| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Chemoattractant) Is an IFN-
- and Lipopolysaccharide- Inducible Glucocorticoid-Attenuated Response Gene Expressed in Lung and Other Tissues During Endotoxemia1
,
,,§
Departments of
*
Pediatrics,
Microbiology, Immunology, and Molecular Genetics, and
Medicine, and
§
Molecular Biology Institute, University of California, Los Angeles, School of Medicine, Los Angeles, CA 90095
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
chemoattractant (I-TAC) (alias ß-R1, H174, IFN-inducible protein
9 (IP-9), and SCYB9B). The murine chemokine has six additional residues
at the carboxyl terminus not present in human I-TAC. Identification of
this cDNA as murine CXCL11/I-TAC is supported by phylogenetic analysis
and by radiation hybrid mapping of murine I-TAC (gene symbol
Scyb11) to mouse chromosome 5 close to the genes for
monokine induced by IFN-
(MIG) and IP10. Murine I-TAC mRNA is
induced in RAW 264.7 macrophages by IFN- or LPS and is weakly
induced by IFN-ß. IFN- induction of murine I-TAC is markedly
enhanced by costimulation with LPS or IL-1ß in RAW cells and by
TNF- in both RAW cells and Swiss 3T3 fibroblasts. Murine I-TAC is
induced in multiple tissues during endoxemia, with strongest expression
in lung, heart, small intestine, and kidney, a pattern of tissue
expression different from those of MIG and IP10. Peak expression of
I-TAC message is delayed compared with IP10, both in lung after i.v.
LPS and in RAW 264.7 cells treated with LPS or with IFN-.
Pretreatment with dexamethasone strongly attenuates both
IFN--induced I-TAC expression in RAW cells and endotoxemia-induced
I-TAC expression in lung and small intestine. The structural and
regulatory similarities of murine and human I-TAC suggest that mouse
models will be useful for investigating the role of this chemokine in
human biology and disease. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, -ß, and -; epithelial cell-derived
neutrophil-activating peptide-78; and granulocyte chemotactic
protein-2) are potent neutrophil chemoattractants. These chemokines all
contain a glutamic acid-leucine-arginine (ELR) motif immediately
preceding the first conserved cysteine and are referred to as
ELR+ CXC chemokines. Seven other CXC chemokines
(platelet factor 4, B lymphocyte chemoattractant/B cell-attracting
chemokine 1, stromal cell-derived factor 1, BRAK, IFN-inducible protein
10 (IP10), monokine induced by -IFN (MIG), and IFN-inducible T cell
chemoattractant (I-TAC; human CXCL11)) lack the ELR motif and
are inactive toward neutrophils (7, 8). Three human chemokines (I-TAC, MIG, and IP10) constitute a structurally and functionally related subset of genes within the non-ELR CXC chemokine subgroup. Although human I-TAC (alias ß-R1, H174, IP-9, or SCYB9B) was identified only recently (9, 10, 11, 12, 13, 14), human and murine IP10 and MIG were among the first chemokines to be discovered (15, 16, 17, 18). Both IP10 and MIG are chemotactic for activated but not resting T cells (19), and both are ligands for the chemokine receptor CXC chemokine receptor 3 (CXCR3) (20). CXCR3 is mainly expressed on activated Th1 cells and NK cells and therefore may play a critical role in selectively recruiting these cells to inflammatory sites (21, 22, 23, 24, 25, 26). Subsequent down-regulation of CXCR3 may also be important in allowing these cells to recirculate to lymph nodes (27). CXCR3 is expressed on infiltrating lymphocytes in active multiple sclerosis lesions (28, 29) and on the T lymphocytes within human atherosclerotic lesions (30). Although not present on normal B cells, CXCR3 is also expressed on malignant B cells in chronic lymphocytic leukemia and some other lymphoproliferative disorders (31). The expression characteristics of CXCR3 suggest that this receptor and its ligands could be important targets for therapeutic blockade in a variety of diseases.
The human I-TAC cDNA was identified by large-scale sequencing of clones
from stimulated human astrocytes, and its predicted product was shown
to be a potent chemoattractant for IL-2-stimulated T cells, acting via
CXCR3 (11). A partial cDNA (ß-R1), not initially
recognized as a chemokine, had previously been isolated as an
IFN--induced gene in astrocytes (9). The H174 cDNA was
obtained by a genetic selection for secreted proteins
(10), whereas the SCYB9B cDNA was discovered
serendipitously as part of a chimeric sequence (12, 13).
The native protein (IP-9) was isolated in a search for novel ligands of
CXCR3 secreted by IFN--stimulated keratinocytes (14).
Human I-TAC (gene symbol SCYB11, formerly SCYB9B) maps to chromosome
4q21.2, in close proximity to MIG (SCYB9) and IP10 (SCYB10) (12, 32). The murine orthologues of MIG (MuMig) and IP10 (crg-2, C7)
are ligands for murine CXCR3 (16, 17, 33, 34, 35), and map to
mouse chromosome 5 (36). The murine orthologue of human
I-TAC has not been described previously.
The anti-inflammatory effects of glucocorticoid hormones are
mediated, in part, by their ability to attenuate the induction of
message expression of genes encoding inflammatory mediators, including
numerous cytokines such as TNF-, IL-1, and IL-8 and enzymes such as
the inducible forms of prostaglandin synthase and nitric oxide synthase
(37, 38). We refer to this class of genes as
glucocorticoid-attenuated response genes (GARGs) (39, 40).
