.1% SDS at 60°C. Positive plaques present on duplicate lifts were purified and the B7-1 DNA was rescued by PCR using primers that flanked the insertion site of the {lambda}gt10 vector (Clontech, Palo Alto, CA). After cloning the PCR fragment into pCR2.1-TOPO, both strands of the putative full-length clone were sequenced using the chain termination method. Clones derived from different PCR reactions were also sequenced to rule out potential errors induced during amplification. The DNA templates were primed with vector sequence primers flanking the multiple cloning site, or primers constructed from internal cDNA sequence. All clones isolated from the {lambda}gt10 porcine macrophage library were identified as soluble porcine B7-1 (sB7-1).

The transmembrane form of porcine B7-1 (tmB7-1) was isolated by RT-PCR of freshly isolated porcine lung RNA using an oligonucleotide from the 3' end of the sB7-1 coding region as the 5' primer (GCTACCAACACGATGCTTTCC) and oligo(dT16) as the 3' primer. Conditions for RNA isolation and RT-PCR were otherwise identical to those described above. The two major products resulting from the RT-PCR were cloned into pCR2.1-TOPO, and inserts were sequenced for identification.

Generation of His-tagged sB7-1

sB7-1 tagged with a carboxyl-terminal histidine hexapeptide (sB7-1-His) was generated in the mammalian expression vector Apex3P (19) by PCR amplification of B7-1 cDNA. The 5' primer (CCGGGGATCCCTTCTGTTTTCATCCTCATCAAGC) was derived from the 5' untranslated region (UTR) of B7-1 and contained a BamHI site for subcloning. The 3' primer (GGCCTGCAGGTCATCAATGGTGATGGTGATGGTGGCATTTTTGCCAGTTGAAGGTCTGTGAC) inserted the histidine tag just upstream of the stop codon and an Sse83371 subcloning site. For stable expression of sB7-1-His, 293-EBNA embryonic kidney cells (Invitrogen, Carlsbad, CA) were transfected with sB7-1-His/Apex3P, as previously described (19). Cells were grown in DMEM containing 5% FCS, 2 mM L-glutamine, 100 IU/ml penicillin, and 100 µg/ml streptomycin (D10 medium) with puromycin at a final concentration of 1 µg/ml. Selected cells were cloned by limiting dilution, and those producing high levels of protein were chosen by Western blot analysis of cell supernatants using rabbit anti-histidine polyclonal IgG. The sB7-1-His protein was purified by affinity chromatography using a nickel-charged nitrilotriacetic acid resin (Qiagen, Chatsworth, CA), as previously described (20). For transient transfections, the full-length untagged version of sB7-1 in pCR2.1-TOPO was subcloned into the mammalian expression vector Apex3P. sB7-1/Apex3P and sB7-1-His/Apex3P were then transfected into 293 cells, as described above. Cells were grown in D10 medium for 12 h and subsequently transferred into the serum-free medium HB PRO (Irvine Scientific, Santa Ana, CA) for 36 h. Cell supernatants were then collected for Western blot analysis.

Northern blot analysis

Total RNA from porcine alveolar macrophages was kindly provided by Dr. Michael Murtaugh. Northern blot analysis was performed using the NorthernMax Kit based on the manufacturer’s protocol (Ambion, Arlington Heights, IL) and a total of 10 µg of RNA per lane. Blots were hybridized with various [{alpha}-32P]UTP-labeled RNA probes that were generated using the MAXIscript In Vitro Transcription Kit (Ambion). RNA transcripts were synthesized from B7-1 DNA fragments contained in pCR2.1-TOPO. These fragments consisted of either the complete 3' UTR of sB7-1 (soluble probe), the complete transmembrane and cytoplasmic regions of tmB7-1 (transmembrane probe), or the extracellular domain, which is common to both the soluble and transmembrane forms of B7-1 (common probe). Levels of each transcript were determined by densitometry using a Gel Doc 1000 (Bio-Rad, Hercules, CA) and NIH Image 1.61 software (downloaded from http://rsb.info.nih.gov/nih-image/download.html).

PMA/ionomycin activation of porcine PBL

Porcine PBL intended for use as stimulator cells in mixed allogeneic or xenogeneic lymphocyte cultures (see below) were resuspended in R10 medium (RPMI containing 5 x 10-5 M 2-ME, 10 mM L-glutamine, 100 IU/ml penicillin, 100 µg/ml streptomycin, and 10% FCS) supplemented with 1 ng/ml PMA (Sigma, St. Louis, MO) and 400 ng/ml ionomycin (Sigma). The cells were seeded in 24-well plates at 2.5 x 106 cells/ml in a final volume of 2 ml, and incubated for 48–72 h at 37°C in 5% CO2 in air. Mitomycin C (50 µg/ml; Sigma) was added to the cells during the last 30 min of culture. Activated cells were then harvested and washed extensively to remove residual PMA/ionomycin and/or mitomycin C. Porcine PBL used in FACS analysis were stimulated with 20 ng/ml PMA and 200 ng/ml ionomycin for 48 h.

Immunofluorescence and flow cytometry

Activated cell populations were preincubated in PBS containing 5% goat serum. Cells were then incubated with purified IgG from hyperimmune serum from a rabbit immunized with sB7-1-His (rabbit anti-porcine-B7-1) or from preimmune rabbit serum, in combination with murine mAbs directed against porcine CD3, IgM, class II, and B7-2 cell surface Ags, in PBS containing 2% goat serum. Cells were washed in the same and then reacted with FITC-labeled goat anti-mouse Ig and with PE-labeled goat anti-rabbit Ig. The cells were again washed and analyzed for surface immunofluorescence using a FACSort flow cytometer and CellQuest Software (Becton Dickinson, Mountain View, CA). Further analysis was performed using WinMDI version 2.7 software (provided by Dr. Joseph Trotter, University of San Diego, CA).

In experiments performed to assess the binding of sB7-1 to the surface of Jurkat cells, sB7-1-His (2.5 µg/ml) was preincubated in HBSS containing either anti-CD28 mAb (25 µg/ml), anti-CD59 mAb (20 µg/ml), anti-CD3 mAb (20 µg/ml), human CTLA-4Ig (20 µg/ml), or buffer alone before addition to Jurkat cells (2.5 x 105 cells/reaction) for an additional incubation. Cells were then incubated with purified rabbit anti-porcine-B7-1 IgG (10 µg/ml), washed in HBSS, and finally incubated in the FITC-conjugated goat anti-rabbit secondary reagent (1/100 dilution). All incubations were performed for 30 min at 4°C. Jurkat/sB7-1-His binding was detected by cell surface immunofluorescence and flow cytometry, as described above.