We hypothesized that there are many GARGs not yet identified, and in a
previous study we cloned a new murine CXC chemokine, LPS-induced CXC
chemokine (gene symbol Scyb5), by screening a cDNA library
prepared from Swiss 3T3 fibroblasts for LPS-induced,
dexamethasone-attenuated messages (39). We recently
extended GARG screening to an in vivo model designed to identify
endotoxemia-induced, dexamethasone-attenuated genes expressed in the
lungs of adrenalectomized mice. In the course of this project, we
identified a cDNA fragment representing an unknown gene. In this
article we describe cDNAs containing the complete coding sequence of
this gene. Sequence comparisons, phylogenetic analysis, gene mapping,
and regulatory properties support the identification of this gene as
the murine orthologue of human I-TAC.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cycloheximide, dexamethasone, murine IFN-ß, and sterile,
tissue-culture certified LPS prepared by phenol extraction and gel
filtration from Escherichia coli serotype O111:B4 were
obtained from Sigma (St. Louis, MO). Preservative- and pyrogen-free
saline (Abbott Laboratories, North Chicago, IL) was used for dilution
of LPS and for control injections. Dexamethasone sodium phosphate (4
mg/ml of dexamethasone phosphate equivalent) for injection was obtained
from Elkins-Sinn (Cherry Hill, NJ). Recombinant murine IFN- was
obtained from Sigma and from R&D Systems (Minneapolis, MN). Recombinant
murine IL-1ß and TNF- were obtained from R&D Systems.
Mice
Male Swiss Webster mice, purchased from Charles River Laboratories (Cambridge, MA) or from Simonson Laboratories (Gilroy, CA), were studied at 8–12 wk of age. Groups of mice used in individual experiments were obtained from a single supplier. Adrenalectomized mice from Charles River Laboratories were used in library preparation and screening. Adrenalectomized mice were given normal saline instead of water to drink and were studied 2–4 wk after adrenalectomy. Other experiments reported in this paper utilized nonoperated mice, except as noted. Mice were housed in specific pathogen-free conditions in the UCLA Center for the Health Sciences Vivarium. Experiments were conducted in accordance with a protocol approved by the UCLA Animal Research Committee.
LPS (50 µg in 200 µl sterile saline or saline alone) was administered i.v. via the tail vein. In experiments involving dexamethasone, two 400-µg doses (or 100 µl saline) were administered s.c. 16–20 h before and 5 min before LPS injection. At specified intervals after LPS injection, the mice were anesthetized with halothane and were then killed by cervical dislocation. The pulmonary artery was flushed with 3 ml cold PBS before removal of the lung lobes, which were individually dissected free of the surrounding soft tissues.
Cell culture
Cell culture media were from Life Technologies (Rockville, MD),
and FBS was from Omega Scientific (Tarzana, CA). RAW 264.7 cells were
cultured in 5% CO2/air in high-glucose DMEM with
10% FBS and antibiotics. Murine Swiss 3T3 cells were cultured at
37°C in 5% CO2/air in low-glucose DMEM
supplemented with 10% FBS and antibiotics. Near-confluent cultures
were switched to medium containing 0.5% FBS for 18–24 h before
induction with IFN- or other agents.
RNA preparation and Northern analysis
Whole organs or tissue segments of 
250 mg dissected from the
mice were immediately homogenized in 3 ml of RNA extraction buffer and
were frozen at -80°C for subsequent RNA isolation by the acid phenol
method (41). RNA from cultured cells was prepared using
Trizol (Life Technologies). Electrophoresis of total cellular RNA (10
µg/lane), transfer, and hybridization conditions were as described
(39). Autoradiographic exposures were made at -80°C
with one intensifying screen using XAR film (Kodak, Rochester, NY).
Expression of I-TAC, MIG, and IP10 was determined either by sequential
stripping and probing of the same membrane or by probing replicate
filters made from the same RNA. Each filter used was then stripped and
reprobed with a cDNA probe for the murine ribosomal S2 protein to
assess variations in loading. Quantitation was performed using phosphor
imaging (Molecular Dynamics, Sunnyvale, CA). Corrections for variations
in loading were made using the signal intensity of S2.
Library synthesis and screening
A cDNA library was prepared using lung tissue harvested from
adrenalectomized mice 1, 2, or 4 h after tail vein injection of 50
µg LPS. Total cellular RNA extracted from the lungs of individual
mice was checked for absence of degradation by Northern analysis and
then pooled (8–10 mice per time point). Poly(A)-RNA was isolated using
the polyATtract kit (Promega, Madison, WI). cDNA was prepared using the
Superscript II cDNA Synthesis kit (Life Technologies). First-strand
synthesis was primed with oligo-dT. After second-strand synthesis,
ligation of Not-Sal-EcoRI adapters, and size selection, the
cDNA was ligated into the EcoRI site of 
ZapII and
packaged with Gigapack III Gold (Stratagene, La Jolla, CA). The primary
library, containing 1 x 106 recombinants,
was amplified once. The library was screened by hybridization with
probe from the 068D fragment (see Results), and insert sizes
of plaque-purified candidate phage were determined by PCR as described
(40), except that amplification was performed using vector
primers ATTAACCCTCACTAAAGGGA and TAATACGACTCACTATAGGG with an
annealing temperature of 58°C. Selected phages were then converted to
plasmid form (42) and sequenced.
Sequence and phylogenetic analysis
Editing of sequences, assembly into contigs, and open reading frame analysis were performed using AssemblyLign 1.09b and MacVector 6.5 (Oxford Molecular, Oxford, U.K.). Multiple sequence alignment and phylogenetic analysis were performed using Clustal W (43, 44). The unrooted tree diagram was generated from the Clustal W output with Treeview 1.5.3 (45). Analysis of signal cleavage sites was performed using Signal-P (46, 47).
Radiation hybrid mapping
DNA samples from the 100 cell lines of the T31 radiation hybrid
panel, which carries fragments of the mouse genome on a hamster
background (48), were used as templates for PCR
amplification with murine I-TAC primers CCTGGGAACGTCTGACTGTG and
GAAGGTAGCGTGGAGTGTGC. Preliminary experiments showed robust
amplification of the expected 195-bp product (nt 370–564 of Fig. 1
) from the cloned I-TAC cDNA. No
products were obtained when the murine MIG and IP10 cDNAs were used as
templates. Reactions were performed with 112.5 ng of hybrid clone DNA,
0.4 µM of each primer, 250 nM of each dNTP, and 0.625 U of TaKaRa Ex
Taq (Takara Shuzo, Otsu, Japan) and the supplied buffer in a total
volume of 25 µl. After an initial denaturation at 94°C for 3 min,
30 cycles of denaturation at 94°C for 30 s, annealing at 62°C
for 1 min, and extension at 72°C for 1.5 min were performed before a
final extension at 72°C for 7 min. The PCR products were analyzed by
electrophoresis in 1.2% agarose gels, stained with ethidium bromide,
and scored for the presence or absence of the 195-bp product. Two
independent reactions were performed with the I-TAC primers for the
entire T31 panel. Additional reactions were performed to clarify
discordant results for I-TAC and to verify the location of markers
determined to be near the I-TAC (Scyb11) locus genetically.
All data were submitted to The Jackson Laboratory Mouse Radiation
Hybrid Database (http://www.jax.org/resources/documents/
cmdata/).
|
Probes were prepared by random-primed synthesis using
-32P-deoxycytidine 5'-triphosphate from NEN
(Boston, MA). Templates were gel-purified fragments excised from cloned
cDNA. The murine I-TAC probe was a 1.2-kb EcoRI fragment
from clone 068D14. This fragment was used, rather than the full-length
insert, to avoid the repetitive sequences present in the 3' end of the
cDNA (see Fig. 1
). The murine MIG cDNA was a gift from Dr. Joshua M.
Farber (National Institutes of Health, Bethesda, MD) (33).
The IP10 (crg-2/GARG-10), macrophage-inflammatory protein-2 (MIP-2),
and S2 clones we used were described previously (39, 49).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The murine I-TAC cDNA was identified in a search for
glucocorticoid-attenuated response genes induced in the lung during
endotoxemia. A two-stage strategy was used in this search. First, we
prepared a subtracted library enriched in endotoxemia-induced genes and
then screened this library by differential hybridization for genes
whose induction in endotoxemia was attenuated by pretreatment with
dexamethasone (J.B.S., unpublished observations). Briefly, cDNA
subtraction was performed using the suppression subtractive
hybridization method (50, 51). The "tester" cDNA
population was prepared from mRNA isolated from lungs of
adrenalectomized mice 1, 2, and 4 h after i.v. injection of
LPS. The "driver" cDNA population was prepared from lung mRNA
from adrenalectomized mice treated with dexamethasone. The tester cDNA
was digested with RsaI, ligated to suppression subtractive
hybridization adapters 1 and 2, hybridized with
RsaI-digested driver, and reamplified by suppression PCR as
described (50, 51). The result of this procedure was a
population of cDNA fragments highly enriched for endotoxemia-induced
genes (data not shown). A ZapII library prepared from this
subtracted cDNA population was then screened by differential
hybridization to select glucocorticoid-attenuated messages
(40). A candidate cDNA fragment designated 068D contained
a sequence not found in GenBank.
To further characterize the 068D partial sequence, we constructed a
full-length (i.e., not RsaI-digested), unsubtracted cDNA
library using poly(A)+ RNA from lungs of
adrenalectomized, LPS-treated mice as described in Materials and
Methods, and screened this library for clones hybridizing with the
068D insert. Two independent clones containing the identical complete
coding sequence were isolated. Fig. 1 shows the sequence of the longer
clone. The shorter cDNA started at nt 20 and terminated with a 21-nt
poly(A) tail following nt 1032 of the sequence shown. This site follows
overlapping rare polyadenylation signals AATATA and TATAAA at nt
1006–15. The polyadenylation signal AATAAA is present at nt 914–19,
but we did not isolate any clones with a 3' end corresponding to this
site. A recent analysis indicates that the "canonical" AATAAA
signal is actually utilized in only about 25% of mouse messages
(52). With 200–400 nt poly(A) tails, messages terminating
after either the 914–19 or the 1006–15 potential polyadenylation
signals would be compatible with the predominant 1.2- to 1.4-kb band we
observed on Northern blots. A second band with about 5% of the signal
intensity of the major band was consistently seen at 
4.5 kb (not
shown).