Costimulation assays

The Jurkat T cell costimulatory assay has been described previously (21, 22). Briefly, PAEC were seeded in wells of 96-well microtiter plates at 5 x 104 cells/well in R10 medium, and cells were allowed to adhere overnight at 37°C. Jurkat T cells (1 x 106 cells/well) were then added to the wells in the presence or absence of 10 µg/ml PHA (Sigma) and either serial dilutions of sB7-1-His, 50 µg/ml of human CTLA-4Ig, or 100 µg/ml of porcine P-selectin-His. In some experiments, Raji cells (1 x 106 cells/well) were substituted for PAEC, but were added to the Jurkat cells at the initiation of the experiment. The cultures were maintained at 37°C in 5% CO2 for 24 h, at which time the culture supernatants were harvested. IL-2 was measured in supernatants using an ELISA kit (Quantikine Human IL-2 Immunoassay; R&D Systems, Minneapolis, MN), according to the manufacturer’s protocol. Briefly, serial dilutions of a human rIL-2 standard (R&D Systems) or culture supernatants were added, in duplicate, to ELISA wells that had been previously coated with a mAb specific for human IL-2, and plates were incubated overnight at 4°C. Unbound cytokine was removed by repeated washes. Bound IL-2 was detected using a second IL-2-specific Ab conjugated with HRP, followed by addition of a hydrogen peroxide/chromogen substrate. The reaction was stopped by the addition of 2 N sulfuric acid. The OD of each well was determined using a microtiter plate reader (Bio-Rad model 3550, Hercules, CA) set to 450 nm, with values corrected by subtraction of readings taken at 595 nm. IL-2 concentrations were calculated using Microplate Manager software (Bio-Rad).

Mixed lymphocyte reactions

Stimulator cells (mitomycin C-treated allogeneic human PBL or PMA/ionomycin-activated porcine PBL; 5 x 105 cells/well) and responder lymphocytes (human PBL; 5 x 105 cells/well) were combined in wells of a 96-well microtiter plate in the presence or absence of serially diluted sB7-1-His or of the indicated concentrations of CTLA-4Ig or porcine P-selectin-His (final volume, 0.2 ml/well). Cells were maintained in R10 medium for 4–5 days at 37°C in 5% CO2 in air. [3H]thymidine (1 µCi/well; NEN DuPont, Boston, MA) was added to the cell cultures during the last 16–18 h of the incubation. The cells were harvested onto glass fiber filters with an automated sample harvester (Wallac, Turku, Finland) and the filters were counted in a beta liquid scintillation counter (Wallac).

Western blot analysis

Supernatants from 293 cells transiently transfected with sB7-1/Apex3P, sB7-1-His/Apex3P, or Apex3P alone were subjected to SDS-PAGE (4–12% gradient gels) under reducing or nonreducing conditions. Proteins were transferred to nitrocellulose and the membrane was blocked for 1 h in blocking solution (Tris-buffered saline containing 5% dry milk). Blots were incubated for 1 h in fresh blocking solution containing either rabbit anti-histidine polyclonal IgG (0.2 mg/ml) or purified anti-porcine B7-1 polyclonal IgG (2 mg/ml). Blots were then washed three times with Ab wash solution (500 mM NaCl, 35 mM Tris, pH 7.4, 0.5 mM CaCl2, 0.1% SDS, 1% Nonidet P-40, and 0.5% deoxycholic acid) before the addition of fresh blocking solution containing HRP-conjugated goat anti-rabbit secondary Ab (1:5000; Zymed) for 15 min. Finally, blots were washed three times in Ab wash solution, incubated for 1 min in ECL Western blot reagent, and exposed to ECL Hyperfilm (both from Amersham, Arlington Heights, IL).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Molecular cloning and sequence analysis of porcine B7-1

Signals generated by the interactions of CD28 and CTLA-4 with the B7 molecules have been shown to be critically involved in mediating experimental allograft rejection (23, 24). In addition, an important role for these molecules in cellular xenograft rejection is suggested by data showing enhanced graft survival when CD28-B7 interactions are inhibited (25). The demonstration of functional CD28-B7 interactions across the species barrier in the potentially clinically relevant porcine to human xenotransplant model could have significant therapeutic implications, given the demonstrated potency of the human anti-pig cellular immune response.

A recent study indicated that porcine B7-2 is recognized by human CD28, and that this interaction promotes activation of human T cells by porcine APCs (26). To further investigate the importance of porcine B7 molecules in the human anti-pig immune response, porcine B7-1 was cloned from a {lambda}gt10 library generated from porcine lung macrophages. In the initial cloning attempts, only cDNA encoding sB7-1 was obtained from the macrophage library, at a frequency of approximately one clone per 1 x 105 phage. This full-length clone lacked both the transmembrane and cytoplasmic domains. sB7-1 cDNA contained 1206 bp comprised of a 304-bp 5' UTR, a 215-bp 3' UTR including a processing/polyadenylation signal, and an open reading frame that encoded 229 aa (data not shown; GenBank accession number AF203442). The abnormally long 5' UTR observed for sB7-1 corresponded to that of B7-1 reported for other species (4, 27). To obtain tmB7-1, RT-PCR was performed on porcine lung RNA using a 5' primer generated from the end of the sB7-1 coding region and oligo(dT16). A B7-1-specific band of approximately 340 bp was generated that encoded a putative transmembrane domain and a partial cytoplasmic domain, but lacked sequence encoding the translational stop site and the 3' UTR (data not shown; GenBank accession number AF203443). The truncation of tmB7-1 cDNA derived from reverse-transcribed porcine lung RNA and the lack of detection of tmB7-1 in the oligo(dT)-primed porcine macrophage library suggest strong 3' UTR secondary structure in this transcript.

The predicted amino acid sequences for sB7-1, tmB7-1, and human B7-1 (hB7-1) were compared (Fig. 1GoA). Sequences were segregated into domains based on exon boundaries identified for hB7-1 (15). Considering that sB7-1 and tmB7-1 amino acid sequences were identical before the transmembrane domain, only sB7-1 is depicted before this region. Excluding the transmembrane and cytoplasmic domains, which are highly divergent between species, porcine B7-1 and hB7-1 shared 65% sequence identity and an overall conservation of the Ig V-like and Ig C-like structural domains characteristic of other B7 molecules (28). The signal peptide for sB7-1 was 29 aa in length, as determined by amino-terminal sequencing of purified protein. Virtually all amino acid residues that have been shown to be critical for the binding of B7-1 to both CD28 and CTLA-4 (excluding methionine 47 and isoleucine 49) were highly conserved (29, 30, 31, 32, 33). A clone containing the complete coding region for tmB7-1 was not found, but based on sequence comparison with various other species, the terminal amino acid is expected to be very close to the translational stop site.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 1. Sequence comparisons between porcine and human B7-1. A, Amino acid sequences of sB7-1, tmB7-1, and hB7-1 were aligned based on amino acid identity and structural similarity. Identical amino acids are denoted by asterisks, and gaps in the sequences are indicated by dashes. Assignment of structural domains is based on exon boundaries published for hB7-1 and are identified by the following abbreviations: signal peptide, SP; Ig variable-like domain, Ig V-like; Ig constant-like domain, Ig C-like; transmembrane domain, TM; cytoplasmic domain, CYT. The signal peptide is depicted by single underline. The transmembrane domain was determined using the PSORT II program (http://psort.nibb.ac.jp) and is indicated by dashed underline. Sites known to be critical for B7-1 binding to CD28 and/or CTLA-4 are shown by double underline. Translational stop sites are indicated by closed diamonds, while the closed circles at the end of the tmB7-1 sequence indicate that the stop codon was not identified in this molecule. The transmembrane and cytoplasmic domains are absent in sB7-1. B, Partial nucleic acid sequence flanking the junction site of hB7-1 exons 4 and 5 was aligned with sB7-1 and tmB7-1 based on sequence similarities. Encoded amino acid sequences for each are also shown. Protein domains corresponding to exons 4 and 5 are depicted as extracellular or transmembrane. The translational stop site for sB7-1 is indicated by an asterisk.