Sequence similarities and phylogenetic analysis
The open reading frame of the murine I-TAC cDNA encodes a
predicted 100-amino acid proprotein with an N-terminal signal sequence
and a mature peptide containing four cysteines in the positions
characteristic of the CXC chemokine family (Fig. 1). Analysis of
predicted signal peptide cleavage sites using Signal-P
(46) showed nearly equal probabilities of cleavage between
Ala19 and Gln20 (Y score,
0.578) and between Gly21 and
Phe22 (Y score, 0.573). For the human I-TAC
sequence in contrast, Signal-P unambiguously predicts cleavage between
positions 21 and 22 (Y score, 0.817; the second highest Y score is
0.321 for cleavage between 20 and 21), in agreement with the N-terminal
sequence of the protein isolated from human keratinocyte supernatants
by Tensen et al. (14). If the processing of the murine
I-TAC proprotein is similar to that of human I-TAC and the other
closely related chemokines, cleavage would occur after
Gly21 (Fig. 2). The
resulting 79-aa residue mature murine I-TAC would have a molecular mass
of 9112 Da. If cleavage occurred after Ala19
instead, the mature protein would have 81 residues and a mass of 9297
Da. With either cleavage site the predicted protein is highly basic
(isoelectric point, 10.8).
|
). The
73 aligned residues of the predicted mature peptides are 71% identical
and 93% similar, whereas the signal sequences are 57% identical and
63% similar (Fig. 2). Murine I-TAC has six additional residues at the
carboxyl terminus not present in the human protein. Next to human
I-TAC, the other chemokines most closely related to murine I-TAC are
human and murine IP10 (32–36% identical residues in the aligned
portions) and human and murine MIG (25–29% identical). Thus, the
murine I-TAC protein has much greater similarity to human I-TAC than to
any other chemokine, murine or human. The IP10 and MIG sequences also
form closely related murine/human pairs, whereas the overall similarity
among the six I-TAC, IP10, and MIG sequences is much less than the
similarity within each pair (Fig. 2). A phylogenetic analysis of all
known murine and human CXC chemokines clearly identifies the protein
encoded by the cDNA we cloned as the murine orthologue of human
I-TAC and shows that I-TAC, MIG, and IP10 form a distinct subgroup of
chemokines in which all three genes have highly conserved murine
and human orthologues (Fig. 3).
|
The chromosomal location of murine I-TAC was determined using the
T31 mouse/hamster radiation hybrid panel (48) as described
in Materials and Methods. Based on the mapping and sequence
data, murine I-TAC was assigned the gene symbol Scyb11 by
the International Committee on Standardized Genetic Nomenclature for
Mice (The Jackson Laboratory, Bar Harbor, ME). The radiation hybrid
data place Scyb11 on mouse chromosome 5 between markers D5
Mit20 and D5 Mit369 (Fig. 4). The
logarithm of odds scores were 5.6 between D5 Mit20 and
Scyb11, and 9.9 between D5 Mit369 and Scyb11.
|
). However, by backcross analysis, D5 Mit369 and D5 Mit274 are widely
separated and in the reverse order, mapping to 68 cM and 45 cM,
respectively. In contrast, the physical and genetic mapping orders are
entirely consistent for D5 Mit312, D5 Mit20, D5 Mit89, D5 Mit10 (Fig. 4), and other nearby markers (not shown). Based on these markers, the
physical map position for murine Scyb11 corresponds to a
locus at 52–53 cM on the genetic map, as shown in Fig. 4. Murine IP10
and MIG have previously been mapped to 53 cM by backcross analysis,
whereas murine KC and MIP-2 map to 51 cM (36). This
portion of mouse chromosome 5 is syntenic to human chromosome 4q12–21,
which contains the human CXC chemokine cluster. Human SCYB11 (I-TAC),
IP10, and MIG are located within 30 kb at 4q21.2, separated by 2
Mb from the CXC chemokine minicluster at 4q12 (32). Our
radiation hybrid mapping data for murine I-TAC (Scyb11),
combined with the linkage data for KC, MIP-2, IP10, and MIG
(36), indicate that murine I-TAC, like its human
orthologue, is located in close proximity to the IP10 and MIG
genes. Murine I-TAC is induced in multiple tissues during endotoxemia, with a time course and pattern of tissue expression different from those of MIG and IP10
Our candidate insert for what proved to be I-TAC was cloned
as an LPS-induced, glucocorticoid-attenuated cDNA from lung. To confirm
the inducibility of I-TAC and to assess its expression in other
tissues, we evaluated message expression of I-TAC in tissues from
LPS-treated and control mice, in comparison with MIG and IP10. I-TAC
message was not detected in control tissues but was induced after LPS
injection in all tissues examined (Fig. 5). Induced I-TAC expression was greatest
in lung, heart, small intestine, and kidney. In contrast, MIG was most
strongly induced in heart and liver, whereas IP10 was most strongly
induced in lung, spleen, and kidney. Taking account of the differences
in exposure times for the autoradiograms in Fig. 5, it is apparent that
IP10 message is considerably more abundant than I-TAC and MIG in most
tissues of the LPS-treated mice at this time point. (The probes used
were similar in length (1.1–1.3 kb) and were labeled to similar
specific activities.)
|
).
I-TAC message was first detectable 2 h after LPS and was still
increasing at 8 h. MIG induction was even more delayed. In
contrast to I-TAC and MIG, message expression of IP10 was substantial
at 2 h and peaked at 4 h. Nevertheless, the initial increase
in IP10 expression was delayed compared with the
neutrophil-chemoattractant CXC chemokine MIP-2, whose message
expression was maximal at 1 h. The differing time courses and
patterns of tissue expression of I-TAC, MIG, and IP10 indicate that
these chemokines are individually regulated.
|
To verify that I-TAC is a glucocorticoid-attenuated response gene and to quantitate the magnitude of the attenuation, we examined the effect of dexamethasone on endotoxemia-induced message expression in the lung and small intestine. Dexamethasone (or saline) was given 16–20 h before and 5 min before i.v. injection of LPS, and tissues were harvested 4 h later. Three mice were studied for each condition. Dexamethasone reduced LPS-induced I-TAC message expression by 85% in lung and by 93% in small intestine (not shown). In the same mice, dexamethasone reduced LPS-induced MIG and IP10 expression by 80% or more in both lung and small intestine. Dexamethasone also reduced LPS-induced expression of all three chemokines by 80% or more in lung and small intestine of adrenalectomized mice (not shown). Thus, dexamethasone strongly attenuates induction of I-TAC, MIG, and IP10 in this endotoxemia model in both nonoperated and adrenalectomized mice.