 
Various splice variants have been reported for the B7 molecules, none of which encode a soluble product (13, 14, 17). To examine the splicing mechanism that generated sB7-1, the nucleic acid and amino acid sequences corresponding to the junction of exons 4 and 5 of hB7-1 were compared with porcine sB7-1 and tmB7-1 (Fig. 1GoB). Sequence identity between the alternative forms of porcine B7-1 were identical in exon 4, but showed no homology beginning with exon 5. A stop codon was generated in the beginning of exon 5 for sB7-1. These data suggest that sB7-1 is a splice variant lacking exons coding for both the transmembrane and cytoplasmic domains and thus represent the first report of a naturally occurring soluble form of B7-1.

Northern analysis of porcine B7-1 splice variants

To determine the relative levels of expression of sB7-1 and tmB7-1 transcripts, Northern blot analysis was performed on total RNA isolated from porcine alveolar macrophages. Reactive RNA species were detected with either a sB7-1-specific probe, a tmB7-1-specific probe, or a probe common to both sB7-1 and tmB7-1. The sB7-1-specific probe hybridized with a single species of approximately 1.3 kb (Fig. 2Go). The size of this message approximates the size of the sB7-1 cDNA clone isolated from the porcine macrophage library. The tmB7-1-specific probe hybridized with a transcript of approximately 3 kb, which represents the membrane form of porcine B7-1. As expected, the tmB7-1-specific probe did not recognize the 1.3-kb species. Finally, the common probe hybridized with both the 1.3- and 3-kb species. The relative densities of the two species reactive with the common probe were determined using National Institutes of Health Image 1.61 software. The tmB7-1 mRNA was present at a 3-fold excess relative to sB7-1. These data indicate that both sB7-1 and tmB7-1 transcripts are well represented in porcine alveolar macrophages.



View larger version (68K):
[in this window]
[in a new window]
 
FIGURE 2. Northern blot analysis of soluble and transmembrane forms of B7-1. Total RNA from porcine alveolar macrophages was electrophoresed, transferred to nitrocellulose, and hybridized with 32P-labeled RNA transcripts. Probes were generated from sequence restricted to sB7-1 (soluble) or tmB7-1 (transmembrane) or sequence common to both forms of the molecule (common). RNA size in kilobases is depicted on the left of the figure, while mRNA species that specifically hybridized with sB7-1 or tmB7-1 are indicated by arrows on the right.

 
Cell surface expression of porcine B7-1

Most studies have indicated that the B7-1 costimulatory molecule is either undetectable or present on only a small subset of resting human B and T cells, but that it is dramatically up-regulated in these cell types upon stimulation by various means (34). To assess the cell surface expression of porcine B7-1 on various subsets of stimulated cells, porcine PBL were evaluated following stimulation with PMA/ionomycin using two-color immunofluorescence (B7-1 was detected by PE-, while other cell surface markers were detected by FITC-conjugated secondary reagents). Following stimulation with PMA/ionomycin, the majority of CD3-, class II-, and B7-2-positive cells were also B7-1 positive (Fig. 3Go, B, C and E, respectively). Virtually all IgM-positive cells were B7-1 positive (Fig. 3GoD). These data suggest that a membrane-bound form of porcine B7-1 is abundant on the surface of both peripheral T cells and APC following cell stimulation.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 3. Expression of cell surface B7-1 on subpopulations of PMA/ionomycin-stimulated porcine PBL. Porcine PBL were isolated from peripheral blood samples and analyzed for the cell surface expression of B7-1 following incubation with PMA/ionomycin for 48 h at 37°C. Cells were reacted with IgG purified from either preimmune rabbit serum (A) or polyclonal rabbit anti-porcine B7-1 (B–E). Lymphocyte subsets were identified by reactivity with mAbs specific for porcine T cells (CD3; B), APC (class II; C), B cells (IgM; D), or B7-2-expressing cells (E). Cells were then reacted with a combination of PE-conjugated goat anti-rabbit and FITC-conjugated goat anti-mouse reagents (A–E). The major lymphoid populations were identified on the basis of forward and side scatter characteristics, and two-color flow-cytometric analysis was performed on 10,000 gated cells. The percentage of positive cells enumerated is indicated.

 
sB7-1 binds human CD28 and CTLA-4

The ligands for several porcine adhesion and costimulatory molecules have been shown to be conserved across species, including humans. These include the ligands for porcine E-selectin, VCAM, and B7-2 (20, 26, 35). The fact that amino acids generally shown to be critical for the binding of B7-1 to both CD28 and CTLA-4 are conserved in porcine B7-1 (Fig. 1GoA) suggests that this molecule could interact with human CD28 and CTLA-4. To confirm this prediction, purified sB7-1-His was incubated with human Jurkat cells. Jurkat cells constitutively express CD28, but do not express CTLA-4 under any culture conditions (36). sB7-1-His specifically bound to Jurkat cells (Fig. 4GoA), but failed to bind a Jurkat derivative cell line that does not express CD28 (TIB 153, data not shown). The binding of sB7-1-His to CD28 was effectively blocked by an anti-CD28 mAb, further establishing the specificity of this interaction. An isotype-matched irrelevant mAb did not interfere with sB7-1-His/CD28 binding.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 4. Porcine B7-1 binding to the human receptors CD28 and CTLA-4. Human Jurkat cells that are known to express CD28, but not CTLA-4, were incubated with sB7-1-His, and binding was determined by FACS analysis (see Materials and Methods). A, Depicts the binding of sB7-1-His to Jurkat cells that have been previously incubated with buffer alone (No Ab), with a functionally blocking anti-CD28 mAb, or with an irrelevant isotype-matched mAb (Anti-CD59). B, Shows the binding of sB7-1-His following preincubation with buffer alone (No Ab), with human CTLA-4Ig, or with an irrelevant isotype-matched mAb (Anti-CD3). The binding of the FITC-conjugated secondary reagent in the absence of sB7-1-His is shown in both panels (Control). Histograms represent data from a single experiment, one of three so performed.

 
It has been demonstrated that both CD28 and CTLA-4 bind to very similar sites on B7-1 (29). To analyze the ability of porcine B7-1 to bind to CTLA-4, sB7-1-His was preincubated with human CTLA-4Ig before its addition to Jurkat cells. Human CTLA-4Ig effectively inhibited the binding of sB7-1-His to CD28 on these cells (Fig. 4GoB). By contrast, an isotype-matched irrelevant mAb had no effect on sB7-1-His/CD28 binding. The interaction between porcine B7-1 and human CTLA-4 was also confirmed by ELISA, as plate-coated sB7-1-His bound to CTLA-4Ig in a titratable fashion (data not shown). These data demonstrate that a naturally occurring soluble form of porcine B7-1 has the ability to bind both human CD28 and CTLA-4. Furthermore, the binding of porcine B7-1 to human receptors suggests that this interaction could play a role in T cell activation during pig to human xenotransplantation.

sB7-1 inhibits IL-2 production following costimulation of human Jurkat T cells

To examine whether sB7-1 could interact functionally with human T cells, sB7-1-His was titrated into the Jurkat costimulation assay and its effect on T cell activation was evaluated by detection of IL-2 in the culture supernatants. Jurkat cells do not constitutively elaborate IL-2, even in the presence of PHA, which provides a primary signal through the TCR. However, PHA signaling in the presence of APCs or a stimulatory anti-CD28 mAb results in significant IL-2 production (37).

Jurkat cells were incubated alone or were cocultured with PAEC or Raji cells in the presence or absence of sB7-1-His, an irrelevant histidine-tagged protein or human CTLA-4Ig. As expected, in the absence of PAEC or Raji cells, Jurkat cells did not generate detectable IL-2 under any of the culture conditions tested (data not shown). By contrast, Jurkat cells generated high levels of IL-2 when stimulated with PHA in the presence of either PAEC (Fig. 5GoA) or Raji cells (Fig. 5GoB). Addition of sB7-1-His inhibited the production of IL-2 in a dose-dependent manner, with maximal inhibition equivalent to that observed by the addition of human CTLA-4Ig. Inhibition of IL-2 production was virtually complete at high doses of sB7-1-His, regardless of the source of APCs (porcine or human) used to provide the secondary signal. Addition of recombinant porcine P-selectin-His did not significantly influence IL-2 production in these assays. Nonspecific toxicity of the sB7-1-His preparation due to excipient effects was excluded by evaluating similar volumes of dialysis buffer, collected during the final dialysis of the protein (data not shown). Since Jurkat cells do not express CTLA-4, these data suggest that sB7-1-His inhibits IL-2 production by binding to CD28 and blocking signaling through this molecule.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 5. Soluble B7-1 blocks IL-2 production following costimulation of human T cells. Cells of the Jurkat line were incubated with PHA and either PAEC (A) or Raji cells (B) under the following costimulatory conditions: PAEC or Raji cells alone (•), or with the indicated concentrations of CTLA-4Ig ({square}), P-selectin-His ({triangleup}), or sB7-1-His ({circ}). The cell cultures were maintained at 37°C for 24 h, at which time the supernatants were harvested and assayed by indirect sandwich ELISA to determine the concentration of hIL-2, as described in Materials and Methods. Results are expressed as the mean of duplicate ELISA determinations, converted to pg/ml IL-2 using Microplate Manager software.

 
sB7-1 inhibits human allogeneic and xenogeneic MLRs

To determine the potential effect of sB7-1-His on T cell activation under conditions in which both CD28 and CTLA-4 molecules were present, MLRs were performed. Short-term primary human allogeneic and xenogeneic MLRs were established by coculturing human PBL with mitomycin C-treated human (Fig. 6GoA) or porcine (Fig. 6GoB) PBL, respectively. MLRs were performed in the presence of increasing amounts of sB7-1-His, an irrelevant histidine-tagged protein, or CTLA-4Ig, and responder cell proliferation was assessed on day 4–5 of culture. The addition of sB7-1-His effectively inhibited human T cell proliferation in a dose-dependent fashion in response to both allogeneic and xenogeneic stimulator cells (Fig. 6Go, A and B, respectively). Addition of human CTLA-4Ig at concentrations of 100 µg/ml also effectively inhibited cell proliferation in both assays, while addition of porcine P-selectin-His at 100 µg/ml had no effect. These results indicate that binding of porcine sB7-1-His to CD28 and/or CTLA-4 ligands on human T cells inhibits their activation by allogeneic or xenogeneic stimulation in a concentration-dependent manner.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 6. Soluble B7-1 inhibits lymphocyte proliferation in an allogeneic and xenogeneic MLR. Porcine PBL were stimulated with PMA/ionomycin for 48–72 h, then treated with mitomycin C before their use as stimulator cells in MLRs, as described in Materials and Methods. Human PBL were isolated and seeded at 5 x 105 cells/well in triplicate wells of 96-well plates in the presence or absence of 5 x 105 similarly prepared and mitomycin C-treated human allogeneic stimulator cells (A) or porcine PBL (B). Cells were maintained at 37°C for 4–5 days, with [3H]thymidine added to the cell cultures during the last 16–18 h of incubation. Cells were harvested onto glass fiber filters and assayed for the incorporation of [3H]thymidine, as described in Materials and Methods. Human PBL proliferation in response to stimulator cells was evaluated in the absence ({circ}) or presence of the indicated amounts of sB7-1-His (•), CTLA-4Ig ({blacksquare}), or P-selectin-His ({square}). Proliferation of human responder cells alone ({diamond}) or human or porcine stimulator cells alone ({triangleup}) is indicated. Results are expressed as the mean cpm of triplicate wells.

 
sB7-1 exists as both a monomer and dimer

The generation of sB7-1 through alternative splicing creates a cysteine residue before a translational termination signal (Fig. 1Go). Although this cysteine residue is included in the recombinantly produced protein, the addition of a histidine tag on the carboxyl terminus of sB7-1 could affect potential disulfide bond formation, and thus dimerization of the molecule. To investigate the ability of the native molecule to dimerize, sB7-1 was transiently expressed in 293 cells and compared with sB7-1-His under reducing and nonreducing gel electrophoresis, followed by Western blot analysis. Under reducing conditions, both proteins migrated as a doublet at approximately 40 kDa, with the histidine-tagged version of the protein running just above the untagged version, most likely due to the hexapeptide tag (Fig. 7GoB, lanes 2 and 3, respectively). Conversely, while sB7-1-His ran identically under nonreducing conditions, the untagged version of sB7-1 showed an additional major species at approximately 80 kDa, presumably due to dimerization of the molecule through cysteine bonding (Fig. 7GoC, lanes 2 and 3, respectively). As expected, Ab reactive against the histidine tag recognized sB7-1-His, but not the untagged version of the protein (Fig. 7GoA, lanes 2 and 3, respectively). No reactivity was observed in samples prepared from 293 cells transfected with vector alone (Fig. 7Go, all panels, lane 1). These results suggest that native sB7-1 may exist as both a monomer and dimer. Furthermore, preliminary studies with sB7-1 preparations containing primarily homodimer indicate that this multimer also functions to block T cell activation in an MLR (data not shown).