It is interesting to note that clones for IP10 were abundantly
represented among the candidate phages we isolated in our screening for
glucocorticoid-attenuated genes (J.B.S., unpublished observations).
However, we did not isolate any MIG clones, most likely because MIG
expression is so low (Fig. 6) at the 2 h time point utilized in
the screening.
Murine I-TAC expression is induced by IFN- and by LPS in RAW
264.7 macrophages and is attenuated by dexamethasone
In RAW 264.7 macrophages, murine I-TAC was strongly induced by as
little as 10 IU/ml IFN- but was only weakly induced by 1000 IU/ml
IFN-ß (not shown). In agreement with previous work (16, 17, 33), MIG was induced by IFN- but not by IFN-ß, whereas
IP10 was strongly induced by either IFN-ß or IFN- (not shown).
Although I-TAC, MIG, and IP10 were all inducible by IFN- in RAW
264.7 cells, the kinetics of their responses to IFN- were distinctly
different (Fig. 7A). IP10
message was rapidly induced and peaked at 4 h, as described
previously (53). I-TAC message expression did not begin to
rise substantially until after 2 h and peaked 6–8 h after IFN-
(Fig. 7A and data not shown). IFN--induced MIG induction
was even more delayed, with peak message expression at 12 h. For
each gene, message expression at 24 h (not shown) remained close
to the 16-h level. In RAW 264.7 cells, LPS induced the message
expression of I-TAC and IP10 but not of MIG (Figs. 7B and
8A). For both I-TAC and IP10,
the time courses of message expression in response to LPS and to
IFN- were similar (Fig. 7, A and B).
Interestingly, the relative kinetics of the responses to IFN- in RAW
cells (prompt for IP10, intermediate for I-TAC, and delayed for MIG)
were identical with what we observed in the lung during endotoxemia
(Fig. 6). The in vivo response, of course, might be partially due to
the direct effects of LPS and partially due to the effects of
endogenous mediators released in endotoxemia, including TNF-,
IL-1ß, and IFN-.
|
-induced message expression of I-TAC, MIG, and IP10 (Fig. 7C). Expression of each chemokine message was reduced by
80% or more at 4 h, a level of attenuation similar to what we
observed at 4 h in vivo, and by more than 90% at 8
h.
Inhibition of protein synthesis with cycloheximide did not block
IFN- induction of I-TAC message expression in RAW 264.7 cells (Fig. 7D). MIG and IP10 also were induced in the presence of
cycloheximide, as previously observed (16, 33). This
indicates that the induction of these genes by IFN- is not dependent
on synthesis of new transcription factors or other intermediates. Thus,
all three of these chemokines are immediate-early or primary response
genes (54), despite the delayed peak expression of I-TAC
and MIG compared with that of IP10. However, secondary factors could
participate in the continuing rise of I-TAC and MIG message expression
after 4 h.
IFN- induction of murine I-TAC is enhanced by costimulation with
LPS, IL-1ß, or TNF-
In RAW 264.7 cells, message induction of both I-TAC and MIG in
response to IFN- together with LPS was increased more than 8-fold
compared with induction by IFN- or LPS alone (Fig. 8A).
This synergistic effect was particularly striking for MIG, which was
not detectably induced by LPS alone. Strong synergistic effects were
seen for all three genes in response to the combination of IFN- with
IL-1ß, with TNF-, or with IL-1ß plus TNF- (Fig. 8A). In Swiss 3T3 cells, induction of I-TAC, MIG, and IP10
by IFN- was much weaker than in RAW cells, but the combination of
IFN- with TNF- or with IL-1ß plus TNF- strongly induced all
three messages (Fig. 8B). For all three genes, message
induction by TNF- in combination with IFN- was enhanced more than
40-fold compared with induction by TNF- or IFN- alone.
Interestingly, the weak IFN--induced message expression of I-TAC,
MIG, and IP10 in Swiss 3T3 cells was dramatically enhanced by
cycloheximide: the IFN--induced message levels of these genes were
increased 35-fold or more in the presence of cycloheximide but were not
increased by cycloheximide in the absence of IFN- (not shown). The
synergistic effects of the combination of IFN- with LPS, IL-1ß, or
TNF- that we observed for murine I-TAC, MIG, and IP10 (Fig. 8) have
also been reported for the human orthologues of these genes in several
cell types (11, 13, 30, 55, 56, 57). These synergies might be
particularly significant in the early stages of Th1-dependent
processes, when few IFN--secreting T cells have arrived at a local
site of inflammation and local IFN- concentrations are low.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, and each of
these chemokines is a ligand for CXCR3 (11, 14, 20).
Because CXCR3 is predominantly expressed on activated Th1 cells
(21, 22, 23, 24, 25, 26), which are characterized by their ability to
secrete IFN- and IL-2, all three chemokines may contribute to
Th1-type immune responses by recruiting CXCR3-expressing Th1 cells to a
local site of inflammation. The IFN- secreted by these Th1 cells
would stimulate increased local production of IP10, MIG, and I-TAC,
which in turn would recruit additional Th1 cells. This self-amplifying
local paracrine loop could have an important role in the establishment
and maintenance of Th1-type responses (20, 25).