View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 7. Multimericity of native and histidine-tagged forms of sB7-1. sB7-1-His and an untagged version of sB7-1 were transiently expressed in 293 cells, subjected to SDS-PAGE under reducing (A and B) or nonreducing (C) conditions, and transferred to nitrocellulose for Western blot analysis. Reactivity of cell supernatant proteins from 293 cells transfected with vector alone (lane 1), sB7-1-His cDNA (lane 2), or cDNA from an untagged version of sB7-1 (lane 3) is shown. Membranes were reacted with either rabbit anti-histidine polyclonal IgG (A) or purified anti-porcine B7-1 polyclonal IgG (B and C). Protein size in kDa is depicted on the right of the figure.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The physiological significance of soluble forms of otherwise transmembrane-linked proteins is not known. However, the levels of soluble adhesion molecules and cytokine receptors, whether products of alternative splicing or enzymatic cleavage, increase during inflammation, infection, or malignancies, and the majority of these soluble molecules maintain the ability to bind their ligands (38). Furthermore, an anti-inflammatory role for soluble P-selectin has been suggested by evidence that it can inhibit both CD18-dependent neutrophil adhesion to endothelium and neutrophil superoxide release (39, 40). Potential immune modulation by a soluble cytokine receptor has also been suggested by the observation that mutations in the extracellular domain of the 55-kDa TNFR-1 in individuals with autoinflammatory syndrome result in a decrease in the shedding of the functionally antagonistic soluble form of the receptor (41).

The naturally occurring soluble form of B7-1 described in the present study represents a potential regulatory component of the immune system that heretofore has not been described. A histidine-tagged version of sB7-1 effectively bound CD28 and CTLA-4 molecules and blocked T cell activation in both allogeneic and xenogeneic MLRs. B7-1 has previously been expressed as a recombinant soluble molecule by replacing the transmembrane and cytoplasmic domains with the Fc region of an Ab or with an oligo-histidine tag (2, 42, 43). These recombinant soluble B7-1 molecules (rsB7-1) also maintain their ability to bind both CD28 and CTLA-4 (2, 42, 43, 44). In addition, plate-immobilized rsB7-1 effectively stimulates T cells in conjunction with a primary signal (anti-CD3 mAb) (2, 43). The ability of these recombinant molecules to block T cell activation was not tested.

Inhibition of T cell activation by sB7-1-His most likely occurs through the inhibition of CD28 binding to B7-1 and/or B7-2 on the APCs. Since it has been shown that Ag presentation in the absence of costimulation through CD28 results in T cell anergy (5, 6), it is interesting to speculate that endogenous sB7-1 may exert this same effect in vivo by blocking the binding of CD28 to its ligands. Blockade of CD28 interactions with the B7 proteins may also reduce the production of Bcl-xL, a molecule important in preventing apoptosis, as engagement of CD28 has been shown to promote the production of this survival factor (45).

In the present study, the inclusion of a carboxyl-terminal histidine hexapeptide prevented B7-1 disulfide-linked dimer formation, as an untagged version of the molecule migrated primarily as a dimer under nonreducing electrophoretic conditions, while the histidine-tagged version ran entirely as a monomer. Apparently, the highly charged histidine tag restricts disulfide bond formation between cysteine residues found at the carboxyl end of the molecule. This finding raises the question of whether sB7-1-His may be functionally different from the untagged version of the molecule. Our preliminary studies with sB7-1 preparations containing primarily homodimer indicate that the homodimer also blocks T cell activation in an MLR (data not shown). In addition, the recent resolution of the crystal structure of human rsB7-1 indicates that this molecule undergoes a rapid monomer-dimer exchange that favors nondisulfide-bonded homodimer formation (46). These data suggest the possibility that sB7-1-His utilized in the present study may also exist as a homodimer.

The ability of sB7-1 to form a stable homodimer may have other important functional consequences. Based on crystal structure data, it has been predicted that the increase in avidity between B7-1 and CTLA-4 homodimers may serve to stabilize the B7-1/CTLA-4 signaling complex, which would facilitate the termination of T cell activation (46). It is interesting to speculate that cysteine bond formation between sB7-1 molecules would further favor the generation of stable homodimers. However, it is not known whether a sB7-1 homodimer would activally signal through CTLA-4 or alternatively, block CTLA-4 signaling by competing with B7-1 on the surface of the APC. Definitive studies addressing the physiologic function(s) of sB7-1 are currently underway.

Alternative splicing of a heteronuclear transcript can result in the generation of a soluble molecule from an otherwise membrane-linked protein. This generally occurs by removal of an exon coding for the transmembrane domain by use of an alternative downstream splice site. Examples of soluble proteins that are generated through this mechanism include LFA-3, P-selectin, and many of the cytokine receptors (38, 47). Alternatively spliced products have also been described for both B7-1 and B7-2 (13, 14), but to our knowledge, this is the first report of an abundant endogenous mRNA that lacks the transmembrane and cytoplasmic domains and encodes a functional, soluble B7 protein.

Evidence that sB7-1 reported in the present study is indeed an alternatively spliced product and not an incompletely processed mRNA with the stop codon generated from unspliced intron sequence includes the following: 1) the 1.2-kb full-length cDNA for sB7-1 corresponds in size to one of two species identified by Northern blot analysis of RNA derived from porcine macrophages, and a probe generated from sequence specific to sB7-1 (3' UTR sequence) recognized this transcript; 2) a known processing/polyadenylation signal is found at the end of the 3' UTR sequence of sB7-1; 3) the sB7-1 message is well represented in the porcine macrophage cDNA library; and 4) there is an absence of a splice donor site at the point that the sB7-1 cDNA sequence diverges from that of tmB7-1. In addition, using PCR analysis of porcine genomic DNA, we demonstrated that the end of the sB7-1 coding region is not juxtaposed to the downstream untranslated region, providing further support that this sequence is not unspliced intron (data not shown).

A tmB7-1-specific probe recognized a mRNA species of approximately 3 kb by Northern blot analysis, which corresponds to that reported previously for stimulated porcine lymph node cells (11). However, this study did not demonstrate the presence of the sB7-1 transcript in lymph node cell RNA, which may indicate its absence or low level of expression in this tissue source. Differential expression of alternatively spliced B7 products in various cell types and in response to different stimuli has been previously reported (13, 48).

Although mRNA for sB7-1 was not as abundant as the tmB7-1 transcript (3-fold less), it was well represented in the alveolar macrophage library. The complete absence of tmB7-1 cDNAs allowed the total number of clones representing sB7-1 to be determined. Of a total of approximately 3 x 106 plated phage, approximately 30 sB7-1 clones were isolated (1 clone per 1 x 105 phage). This frequency is indicative of a low-abundance mRNA (mRNAs occurring at less than 14 copies per cell) with an average occurrence in an oligo(dT) reverse-transcribed library (49).

Recently, a soluble form of hB7-1 has been identified in the synovial fluid of arthritic patients (12). It is not known whether this soluble molecule is also encoded by an alternatively spliced message or rather, represents a result of enzymatic cleavage from the cell surface. Northern blot analysis has identified at least four different hB7-1 transcripts that may represent alternatively spliced molecules (4). Using RT-PCR, we have also cloned a putative alternatively spliced form of hB7-1 that encodes a protein lacking the transmembrane and cytoplasmic domains (data not shown). However, this species was not detectable by Northern blot analysis, suggesting either that it was not present in the source of RNA analyzed or it represented a rare transcript. The relevance of this alternatively spliced human soluble B7-1 is currently under investigation.

Based on anatomical and physiological considerations, the pig is considered the most likely candidate as a xenogeneic organ donor for human transplants. However, cellular mechanisms of rejection of pig organs mediated by recognition of porcine adhesion and/or costimulatory molecules are likely to represent at least one major barrier to the success of such transplants (50). For example, porcine E-selectin, VCAM, and B7-2 have all been shown to interact with the human homologues of their receptors and to mediate human leukocyte adhesion or T cell costimulation (20, 26, 35). In the present study, we show that porcine B7-1 is recognized by the human receptors CD28 and CTLA-4 and that it can also serve as a ligand for human T cell costimulation by porcine APCs. These data suggest that porcine B7-1 may represent a good candidate for blockade or targeted gene knockout in the xenotransplantation setting. However, the functional redundancy described for B7-1 and B7-2 suggests that blockade of B7-1 alone may not be sufficient to adequately inhibit T cell activation. Indeed, the combination of functionally blocking anti-murine B7-1 and B7-2 mAbs is required to effectively inhibit primary MLRs and allogeneic transplant rejection, while inhibition with anti-B7-1 mAbs alone does not (24, 51, 52). Thus, we are currently investigating the effectiveness of functionally blocking mAbs to porcine B7-1 and B7-2 either independently or in combination during xenotransplantation.


    Acknowledgments
 
We thank Aaron Bourret for technical assistance, and Dr. Scott Rollins for helpful discussions.


    Footnotes
 
1 This work was supported in part by a National Institutes of Standards and Technology-Advanced Technology Program grant to W.L.F. Back

2 Current address: Immunology, Cancer and Infectious Disease, Central Research Division, Pfizer Inc., Eastern Point Road, Groton, CT 06340. Back

3 Address correspondence and reprint requests to Dr. Russell P. Rother, Alexion Pharmaceuticals, Molecular Development, 25 Science Park, Box 15, New Haven, CT 06511. Back

4 Abbreviations used in this paper: sB7-1, soluble B7-1; hB7-1, human B7-1; PAEC, porcine aortic endothelial cell; tmB7-1, transmembrane B7-1; UTR, untranslated region. Back