The identification of murine I-TAC allows us to compare the structures
of all three of the human CXCR3 ligands (I-TAC, MIG, and IP10) with
their murine counterparts. The predicted mature murine I-TAC protein
has much greater similarity to human I-TAC (71% identical, 93%
similar residues) than to the most closely related murine chemokines,
MIG and IP10 (29–36% identity). The sequence similarities between
murine and human MIG, and between murine and human IP10, are equally
close (Fig. 2). The phylogenetic analysis (Fig. 3) and the mapping of
murine I-TAC to mouse chromosome 5 near the murine MIG and IP10 genes
(Fig. 4) support the idea that I-TAC, MIG, and IP10 arose by gene
duplication from a common precursor early in mammalian evolution
(32, 58). In addition, the preservation of both high
sequence similarity and distinct regulatory features (discussed below)
within each murine-human pair of homologues suggests that the I-TAC,
IP10, and MIG genes may have developed individually conserved functions
before the divergence of the rodent and primate lineages. In
considering this suggestion, it is useful to note that a clear
one-to-one correspondence between human and murine genes does not exist
for all chemokines. The neutrophil-chemoattractant,
ELR+ subgroup of CXC chemokines provides several
examples (Fig. 3), including 1) the lack of a murine orthologue of
human IL-8, 2) the likely origin of human epithelial cell-derived
neutrophil-activating peptide-78 and granulocyte chemotactic protein-2
from an evolutionarily recent gene duplication of an ancestral gene
orthologous to murine LPS-induced CXC chemokine (LIX) (59, 60), and 3) the lack of identifiable orthologues for any of the
individual human GRO genes, though as a group the GRO genes are closely
related to murine KC and MIP-2 (58). These examples
suggest that there has been ample evolutionary time for correspondences
between murine and human chemokines that originated from common
ancestral genes to have become obscured. Thus, the preservation of high
similarity between human and murine I-TAC, between human and murine
MIG, and between human and murine IP10 (Figs. 2 and 3) supports the
idea that each of these genes may have an evolutionarily conserved
function.
The existence of multiple ligands for a single receptor is a common
theme in the chemokine superfamily (3, 7). Differential
regulation in distinct cells types or tissues is one of several
mechanisms by which chemokines that act on a common receptor could have
functionally distinct properties in vivo (7, 25, 61). Our
studies of the endotoxemia model provide two lines of evidence for
differential regulation of I-TAC, MIG, and IP10 in vivo. First, the
patterns of tissue expression of these genes are different. I-TAC
message, undetectable in control tissues, is most abundantly expressed
during endotoxemia in lung, heart, small intestine, and kidney, a
pattern quite different from those of MIG and IP10 (Fig. 5). In
contrast to I-TAC, endotoxemia-induced MIG expression is greatest in
liver. This is consistent with a previous study showing that liver
expression of MIG is prominent during the acute phase of various viral
and protozoal infections and after IFN- injection (62).
The pattern of IP10 expression in that study varied for different
stimuli (62). In endotoxemia, we found that IP10
expression was prominently induced in lung and kidney and, in direct
contrast to I-TAC, was high in spleen but low in small intestine (Fig. 5). Except for the observation that IP10 is induced in liver and kidney
after LPS injection (63), tissue expression of IP10 and
MIG has not previously been evaluated in endotoxemia, so our study
provides new information for these chemokines as well as for I-TAC.
Second, we found that the time courses of I-TAC, MIG, and IP10
induction are different. Lung expression of I-TAC and MIG in response
to LPS injection is delayed compared with that of IP10. Message
expression of IP10 rises abruptly at 2 h and peaks 4 h after
LPS, whereas I-TAC expression and MIG expression continue to increase
between 4 and 8 h. However, for I-TAC the rate of rise between 4
and 8 h was modest compared with that of MIG, suggesting that the
expression of MIG peaks later than that of I-TAC, which is consistent
with the in vitro kinetics we found for these genes (Fig. 7).
Studies of human tissues have also provided evidence for differential expression of I-TAC, MIG, and IP10. Skin biopsies of allergic contact reactions and mycosis fungoides show consistent topographic expression patterns by in situ hybridization, with I-TAC expressed mainly in the epidermis, MIG mainly in the dermis, and IP10 in both (14). In human carotid atherosclerotic plaques, smooth muscle cells express IP10 and MIG but not I-TAC, whereas endothelial cells and macrophages express all three chemokines (30). Such differences in localization of expression are consistent with the idea that I-TAC, MIG, and IP10 may have nonredundant roles in vivo (19, 30). Experimental models showing a specific requirement for I-TAC or IP10 have not been reported. However, a recent study suggests that T cell infiltration and rejection of class II MHC-disparate allografts in mice may be specifically dependent on intra-allograft production of MIG (64).
To examine further the differential regulation of I-TAC, MIG, and IP10,
we compared their responses to induction by IFN-, IFN-ß, and
LPS in RAW 264.7 macrophage cells. Murine I-TAC, MIG, and IP10 are
all strongly induced by IFN- in these cells (Figs. 7 and 8).
However, the three genes have differing responses to IFN-ß and to
LPS. Murine I-TAC is weakly induced by IFN-ß (not shown) and
modestly induced by LPS (Fig. 8A) relative to IFN-.
Similarly, human I-TAC is weakly induced by IFN- or IFN-ß in THP-1
myelomonocytic cells and strongly induced by IFN- (13).