Received for publication September 20, 1999. Accepted for publication March 28, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mueller, D. L., M. K. Jenkins, R. H. Schwartz. 1989. Clonal expansion versus functional inactivation: a costimulatory signaling pathway determines the outcome of T cell antigen receptor occupancy. Annu. Rev. Immunol. 7:445.[Medline]
  2. Linsley, P. S., W. Brady, L. Grosmaire, A. Aruffo, N. K. Damle, J. A. Ledbetter. 1991. Binding of the B cell activation antigen B7 to CD28 costimulates T cell proliferation and interleukin 2 mRNA accumulation. J. Exp. Med. 173:721.[Abstract/Free Full Text]
  3. Freeman, G. J., J. G. Gribben, V. A. Boussiotis, J. W. Ng, V. A. Restivo, L. A. Lombard, G. S. Gray, L. M. Nadler. 1993. Cloning of B7-2: a CTLA-4 counter-receptor that costimulates human T cell proliferation. Science 262:909.[Abstract/Free Full Text]
  4. Freeman, G. J., A. S. Freedman, J. M. Segil, G. Lee, J. F. Whitman, L. M. Nadler. 1989. B7, a new member of the Ig superfamily with unique expression on activated and neoplastic B cells. J. Immunol. 143:2714.[Abstract]
  5. Harding, F. A., J. G. McArthur, J. A. Gross, D. H. Raulet, J. P. Allison. 1992. CD28-mediated signaling co-stimulates murine T cells and prevents induction of anergy in T cell clones. Nature 356:607.[Medline]
  6. Gimmi, C. D., G. J. Freeman, J. G. Gribben, G. S. Gray, L. M. Nadler. 1993. Human T-cell clonal anergy is induced by antigen presentation in the absence of B7 costimulation. Proc. Natl. Acad. Sci. USA 90:6586.[Abstract/Free Full Text]
  7. Kearney, E. R., T. L. Walunas, R. W. Karr, P. A. Morton, D. Y. Loh, J. A. Bluestone, M. K. Jenkins. 1995. Antigen-dependent clonal expansion of a trace population of antigen-specific CD4+ T cells in vivo is dependent on CD28 costimulation and inhibited by CTLA-4. J. Immunol. 155:1032.[Abstract]
  8. Krummel, M. F., J. P. Allison. 1995. CD28 and CTLA-4 have opposing effects on the response of T cells to stimulation. J. Exp. Med. 182:459.[Abstract/Free Full Text]
  9. Walunas, T. L., D. J. Lenschow, C. Y. Bakker, P. S. Linsley, G. J. Freeman, J. M. Green, C. B. Thompson, J. A. Bluestone. 1994. CTLA-4 can function as a negative regulator of T cell activation. Immunity 1:405.[Medline]
  10. Tivol, E. A., F. Borriello, A. N. Schweitzer, W. P. Lynch, J. A. Bluestone, A. H. Sharpe. 1995. Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan tissue destruction, revealing a critical negative regulatory role of CTLA-4. Immunity 3:541.[Medline]
  11. Davis, T. A., N. Craighead, A. J. Williams, A. Scadron, C. H. June, K. P. Lee. 1996. Primary porcine endothelial cells express membrane-bound B7-2 (CD86) and a soluble factor that co-stimulate cyclosporin A-resistant and CD28-dependent human T cell proliferation. Int. Immunol. 8:1099.[Abstract/Free Full Text]
  12. McHugh, R. S., W. D. Ratnoff, R. Gilmartin, K. W. Sell, P. Selvaraj. 1998. Detection of a soluble form of B7-1 (CD80) in synovial fluid from patients with arthritis using monoclonal antibodies against distinct epitopes of human B7-1. Clin. Immunol. Immunopathol. 87:50.[Medline]
  13. Borriello, F., J. Oliveros, G. J. Freeman, L. M. Nadler, A. H. Sharpe. 1995. Differential expression of alternate mB7-2 transcripts. J. Immunol. 155:5490.[Abstract]
  14. Inobe, M., P. S. Linsley, J. A. Ledbetter, Y. Nagai, M. Tamakoshi, T. Uede. 1994. Identification of an alternatively spliced form of the murine homologue of B7. Biochem. Biophys. Res. Commun. 200:443.[Medline]
  15. Selvakumar, A., B. K. Mohanraj, R. L. Eddy, T. B. Shows, P. C. White, B. Dupont. 1992. Genomic organization and chromosomal location of the human gene encoding the B-lymphocyte activation antigen B7. Immunogenetics 36:175.[Medline]
  16. Selvakumar, A., P. C. White, B. Dupont. 1993. Genomic organization of the mouse B-lymphocyte activation antigen B7. Immunogenetics 38:292.[Medline]
  17. Borriello, F., G. J. Freeman, S. Edelhoff, C. M. Disteche, L. M. Nadler, A. H. Sharpe. 1994. Characterization of the murine B7-1 genomic locus reveals an additional exon encoding an alternative cytoplasmic domain and a chromosomal location of chromosome 16, band B5. J. Immunol. 153:5038.[Abstract]
  18. Chomczynski, P., N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  19. Evans, M. J., S. L. Hartman, D. W. Wolff, S. A. Rollins, S. P. Squinto. 1995. Rapid expression of an anti-human C5 chimeric Fab utilizing a vector that replicates in COS and 293 cells. J. Immunol. Methods 184:123.[Medline]
  20. Mueller, J. P., M. J. Evans, R. Cofiell, R. P. Rother, L. A. Matis, E. A. Elliot. 1995. Porcine vascular cell adhesion molecule (VCAM) mediates endothelial cell adhesion to human T cells. Transplantation 60:1299.[Medline]
  21. Murray, A. G., M. M. Khodadoust, J. S. Pober, A. L. M. Bothwell. 1994. Porcine aortic endothelial cells activate human T cells: direct presentation of MHC antigens and costimulation by ligands for human CD2 and CD28. Immunity 1:57.[Medline]
  22. Rollins, S. A., S. P. Kennedy, A. J. Chodera, E. A. Elliott, G. B. Zavoico, L. A. Matis. 1994. Evidence that activation of human T cells by porcine endothelium involves direct recognition of porcine SLA and costimulation by porcine ligands for LFA-1 and CD2. Transplantation 57:1709.[Medline]
  23. Turka, L. A., P. S. Linsley, H. Lin, W. Brady, J. M. Leiden, R.-Q. Wei, M. L. Gibson, X.-G. Zheng, S. Myrdal, D. Gordon, et al 1992. T-cell activation by the CD28 ligand B7 is required for cardiac allograft rejection in vivo. Proc. Natl. Acad. Sci. USA 89:11102.[Abstract/Free Full Text]
  24. Lenschow, D. J., Y. Zeng, K. S. Hathcock, L. A. Zuckerman, G. J. Freeman, J. R. Thistlethwaite, G. S. Gray, R. J. Hodes, J. A. Bluestone. 1995. Inhibition of transplant rejection following treatment with anti-B7-2 and anti-B7-1 antibodies. Transplantation 60:1171.[Medline]
  25. Lenschow, D. J., Y. Zeng, J. R. Thistlethwaite, A. Montag, W. Brady, M. L. Gibson, P. S. Linsley, J. A. Bluestone. 1992. Long-term survival of xenogeneic pancreatic islet grafts induced by CTLA-4Ig. Science 257:789.[Abstract/Free Full Text]
  26. Maher, S. E., K. Karmann, W. Min, C. C. W. Hughes, J. S. Pober, A. L. M. Bothwell. 1996. Porcine endothelial CD86 is a major costimulator of xenogeneic human T cells. J. Immunol. 157:3838.[Abstract]
  27. Freeman, G. J., G. S. Gray, C. D. Gimmi, D. B. Lombard, L. J. Zhou, M. White, J. D. Fingeroth, J. G. Gribben, L. M. Nadler. 1991. Structure, expression, and T-cell costimulatory activity of murine homologue of human B lymphocyte activation antigen B7. J. Exp. Med. 174:625.[Abstract/Free Full Text]
  28. Judge, T. A., M. Liu, P. J. Christensen, J. J. Jak, L. A. Turka. 1995. Cloning the rat homolog of the CD28/CTLA-4-ligand B7-1: structural and functional analysis. Int. Immunol. 7:171.[Abstract/Free Full Text]
  29. Guo, Y., Y. Wu, M. Zhao, X.-P. Kong, Y. Liu. 1995. Mutational analysis and an alternatively spliced product of B7 defines its CD28/CTLA-4-binding site on immunoglobulin C-like domain. J. Exp. Med. 181:1345.[Abstract/Free Full Text]
  30. Ellis, J. H., M. N. Burden, D. V. Vinogradov, C. Linge, J. S. Crowe. 1996. Interactions of CD80 and CD86 with CD28 and CTLA4. J. Immunol. 56:2700.
  31. Fargeas, C. A., A. Truneh, M. Reddy, M. Hurle, R. Sweet, R.-P. Sekaly. 1995. Identification of residues in the V domain of CD80 (B7-1) implicated in functional interactions with CD28 and CTLA4. J. Exp. Med. 182:667.[Abstract/Free Full Text]