However, induction of human I-TAC by LPS as a single stimulus was not
observed in THP-1 cells (13). In contrast to I-TAC, we
found that murine IP10 is strongly induced in RAW cells by IFN-ß
and by LPS (as well as by IFN-), whereas MIG is induced only by
IFN- (Figs. 7 and 8), which is in agreement with previous studies of
IP10 and MIG in both murine and human monocyte/macrophage cell lines
(15, 18, 19, 53). Thus, each of the three related
chemokines has a different pattern of responsiveness to stimulation
with IFN-, IFN-ß, and LPS, and with the exception of the I-TAC
response to LPS, the pattern for each chemokine is similar in both
murine and human monocyte/macrophage cell lines.
Although induction of human I-TAC by LPS as a single stimulus was not
observed in THP-1 cells (13), costimulation with LPS
enhances IFN- induction of human I-TAC in these cells
(13). In fact, the combination of IFN- with LPS,
IL-1ß, or TNF- produces synergistic increases in human I-TAC, MIG,
and IP10 induction in a wide variety of cell types (11, 13, 30, 55, 56, 57). We found that costimulation with LPS, IL-1ß, or
TNF- also markedly augments IFN- induction of murine I-TAC in RAW
264.7 macrophages, Swiss 3T3 fibroblasts, or both cell types (Fig. 8).
Murine IP10 and MIG were also synergistically induced, as previously
reported (65, 66, 67). For murine I-TAC, we observed the
greatest synergy in Swiss 3T3 cells, in which the combination of
TNF- with IFN- induced more than 50-fold greater expression than
either agent alone (Fig. 8B and data not shown).
Glucocorticoids are widely used in the treatment of inflammatory
diseases. Among other mechanisms, inhibition of the expression of
proinflammatory cytokines is thought to be an important component of
the anti-inflammatory effects of glucocorticoids (37, 38, 68, 69). For human I-TAC, glucocorticoid effects on induction so far
have been investigated in only one study, which found that
dexamethasone had little or no effect on induction of human I-TAC,
MIG, or IP10 in bronchial epithelial cells stimulated with IFN- or
with IFN- in combination with TNF- or IL-1ß (55).
In contrast, we found that dexamethasone strongly attenuates the
induction of murine I-TAC, as well as MIG and IP10, in both lung and
small intestine during endotoxemia and in IFN--stimulated RAW
macrophages (Fig. 7C), as previously observed for IP10 in
LPS-stimulated RAW cells (70). These observations suggest
that glucocorticoid attenuation of I-TAC, MIG, and IP10 expression may
contribute to the anti-inflammatory effects of glucocorticoids in
Th1-dependent processes.
The I-TAC, MIG, and IP10 genes have been highly conserved between mouse and human, and message regulation of each gene is similar in both species. The CXCR3 gene has also been highly conserved between mouse and human and is preferentially expressed in activated Th1 cells in both species (34, 35). Murine CXCR3 is activated by human I-TAC, murine MIG, and murine IP10 and, as in the human system (11, 14), the hierarchy for cross-desensitization of murine CXCR3 is human I-TAC > MIG > IP10 (34, 35). Although murine 6Ckine induces a Ca2+ flux via murine CXCR3 (34) whereas human 6Ckine does not induce a Ca2+ flux via human CXCR3 (71), the significance of this difference is uncertain because murine 6Ckine fails to induce chemotaxis in murine CXCR3 transfectants (35). Thus, the available data suggest that the CXCR3 receptor/ligand system functions similarly in mice and humans and that mouse models (interpreted with appropriate caution (71)) should be valuable for studying the role of I-TAC and the other CXCR3 ligands in human immunity and disease.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jeffrey B. Smith, Department of Pediatrics, UCLA Center for the Health Sciences B2-325, 10833 Le Conte Avenue, Los Angeles, CA 90095. E-mail address:
3 Abbreviations used in this paper: GRO, growth-related oncogene; ELR, glutamic acid-leucine-arginine; IP10, IFN-inducible protein-10; MIG, monokine induced by IFN-; I-TAC, IFN-inducible T cell chemoattractant; CXCR3, CXC chemokine receptor 3; GARG, glucocorticoid-attenuated response gene; MIP-2, macrophage-inflammatory protein-2.
Received for publication December 10, 1999. Accepted for publication March 24, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. J. Biol. Chem. 271:22878. chemoattractant (I-TAC): a novel non-ELR CXC chemokine with potent activity on activated T cells through selective high affinity binding to CXCR3. J. Exp. Med. 187:2009.-treated human monocytes (THP-1). J. Interferon Cytokine Res. 19:505.[Medline]
-Interferon transcriptionally regulates an early-response gene containing homology to platelet proteins. Nature 315:672.[Medline]
and IP-10 are expressed in demyelinating brain lesions. Proc. Natl. Acad. Sci. USA 96:6873.-interferon encodes a member of the platelet factor 4 family of cytokines. Proc. Natl. Acad. Sci. USA 87:5238. ZAP-based vectors. Methods Mol. Biol. 69:53.[Medline]
interferon and other agents. Mol. Cell. Biol. 12:1535. (MIG), IFN-inducible T cell chemoattractant (I-TAC), and IFN--inducible protein-10 (IP-10) chemokines by human neutrophils. J. Immunol. 162:4928. with patterns of tissue expression that suggest nonredundant roles in vivo. J. Immunol. 157:4511.[Abstract]
. J. Leukocyte Biol. 52:27.[Abstract]
-induced chemokine Mig. J. Immunol. 163:4878.
B sequence motifs controls IFN - and lipopolysaccharide-stimulated transcription from the murine IP-10 promoter. J. Biol. Chem. 268:6677.B site mediate synergistic induction of murine IP-10 gene transcription by IFN- and TNF-. J. Immunol. 154:5235.[Abstract]
and tumor necrosis factor- in transcriptional activation is mediated by cooperation between signal transducer and activator of transcription 1 and nuclear factor B. J. Biol. Chem. 272:14899.This article has been cited by other articles:
|
|
 |
|
  J. Ehrchen, L. Steinmuller, K. Barczyk, K. Tenbrock, W. Nacken, M. Eisenacher, U. Nordhues, C. Sorg, C. Sunderkotter, and J. Roth Glucocorticoids induce differentiation of a specifically activated, anti-inflammatory subtype of human monocytes Blood, February 1, 2007; 109(3): 1265 - 1274. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Ericsson, K. Kotarsky, M. Svensson, M. Sigvardsson, and W. Agace Functional Characterization of the CCL25 Promoter in Small Intestinal Epithelial Cells Suggests a Regulatory Role for Caudal-Related Homeobox (Cdx) Transcription Factors J. Immunol., March 15, 2006; 176(6): 3642 - 3651. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. P. Widney, Y. Hu, A. K. Foreman-Wykert, K. C. Bui, T. T. Nguyen, B. Lu, C. Gerard, J. F. Miller, and J. B. Smith CXCR3 and Its Ligands Participate in the Host Response to Bordetella bronchiseptica Infection of the Mouse Respiratory Tract but Are Not Required for Clearance of Bacteria from the Lung Infect. Immun., January 1, 2005; 73(1): 485 - 493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Sentman, S. K. Meadows, C. R. Wira, and M. Eriksson Recruitment of Uterine NK Cells: Induction of CXC Chemokine Ligands 10 and 11 in Human Endometrium by Estradiol and Progesterone J. Immunol., December 1, 2004; 173(11): 6760 - 6766. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. B. Smith and H. R. Herschman Targeted Identification of Glucocorticoid-attenuated Response Genes: In Vitro and in Vivo Models Proceedings of the ATS, November 1, 2004; 1(3): 275 - 281. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Marson, R. M. Lawn, and T. Mikita Oxidized Low Density Lipoprotein Blocks Lipopolysaccharide-induced Interferon {beta} Synthesis in Human Macrophages by Interfering with IRF3 Activation J. Biol. Chem., July 2, 2004; 279(27): 28781 - 28788. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Johnston, C. H. Kim, D. Soler, M. Emoto, and E. C. Butcher Differential Chemokine Responses and Homing Patterns of Murine TCR{alpha}{beta} NKT Cell Subsets J. Immunol., September 15, 2003; 171(6): 2960 - 2969. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. G. Kallapur, A. H. Jobe, M. Ikegami, and C. J. Bachurski Increased IP-10 and MIG Expression after Intra-amniotic Endotoxin in Preterm Lamb Lung Am. J. Respir. Crit. Care Med., March 1, 2003; 167(5): 779 - 786. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. B. Smith, T. T. Nguyen, H. J. Hughes, H. R. Herschman, D. P. Widney, K. C. Bui, and L. E. Rovai Glucocorticoid-attenuated response genes induced in the lung during endotoxemia Am J Physiol Lung Cell Mol Physiol, September 1, 2002; 283(3): L636 - L647. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Meraro, M. Gleit-Kielmanowicz, H. Hauser, and B.-Z. Levi IFN-Stimulated Gene 15 Is Synergistically Activated Through Interactions Between the Myelocyte/Lymphocyte-Specific Transcription Factors, PU.1, IFN Regulatory Factor-8/IFN Consensus Sequence Binding Protein, and IFN Regulatory Factor-4: Characterization of a New Subtype of IFN-Stimulated Response Element J. Immunol., June 15, 2002; 168(12): 6224 - 6231. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Dufour, M. Dziejman, M. T. Liu, J. H. Leung, T. E. Lane, and A. D. Luster IFN-{gamma}-Inducible Protein 10 (IP-10; CXCL10)-Deficient Mice Reveal a Role for IP-10 in Effector T Cell Generation and Trafficking J. Immunol., April 1, 2002; 168(7): 3195 - 3204. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Zhang, B. A. Luxon, A. Casola, R. P. Garofalo, M. Jamaluddin, and A. R. Brasier Expression of Respiratory Syncytial Virus-Induced Chemokine Gene Networks in Lower Airway Epithelial Cells Revealed by cDNA Microarrays J. Virol., October 1, 2001; 75(19): 9044 - 9058. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Zhang, M. A. Thornton, M. A. Kowalska, B. S. Sachis, M. Feldman, M. Poncz, S. E. McKenzie, and M. P. Reilly Localization of distal regulatory domains in the megakaryocyte-specific platelet basic protein/platelet factor 4 gene locus Blood, August 1, 2001; 98(3): 610 - 617. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Cox, C.-H. Jenh, W. Gonsiorek, J. Fine, S. K. Narula, P. J. Zavodny, and R. W. Hipkin Human Interferon-Inducible 10-kDa Protein and Human Interferon-Inducible T Cell {alpha} Chemoattractant Are Allotopic Ligands for Human CXCR3: Differential Binding to Receptor States Mol. Pharmacol., April 1, 2001; 59(4): 707 - 715. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
), I-TAC (•), and MIG (
) to S2 in arbitrary
units. The units are chosen so that maximal expression of each gene
equals 100. B, LPS time course. RNA was harvested after
the addition of 1 µg/ml LPS to the medium and was analyzed as in
A. Expression of IP10 and I-TAC is represented as in
A. MIG expression was not induced by LPS. C, Effect of
dexamethasone (Dex). Dex (2 µg/ml) was added to the culture medium
3 h before addition of 10 ng/ml IFN-