  32. Peach, R. J., J. Bajorath, J. Naemura, G. Leytze, A. Aruffo, P. S. Linsley. 1995. Both extracellular immunoglobulin-like domains of CD80 contain residues critical for binding T cell surface receptors CTLA-4 and CD28. J. Biol. Chem. 270:21181.[Abstract/Free Full Text]
  33. Guo, Y., Y. Wu, X. Kong, M. Liu. 1998. Identification of conserved amino acids in murine B7-1 IgV domain critical for CTLA4/CD28:B7 interaction by site-directed mutagenesis: a novel structural model of the binding site. Mol. Immunol. 35:215.[Medline]
  34. Lenschow, D. J., T. L. Walunas, J. A. Bluestone. 1996. CD28/B7 system of T cell costimulation. Clin. Immunol. Immunopathol. 14:233.
  35. Rollins, S. A., M. J. Evans, K. K. Johnson, E. A. Elliot, S. P. Squinto, L. A. Matis, R. P. Rother. 1994. Molecular and functional analysis of porcine E-selectin reveals a potential role in xenograft rejection. Biochem. Biophys. Res. Commun. 204:763.[Medline]
  36. Freeman, G. J., D. B. Lombard, C. D. Gimmi, S. A. Brod, K. Lee, J. C. Laning, D. A. Hafler, M. E. Dorf, G. S. Gray, H. Reiser, et al 1992. CTLA-4 and CD28 mRNA are coexpressed in most T cells after activation: expression of CTLA-4 and CD28 mRNA does not correlate with the pattern of lymphokine production. J. Immunol. 149:3795.[Abstract]
  37. Williams, T. M., D. M. Moolten, H. Makni, H. W. Kim, J. A. Kant, M. Kamoun. 1992. CD28-stimulated IL-2 gene expression in Jurkat T cells occurs in part transcriptionally and is cyclosporine-A sensitive. J. Exp. Med. 148:2609.
  38. Meager, A., C. Bird, A. Mire-Sluis. 1996. Assays for measuring soluble cellular adhesion molecules and soluble cytokine receptors. J. Immunol. Methods 191:97.[Medline]
  39. Gamble, J. R., M. P. Skinner, M. C. Berndt, M. A. Vadas. 1990. Prevention of activated neutrophil adhesion to endothelium by soluble adhesion protein GMP-140. Science 249:414.[Abstract/Free Full Text]
  40. Wong, C. S., J. R. Gamble, M. P. Skinner, C. M. Lucas, M. C. Berndt, M. A. Vadas. 1991. Adhesion protein GMP-140 inhibits superoxide release by human neutrophils. Proc. Natl. Acad. Sci. USA 88:2397.[Abstract/Free Full Text]
  41. McDermott, M. F., I. Aksentijevich, J. Galon, E. M. McDermott, B. W. Ogunkolade, M. Centola, E. Mansfield, M. Gadina, L. Karenko, T. Pettersson, et al 1999. Germline mutations in the extracellular domains of the 55 kDa TNF receptor, TNFR1, define a family of dominantly inherited autoinflammatory syndromes. Cell 97:133.[Medline]
  42. Van der Merwe, P. A., D. L. Bodian, S. Dainke, P. Linsley, S. J. Davis. 1997. CD80 (B7-1) binds both CD28 and CTLA-4 with low affinity and very fast kinetics. J. Exp. Med. 185:393.[Abstract/Free Full Text]
  43. Gerstmayer, B., U. Pessara, W. Wels. 1997. Construction and expression in the yeast Pichia pastoris of functionally active soluble forms of the human costimulatory molecules B7-1 and B7-2 and the B7 counter-receptor CTLA-4. FEBS Lett. 407:63.[Medline]
  44. Linsley, P. S., W. Brady, M. Urnes, L. S. Grosmaire, N. K. Damle, J. A. Ledbetter. 1991. CTLA-4 is a second receptor for the B cell activation antigen B7. J. Exp. Med. 174:561.[Abstract/Free Full Text]
  45. Boise, L. H., A. J. Minn, P. J. Noel, C. H. June, M. A. Accavitti, T. Lindsten, C. B. Thompson. 1995. CD28 costimulation can promote T cell survival by enhancing the expression of Bcl-XL. Immunity 3:87.[Medline]
  46. Ikemizu, S., R. J. C. Gilbert, J. A. Fennelly, A. V. Collins, K. Harlos, E. Y. Jones, D. I. Stuart, S. J. Davis. 2000. Structure and dimerization of a soluble form of B7-1. Immunity 12:51.[Medline]
  47. Yamashita, K., C. R. Parish, H. S. Warren, L. C. Harrison. 1997. A multimeric form of soluble recombinant sheep LFA-3 (CD58) inhibits human T-cell proliferation. Immunology 92:39.[Medline]
  48. Inobe, M., N. Aoki, P. Linsley, J. A. Ledbetter, R. Abe, M. Murakami, T. Uede. 1996. The role of the B7-1a molecule, an alternatively spliced form of murine B7-1 (CD80), on T cell activation. J. Immunol. 157:582.[Abstract]
  49. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Construction and analysis of cDNA libraries. Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, p. 8.1.
  50. Matis, L. A., E. A. Elliott, M. J. Evans, J. P. Mueller, S. A. Rollins, R. P. Rother, M.-C. Shanafelt. 1995. The molecular basis of human anti-porcine cellular interactions. Xeno 3:1.
  51. Lenschow, D. J., G. H.-T. Su, L. A. Zuckerman, N. Nabavi, C. L. Jellis, G. S. Gray, J. Miller, J. A. Bluestone. 1993. Expression and functional significance of an additional ligand for CTLA-4. Proc. Natl. Acad. Sci. USA 90:11054.[Abstract/Free Full Text]
  52. Chen, C., N. Nabavi. 1994. In vitro induction of T cell anergy by blocking B7 and early T cell costimulatory molecule ETC-1/B7-2. Immunity 1:147.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
Y.-A. Zhang, J.-i. Hikima, J. Li, S. E. LaPatra, Y.-P. Luo, and J. O. Sunyer
Conservation of Structural and Functional Features in a Primordial CD80/86 Molecule from Rainbow Trout (Oncorhynchus mykiss), a Primitive Teleost Fish
J. Immunol., July 1, 2009; 183(1): 83 - 96.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. Homann, W. Dummer, T. Wolfe, E. Rodrigo, A. N. Theofilopoulos, M. B. A. Oldstone, and M. G. von Herrath
Lack of Intrinsic CTLA-4 Expression Has Minimal Effect on Regulation of Antiviral T-Cell Immunity
J. Virol., January 1, 2006; 80(1): 270 - 280.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I.-H. Choi, G. Zhu, G. L. Sica, S. E. Strome, J. C. Cheville, J. S. Lau, Y. Zhu, D. B. Flies, K. Tamada, and L. Chen
Genomic Organization and Expression Analysis of B7-H4, an Immune Inhibitory Molecule of the B7 Family
J. Immunol., November 1, 2003; 171(9): 4650 - 4654.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S.-C. Wong, E. Oh, C.-H. Ng, and K.-P. Lam
Impaired germinal center formation and recall T-cell-dependent immune responses in mice lacking the costimulatory ligand B7-H2
Blood, August 15, 2003; 102(4): 1381 - 1388.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
N. Lahat, M. A. Rahat, M. Ballan, L. Weiss-Cerem, M. Engelmayer, and H. Bitterman
Hypoxia reduces CD80 expression on monocytes but enhances their LPS-stimulated TNF-{alpha} secretion
J. Leukoc. Biol., August 1, 2003; 74(2): 197 - 205.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
V. Douin-Echinard, J.-M. Peron, V. Lauwers-Cances, G. Favre, and B. Couderc
Involvement of CD70 and CD80 intracytoplasmic domains in the co-stimulatory signal required to provide an antitumor immune response
Int. Immunol., March 1, 2003; 15(3): 359 - 372.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Costa, D. F. Barber, and W. L. Fodor
Human NK Cell-Mediated Cytotoxicity Triggered by CD86 and Gal{alpha}1,3-Gal Is Inhibited in Genetically Modified Porcine Cells
J. Immunol., April 15, 2002; 168(8): 3808 - 3816.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Ling, P. W. Wu, J. S. Miyashiro, S. Marusic, H. F. Finnerty, and M. Collins
Differential Expression of Inducible Costimulator-Ligand Splice Variants: Lymphoid Regulation of Mouse GL50-B and Human GL50 Molecules
J. Immunol., June 15, 2001; 166(12): 7300 - 7308.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. K. Kapsogeorgou, H. M. Moutsopoulos, and M. N. Manoussakis
Functional Expression of a Costimulatory B7.2 (CD86) Protein on Human Salivary Gland Epithelial Cells that Interacts with the CD28 Receptor, but Has Reduced Binding to CTLA4
J. Immunol., March 1, 2001; 166(5): 3107 - 3113.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Faas, S. J.
Right arrow Articles by Rother, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Faas, S. J.
Right arrow Articles by Rother, R. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS