The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuwana, M.
Right arrow Articles by Wright, T. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuwana, M.
Right arrow Articles by Wright, T. M.
The Journal of Immunology, 2000, 164: 6138-6146.
Copyright © 2000 by The American Association of Immunologists

Analysis of Soluble and Cell Surface Factors Regulating Anti-DNA Topoisomerase I Autoantibody Production Demonstrates Synergy Between Th1 and Th2 Autoreactive T Cells1

Masataka Kuwana2,*, Thomas A. Medsger, Jr.*,{dagger} and Timothy M. Wright3,*,{dagger},{ddagger}

* Division of Rheumatology and Clinical Immunology, Department of Medicine, {dagger} University of Pittsburgh Arthritis Institute, and {ddagger} Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The cellular and subcellular events governing Ab production with specificity for self Ags are poorly understood. In this study we examined the role of cellular interactions and cytokines in regulating the production of anti-DNA topoisomerase I (topo I) Ab, a major autoantibody in patients with systemic sclerosis (SSc). Topo I-specific T cell clones derived from SSc subjects and healthy donors were cultured with autologous peripheral blood B cells. Anti-topo I Ab production was induced by five of seven topo I-specific T cell clones derived from SSc subjects, but by none of eight T cell clones generated from healthy controls. However, two of the T cell clones from healthy controls provided help to HLA-DR-matched SSc B cells to produce anti-topo I Ab. The analysis of cytokine mRNA expression revealed that the ability to promote anti-topo I autoantibody production was strictly correlated with IL-2 and IL-6 expression by the T cell clones. Kinetic studies showed that IL-2 was required throughout the culture period for maximal autoantibody production and that both MHC-TCR and CD40-CD40L interactions were essential during the early phase of the culture. IL-6 was important in the late phase. Th1 clones (producing IL-2, but no IL-6) and Th2 clones (producing IL-6, but no IL-2) synergically activated autologous B cells to produce anti-topo I Ab. These results indicate that T cell-dependent B cell activation resulting in anti-topo I autoantibody production requires a series of temporally defined cell contact and soluble stimuli.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Systemic sclerosis (scleroderma; SSc)4 is an autoimmune disease characterized by microvascular damage and fibrosis of the dermis and internal organs (1). A prominent immunological abnormality in SSc patients is the presence of circulating autoantibodies against a variety of nuclear proteins, most of which are known to be involved in important cellular functions, such as transcription and cell division (2). One of the major autoantibody responses specific to SSc is directed against DNA topoisomerase I (topo I), a nuclear enzyme that catalyzes a relaxation of dsDNA (3) and is involved in transcription mediated by RNA polymerase II (4, 5). The basic mechanisms regulating autoantibody responses to topo I in SSc patients have not been defined, but several indirect lines of evidence, including the presence of isotype-switching and affinity maturation (6, 7), recognition of multiple epitopes on topo I (8), and associations with the MHC class II alleles (9, 10, 11), strongly suggest that anti-topo I Ab production results from an Ag-driven, T cell-dependent process. Our previous studies examining the cellular mechanisms controlling anti-topo I Ab production support this hypothesis. We have detected topo I-specific T cell proliferative responses in individuals with certain HLA-DR types, including DR15, DR11, and DR7 (12). Furthermore, B cells from anti-topo I-positive SSc subjects did not spontaneously produce anti-topo I Ab in vitro, but did produce this autoantibody in an Ag-dependent manner when cultured with topo I-specific T cells (13).

Many of the factors regulating the humoral immune response to foreign Ags have been identified. It has been shown that T cell-dependent B cell activation resulting in the production of specific Abs requires both cognate interaction between T and B cells and T cell-derived cytokines (14, 15, 16). T-B cell interaction is governed by distinct sets of receptor/ligand pairs, such as CD40 on mature B cells and CD40 ligand (CD40L) on activated T cells. In addition, various cytokines derived from T cells, including IL-1, IL-2, IL-4, IL-6, IL-10, and IFN-{gamma}, have been shown to have human B cell growth and/or differentiation factor activities (16, 17).

To identify the cell surface and soluble factors involved in autoantibody production in SSc, we have developed a culture system capable of reconstituting the components necessary for the synthesis of anti-topo I Ab in vitro (13). Using bulk PBMC in this system, we found that the production of anti-topo I Ab is dependent on cognate and HLA-DR-restricted T-B cell interaction. Assessment of the cytokine requirements necessary for this process was not feasible due to the heterogeneity of the T cells in the cultures. In this report we present the analysis of cytokine profiles and T cell function involved in promoting anti-topo I Ab production using T cell clones derived from SSc subjects and healthy individuals.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human subjects

Blood samples were obtained from two subjects with SSc who had serum anti-topo I Ab (T1 and T2) and from three healthy controls (D1, D2, and D3). All subjects were North American Caucasians and had been analyzed in our previous study (18). They were selected based on the presence of HLA-DR11 (DRB1*1101 or *1104), as determined by the PCR-restriction fragment length polymorphism method (19). Subjects with HLA-DR11 were chosen for these studies because HLA-DR11 was previously shown to be associated with the presence of serum anti-topo I Ab (10, 11) and topo I-specific T cell proliferative responses (12) in North American Caucasians. The SSc subjects fulfilled the American College of Rheumatology (formerly termed American Rheumatism Association) preliminary criteria for the classification of SSc (20). Serum anti-topo I Ab was identified by double immunodiffusion (8), immunoprecipitation using 35S-labeled HeLa cell extracts (21), and anti-topo I ELISA (7). Sera from SSc subjects were positive for anti-topo I Ab by all three methods, and sera from healthy controls were confirmed to be negative for anti-topo I-Ab by all three methods.

Antigens

Five recombinant topo I proteins (F3–F7) encompassing together the entire 765-aa sequence of topo I were prepared as soluble maltose-binding protein (MBP)-topo I fusion proteins as described previously (7). These included F3 (aa 1–93), F4 (aa 43–224), F5 (aa 209–386), F6 (aa 363–563), and F7 (aa 541–765). An equimolar mixture of these five recombinant proteins was regarded as topo I and was used as the Ag for the anti-topo I ELISA, the topo I-induced T cell proliferation assay, and the in vitro anti-topo I Ab production assay. MBP, the fusion partner of the recombinant topo I-fusion proteins, was prepared and used as a negative control Ag.

Cell preparations

A total of 15 topo I-specific T cell clones were analyzed in this study. All T cell clones had a CD3+CD4+CD8- phenotype, and other characteristics, including antigenic specificity and TCR{alpha}ß usage, were reported previously (18). Seven clones were generated from anti-topo I-positive SSc subjects and included T1-1 and T1-3 (from subject T1), and T2-3, T2-4, T2-5, T2-6, and T2-7 (from subject T2). Eight clones were generated from healthy control subjects and included D1-1 (from subject D1), D2-5A, D2-8A, D2-15A, D2-24, and D2-14 (from subject D2), and D3-5 and D3-6 (from subject D3). Topo I-specific T cell clones were maintained in RPMI 1640 containing 10% human AB serum (Sigma, St. Louis, MO), 2 mM L-glutamine, 50 U/ml penicillin, and 50 µg/ml streptomycin by stimulation with irradiated (9000 rad) autologous EBV-transformed B cells (as APCs), topo I (20 µg/ml), and rIL-2 (100 U/ml; Life Technologies, Grand Island, NY) at 7- to 10-day intervals. Before use, topo I-specific T cell clones were rested for 7–10 days and recovered on a Ficoll-Paque (Pharmacia, Piscataway, NJ) density gradient to remove residual Ag and APCs. For the analysis of cytokine profiles and the in vitro anti-topo I Ab production assay, T cell clones were cultured in complete medium in which human serum was replaced by FBS.

B cell-enriched fractions were obtained from PBMC as described previously (13) with some modifications. Briefly, adherent cells were removed from PBMC by adherence to plastic flasks. Then fractions highly enriched for B cells were prepared from the nonadherent cells by two purifications using nylon wool columns. To minimize contaminating T cells in the B cell fraction, T cells were further depleted by incubation with anti-CD4 and anti-CD8 mAb-coupled magnetic beads (Dynal, Oslo, Norway). Flow cytometric analysis revealed that the B cell fraction contained >90% CD22+ B cells and <2% CD3+ T cells.

Detection of cytokine expression

Topo I-specific T cell clones or PBMC (1 x 105 cells) in 1 ml of complete medium were cultured in 24-well plates in the presence of PHA (1 µg/ml). The cells were harvested 18 h later, and T cell clones were isolated by incubation with anti-CD4 mAb-coupled magnetic beads. The culture supernatants were collected, filtered through a 0.22-µm pore size filter, and stored at -20°C until assayed. The amount of IL-6 protein in the culture supernatants was measured by ELISA (Advanced Magnetics, Cambridge, MA). To analyze cytokine mRNA expression, total cellular RNA was purified from T cell clones or PBMC using a phenol/guanidine isothiocyanate extraction procedure (Trizol, Life Technologies). First-strand cDNA was synthesized from 1 µg of total RNA using Moloney murine leukemia virus reverse transcriptase (Life Technologies) with random hexamer priming. Aliquots of the cDNA (50 ng of total RNA equivalent) were amplified with specific primers by PCR for 35 cycles (or 40 cycles for IL-4). The sense and antisense primers used were as follows: IFN-{gamma}, GGTCATTCAGATGTAGCGGAT (sense) and GACAGTTCAGCCATCACTTGG (antisense); IL-2, ATGTACAGGATGCAACTCCTG (sense) and TCAAGTTAGTGTTGAGATGAT GCTTTGAC (antisense) (22); IL-4, TGCCTCCAAGAACACAACTG (sense) and AACGTACTCTG GTTGGCTTC (antisense) (23); IL-6, GGATCCTCCTTCTCCACAAGCGCCTTCGGTCCA (sense) and AAGCTTGTTCCTCACTACTCTCAAATCTGTTCTG (antisense) (24); IL-10, GCGACTCTATAGACTCTAGGA (sense) and CCGAGACACTGGAAGGTGAAT (antisense); TGF-ß, GCCCTGGACACCAACTATTGCT (sense) and AGGCTCCAAATGTAGGGGCAGG (antisense) (25); TCR{alpha}, TCCAGTGACAAGTCTGTCTGCCTA (sense) and TTGCTCCAGGCCACAGCACTGTT (antisense); and ß-actin, TTCATGGATGCCACAGGATTC (sense) and TTCTACAATGAGCTGCGTGTG (antisense). PCR products were analyzed by electrophoresis on 2% agarose gels and were visualized by ethidium bromide staining. In some topo I-specific T cell clones, cytokine mRNA expression was examined without stimulation.

Ag-induced T cell proliferation assay

Topo I-induced T cell proliferation was determined as described previously (12). Briefly, T cell clones (2 x 104 cells) were cultured with autologous irradiated EBV-transformed B cells (2 x 104) in the presence of topo I or MBP (20 µg/ml). After 48 h of incubation, [3H]thymidine (1 µCi/well) was pulsed for 16 h, and the cells were harvested. Incorporated [3H]thymidine was quantified by liquid scintillation counting.

Analysis of in vitro anti-topo I Ab production

Production of anti-topo I Ab from cultured cells was measured as described previously (13) with modifications. Topo I-specific T cell clones (3 x 105 cells) were cultured in duplicate in 24-well tissue culture clusters (Corning, Corning, NY) with peripheral blood B cells (3 x 105) in the presence of Ag (topo I or MBP; 20 µg/ml) and pokeweed mitogen (PWM; 1 µg/ml) with or without exogenous IL-2 (100 U/ml). The cells were washed after 60 h of culture and then cultured without Ag for additional 7 days. Culture supernatants were then harvested, and anti-topo I Ab levels were measured by topo I-specific ELISA (7). Unless stated otherwise, samples were analyzed for total anti-topo I Ab, defined as the total of IgG, IgA, and IgM isotypes of anti-topo I Ab. To examine the isotypes of the anti-topo I Ab produced, IgG, IgA, and IgM anti-topo I Ab isotypes were determined by isotype-specific ELISAs (7). All samples were tested in duplicate, and the results were calculated as the mean of duplicate values minus the reference blank well mean. Unless indicated otherwise, SD are <15% of the mean value or <0.010 (OD405). The presence of anti-topo I Ab in culture supernatants was assessed by immunoprecipitation using 35S-labeled HeLa cell extracts (13, 21). In some samples the specificity of anti-topo I reactivity in the ELISA was confirmed by ELISA inhibition assay, in which topo I and MBP (100 µg/ml) were used as competitors (7).

The effect of blocking interactions with MHC class II molecules on in vitro anti-topo I Ab production was determined by the addition of mAbs (1 µg/ml) specific for HLA-DR (L243) or HLA-DQ (1a3) (Leinco, St. Louis, MO). Anti-CD40L mAb (1 µg/ml; 2431, Ancell, Bayport, MN) was used to block the CD40-CD40L interaction. Serial concentrations of anti-IL-6 mAb (2.5, 10, 25, and 50 µg/ml; Genzyme, Cambridge, MA) were used to neutralize IL-6 activity in the cultures. Purified mouse IgG1 and IgG2a mAbs against irrelevant specificities (Leinco) were used as isotype controls. In some experiments serial amounts (as indicated in the figures) of exogenous rIL-2, rIL-4, or rIL-6 (Life Technologies) were added to the cultures. Unless otherwise indicated, all mAbs and exogenous cytokines were added to the cultures at the initiation of the cultures and added again after the cells were washed on day 3.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytokine profile of anti-topo I-specific T cell clones

Fifteen topo I-specific T cell clones were analyzed for cytokine mRNA expression, including IFN-{gamma}, IL-2, IL-4, IL-6, IL-10, and TGF-ß, with TCR{alpha} and ß-actin as controls. Shown in Fig. 1Go are the PCR-amplified products stained by ethidium bromide. Table IGo summarizes the cytokine mRNA expression of all topo I-specific T cell clones. Individual T cell clones expressed different sets of cytokines. Of seven topo I-specific T cell clones derived from anti-topo I-positive SSc subjects, T1-1 and T2-3 expressed IFN-{gamma} and IL-2, but did not express IL-4, IL-6, or IL-10. This pattern of cytokine expression is consistent with that of a Th1 cell subset. Clones T2-4 and T2-7 had patterns of cytokine mRNA expression consistent with a Th2 phenotype, with signals for IL-4, IL-6, and/or IL-10 and lacking signals for IFN-{gamma} or IL-2. The remaining three clones from SSc subjects (T1-3, T2-5, and T2-6) expressed both Th1 and Th2 cytokines. In contrast, all eight topo I-specific T cell clones generated from healthy donors expressed both Th1 cytokines and Th2 cytokines in various combinations. Only a trace amount of IL-10 mRNA was detected in clones T2-5 and T2-7 without PHA stimulation, indicating that expression of T cell-derived cytokines required T cell activation.



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 1. Cytokine mRNA expression of topo I-specific T cell clones determined by RT-PCR. Topo I-responsive T cell clones were derived from SSc subjects and healthy controls. Total RNA isolated from PHA-stimulated topo I-specific T cell clones or, as a control, PHA-stimulated PBMC was reverse transcribed into cDNA, and aliquots corresponding to 50 ng of total RNA input were used as templates with specific primers for 35 or 40 cycles of PCR amplification. The PCR products were then analyzed by agarose gel electrophoresis followed by ethidium bromide staining. Product sizes for IFN-{gamma}, IL-2, IL-4, IL-6, IL-10, TGF-ß, TCR{alpha}, and ß-actin were 311, 462, 224, 425, 506, 161, 151, and 561 bp, respectively. M, m.w. marker (123-bp ladder).

 

View this table:
[in this window]
[in a new window]
 
Table I. Cytokine profiles of topo I-specific T cell clones and in vitro anti-topo I Ab production in cultures of T cell clones and autologous B cells

 
Topo I-specific T cell clones induce anti-topo I Ab production by SSc subject B cells

Anti-topo I Ab was measured in supernatants of cultures containing individual topo I-specific T cell clones and autologous B cells stimulated with topo I and PWM in the presence or the absence of exogenous IL-2 (Table IGo). When anti-topo I Ab levels in ELISA were compared with the immunoprecipitation results, all culture supernatants representing anti-topo I Ab levels >=0.047 precipitated a 100-kDa protein, which was consistent with topo I. In ELISA inhibition assay, anti-topo I reactivity in samples that immunoprecipitated topo I was completely inhibited by the addition of topo I, but not by MBP (data not shown). Of seven topo I-specific T cell clones derived from anti-topo I-positive SSc subjects, clones T1-3, T2-5, and T2-6 induced anti-topo I Ab production, whereas clones T1-1 and T2-3 were unable to provide help to B cells regardless of IL-2. Anti-topo I Ab was detected in the supernatants of cultures containing clones T2-4 and T2-7 when supplemented with exogenous IL-2. The only anti-topo I Ab isotype detected was IgG. B cells from all subjects cultured alone did not produce anti-topo I Ab regardless of exogenous IL-2 (data not shown). Anti-topo I Ab was not found in culture supernatants stimulated with the control Ag MBP (data not shown). In contrast, cultures containing the eight topo I-specific T cell clones derived from healthy controls, and autologous B cells did not produce anti-topo I Ab.

The lack of anti-topo I Ab production by B cells derived from healthy controls could be due to the lack of helper function in topo I-specific T cells and/or the absence of circulating B cells capable of producing anti-topo I Ab in healthy subjects. To test these two possibilities, topo I-specific T cell clones and B cells from anti-topo I-positive SSc subjects and HLA-DR-matched healthy subjects were cultured in different combinations. Topo I-specific T cell clones derived from healthy controls were cultured with B cells from anti-topo I-positive SSc subjects T1 and T2 in the presence or the absence of exogenous IL-2. B cells from a healthy control subject (D2) were used as a negative control. The topo I-specific T cell clones used were D1-1, D2-5A, D2-24, and D3-5, because they showed topo I-specific proliferative responses when EBV-transformed B cells generated from T1, T2, and D2 were used as APCs (data not shown). Furthermore, these T cell clones showed significant proliferation after stimulation with topo I peptides presented on mouse L cell transfectants carrying DRB1*1101 (M. Kuwana, H. Inoko, and T. M. Wright, unpublished observations).

As shown in Table IIGo, significant levels of IgG anti-topo I Ab were detected in supernatants of cultures containing clones D2-5A and D3-5 when they were incubated with B cells from SSc subjects, but not when cultured with B cells from a control subject D2. By contrast, five topo I-specific T cell clones generated from SSc subjects (T1-3, T2-4, T2-5, T2-6, and T2-7), which induced anti-topo I Ab production from autologous SSc B cells, did not stimulate anti-topo I Ab production by B cells from healthy controls D1 or D2, although these clones showed topo I-specific proliferation in the cultures with EBV-transformed B cells from D1 and D2 (data not shown). Anti-topo I Ab was not detected even when 3 x 106 (10 times more) B cells from the healthy control D1 were used (data not shown). These results indicate that topo I-specific T cells from anti-topo I-positive SSc subjects as well as those from healthy individuals can drive anti-topo I Ab production from SSc B cells, and that circulating B cells capable of producing IgG anti-topo I Ab were present only in anti-topo I-positive SSc subjects.


View this table:
[in this window]
[in a new window]
 
Table II. Anti-topo I Ab levels (OD405) in cultures containing peripheral blood B cells and topo I-specific T cell clones

 
Relationship between T cell cytokine expression and anti-topo I Ab production

Seven topo I-specific T cell clones (T1-3, T2-4, T2-5, T2-6, T2-7, D2-5A, and D3-5) were able to induce anti-topo I Ab production from HLA-DR-matched SSc B cells, but four clones (T1-1, T2-3, D1-1, and D2-24) were not. When the cytokine profiles of topo I-specific T cell clones were compared according to their ability to drive anti-topo I Ab production (Table IGo), it was evident that the seven clones that provided help to SSc B cells expressed IL-6 mRNA, whereas none of four clones lacking the helper function expressed IL-6 mRNA. In particular, the five clones (T2-4, T2-5, T2-6, T2-7, and D2-5A) that induced large amounts of anti-topo I Ab (>0.1 OD405) had the highest signal for IL-6 mRNA (Fig. 1Go and Table IGo), although the PCR products were not quantitated. Using an ELISA we found that these five clones secreted detectable levels of IL-6 into supernatants upon PHA stimulation (306, 788, 512, 526, and 182 pg/ml, respectively), whereas IL-6 was not detected in the supernatants of the remaining clones. Therefore, IL-6 secreted by topo I-specific T cell clones appeared to be involved in the activation of B cells to produce anti-topo I Ab.

All except two topo I-specific T cell clones expressed IL-2 mRNA, and the remaining two clones, T2-4 and T2-7, induced anti-topo I Ab production if IL-2 was added to the cultures, suggesting that endogenous or exogenous IL-2 was also necessary for helper function. No additional relationships were found between the helper function and cytokine mRNA expression, including those of IL-4 and IL-10.

Effect of IL-6 neutralization on anti-topo I Ab production

To further examine the role of IL-6 in the production of anti-topo I Ab, the effect of IL-6 neutralization by anti-IL-6 mAb was tested. B cells from anti-topo I-positive SSc subject T2 were cultured with the topo I-specific T cell clones T2-4, T2-6, and D2-5A (Fig. 2Go). Anti-IL-6 mAb inhibited anti-topo I Ab production in a dose-dependent fashion, reaching a plateau at a concentration of 25 µg/ml, and isotype control mouse IgG1 mAb (25 µg/ml) had no effect. The maximal inhibitions observed at 25 µg/ml of anti-IL-6 mAb in cultures of T2-4, T2-6, and D2-5A were 63, 65, and 70%, respectively, suggesting that B cell activation is mediated by other factors besides IL-6. As shown in Fig. 2Go, anti-topo I Ab production was also blocked by addition of anti-HLA-DR or anti-CD40L mAb, but not by anti-HLA-DQ mAb, confirming our previous observations regarding the MHC class II restriction of this response using bulk PBMC cultures (13). Similar results were obtained when topo I-specific T cell clones T2-5, T2-7, and D3-5 were used or when B cells from an another anti-topo I-positive SSc subject T1 were used (data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 2. Effects of anti-IL-6, anti-HLA-DR, anti-HLA-DQ, and anti-CD40L mAbs on in vitro anti-topo I Ab production. Peripheral blood B cells from anti-topo I-positive SSc subject T2 were cultured with clone T2-4, T2-6, or D2-5A. The cultured cells were stimulated with topo I (20 µg/ml) and PWM (1 µg/ml) in the presence (T2-4 and D2-5A) or the absence (T2-6) of exogenous IL-2 (100 U/ml). Anti-IL-6 mAb (2.5, 10, 25, and 50 µg/ml), anti-HLA-DR mAb (1 µg/ml), anti-HLA-DQ mAb (1 µg/ml), anti-CD40L mAb (1 µg/ml), or isotype control mAb (mouse IgG1, 25 µg/ml) was added to the cultures at their initiation and again after the cells were washed on day 3. Anti-topo I Ab in the supernatants was measured by anti-topo I ELISA.

 
To examine the sequence of events in the T-B cell interactions leading to anti-topo I Ab production, the kinetics of the inhibition by anti-HLA-DR, anti-CD40L, and anti-IL-6 mAbs on anti-topo I Ab production were measured in cultures of clones T2-4 and D2-5A (Fig. 3Go). Each mAb was added at the initiation of the cultures, after the cells were washed on day 3, or at both times. The results indicate that anti-IL-6 mAb blocked anti-topo I Ab production when it was added on day 3, but not when it was present only during the first 3 days of culture. In contrast, anti-HLA-DR and anti-CD40L mAbs were effective when they were added at the initiation of culture, but had no effect when they were added only on day 3. These findings indicate that IL-6 promotes anti-topo I Ab production in the late phase of the T-B cell interaction, whereas HLA-DR and CD40 are important only during the early phase (days 0–3).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 3. Kinetics of the inhibitory effects of anti-IL-6, anti-HLA-DR, and anti-CD40L mAbs on in vitro anti-topo I Ab production. Peripheral blood B cells from anti-topo I-positive SSc subject T2 were cultured with topo I-specific T cell clone T2-4 or D2-5A. The cultured cells were stimulated with topo I (20 µg/ml) and PWM (1 µg/ml) in the presence of exogenous IL-2 (100 U/ml). Anti-IL-6 mAb (25 µg/ml), anti-HLA-DR mAb (1 µg/ml), or anti-CD40L mAb (1 µg/ml) was added to the cultures at their initiation, after the cells were washed on day 3, or at both times. Anti-topo I Ab in the supernatants was measured by anti-topo I ELISA.

 
Effect of exogenous IL-6 on anti-topo I Ab production

To examine whether the inability of some topo I-specific T cell clones to provide help to SSc subject B cells could be due to the lack of endogenous IL-6 in the cultures, the effect of exogenous IL-6 on in vitro anti-topo I Ab production was examined (Fig. 4Go). The possible involvement of another Th2 cytokine, IL-4, in this process was also studied. IL-6 did not induce anti-topo I Ab production when it was present only during the initial phase (days 0–3) of the cultures, but it did induce anti-topo I Ab production when it was added on day 3, indicating again that IL-6 promotes anti-topo I Ab production in the late phase of culture. However, IL-6-induced anti-topo I Ab production was completely abolished when the cells were cultured with anti-HLA-DR or anti-CD40L mAb. B cells alone did not produce anti-topo I Ab when stimulated with IL-4, IL-6, or IL-4 and IL-6 in combination (data not shown). When serial concentrations (0.2–5 ng/ml) of IL-4 or IL-6 were tested (Fig. 5Go), enhancement of anti-topo I Ab production by IL-6 was dose dependent and reached a plateau at a concentration of 1 ng/ml, whereas IL-4 failed to augment anti-topo I Ab production at any concentration. Moreover, when both of these cytokines were added together, IL-4 did not enhance, but instead seemed to inhibit slightly the effects of IL-6 (Fig. 4Go). Taken together, these results identify IL-6 as a major B cell-activating factor produced by autoreactive T cells that promotes anti-topo I Ab production. In addition, IL-6-induced anti-topo I Ab production requires both HLA-DR and CD40 engagement in the early phase of the T-B cell collaboration.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 4. Effect of exogenous IL-4 and IL-6 on in vitro anti-topo I Ab production. Peripheral blood B cells from anti-topo I-positive SSc subject T2 were cultured with topo I-specific T cell clone T2-3 or D1-1. The cultured cells were stimulated with topo I (20 µg/ml) and PWM (1 µg/ml) in the presence of exogenous IL-4 (1 ng/ml), IL-6 (1 ng/ml), and both IL-4 and IL-6. Exogenous cytokines were added at the initiation of cultures and again after the cells were washed on day 3. In some preparations, IL-6 was added only at the initiation or only on day 3. Anti-HLA-DR (1 µg/ml) or anti-CD40L (1 µg/ml) mAb was added to the cultures supplemented with IL-6 as indicated. Anti-topo I Ab in the culture supernatants was measured by anti-topo I ELISA.

 


View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 5. Effects of serial concentrations of exogenous IL-4 and IL-6 on in vitro anti-topo I Ab production. Peripheral blood B cells from anti-topo I-positive SSc subject T2 were cultured with either topo I-specific T cell clone T2-3 or D1-1 and were stimulated with topo I (20 µg/ml) and PWM (1 µg/ml) in the presence of serial concentrations of IL-6 (0–5 ng/ml; A), or IL-4 (0–5 ng/ml; B). Exogenous cytokines were added at the initiation of cultures and again after the cells were washed on day 3. Anti-topo I Ab in the culture supernatants was measured by anti-topo I ELISA.

 
Role of IL-2 in anti-topo I Ab production

To examine the role of IL-2 in anti-topo I Ab production, IL-2 was added to the cultures of B cells from an anti-topo I-positive SSc subject T2 with two T cell clones, T2-4 or T2-7, that lack IL-2 expression (Fig. 6Go). IL-2 markedly augmented anti-topo I Ab production induced by T2-4 and T2-7. IL-2 was required for the entire 10-day culture period for maximal effect. When IL-2 was added 18 h after the initiation of culture, there was no stimulation of anti-topo I Ab production (Fig. 6GoA). Experiments using serial concentrations of IL-2 (10–200 U/ml) showed that a minimal amount of IL-2 (10 U/ml) was adequate for induction of anti-topo I Ab production and larger amounts had no additional effect (Fig. 6GoB). Similar to their effects on IL-6 stimulation, anti-HLA-DR and anti-CD40L mAbs blocked IL-2-induced anti-topo I Ab production. Also shown in Fig. 6Go is the finding that anti-IL-6 mAb inhibited IL-2-induced anti-topo I Ab production, indicating that IL-2 was not able to induce anti-topo I Ab production without IL-6. Similar results were obtained with B cells from an additional anti-topo I-positive SSc subject T1 (data not shown). These results suggest that IL-2 is essential in the T-B cell collaboration leading to anti-topo I Ab production, especially in the very early phase of the cultures.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 6. Effect of exogenous IL-2 on in vitro anti-topo I Ab production. Peripheral blood B cells from anti-topo I-positive SSc subject T2 were cultured with either topo I-specific T cell clone T2-4 or T2-7, which lack IL-2 expression. The cultured cells were stimulated with topo I (20 µg/ml) and PWM (1 µg/ml) in the presence or the absence of exogenous IL-2 (100 U/ml; A) or in the presence of serial concentrations of IL-2 (0–200 U/ml; B). B, {blacksquare} and {square} indicate the results of T2-4 and T2-7, respectively. Unless otherwise specified, IL-2 was added to the cultures at the initiation and again after the cells were washed on day 3. In some samples, IL-2 was added only at the initiation or only on day 3, as indicated. Anti-HLA-DR (1 µg/ml), anti-CD40L (1 µg/ml), or anti-IL-6 (25 µg/ml) mAb was added to the cultures supplemented with IL-2, as indicated. Anti-topo I Ab in the supernatants was measured by anti-topo I ELISA.

 
Synergy between Th1 and Th2 autoreactive T cell clones

Our results indicated that both IL-2 and IL-6 are necessary to induce anti-topo I Ab production by autoreactive B cells from SSc subjects. To test whether IL-2 or IL-6 secreted by different topo I-specific T cell clones could synergistically provide help to B cells, we set up cultures containing B cells from anti-topo I-positive SSc subject T2 and autologous Th1 (T2-3) and Th2 (T2-4 or T2-7) clones in various ratios (Fig. 7Go). Anti-topo I Ab was detected in the supernatants of cultures containing B cells incubated with the mixture of clones T2-3 and T2-4 or T2-7, clones T2-4 or T2-7 supplemented with IL-2, and clone T2-3 supplemented with IL-6. The maximum production of autoantibody was observed when clone T2-3 (Th1) was cultured with either clone T2-4 (Th2) or clone T2-7 (Th2) in a ratio of 1:2. These results indicate that simultaneous activation of Th1 and Th2 clones can produce complementary cytokines (IL-2 and IL-6), leading to the activation of autoreactive B cells. Thus, in contrast to the well-described antagonism between Th1 and Th2 cells, we observed synergy between these T cells in promoting autoantibody production.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 7. Stimulation of in vitro anti-topo I Ab production by Th1 and Th2 cell clones. Peripheral blood B cells from anti-topo I-positive SSc subject T2 were cultured with the mixture of topo I-specific T cell clones T2-3 and T2-4 (A) or the mixture of T2-3 and T2-7 (B) in various ratios. The cultured cells were stimulated with topo I (20 µg/ml) and PWM (1 µg/ml) with or without the addition of exogenous IL-2 (100 U/ml) or IL-6 (1 ng/ml), as indicated. Anti-topo I Ab in the supernatants was measured by anti-topo I ELISA.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We examined the mechanisms for T-B cell collaboration regulating the production of anti-topo I Ab using an in vitro system consisting of human topo I-specific T cell clones and peripheral blood B cells. Utilization of topo I-specific T cell clones enabled us to analyze the involvement of individual cytokines in the production of anti-topo I Ab. Our results clearly show that T cell-dependent B cell activation in this response depends on two types of stimuli: receptor/ligand engagement generated by a cognate T-B cell contact, and cytokines secreted by the activated topo I-specific T cells. These stimuli could be provided by different topo I-specific T cell populations expressing distinct sets of cytokines. The sequence of T-B cell collaboration for the anti-topo I Ab production is summarized as follows: 1) topo I-specific T cells are activated upon recognition of HLA-DR/topo I peptide complex presented on B cells; 2) B cells are reciprocally activated through the signal generated by CD40-CD40L interaction; and 3) IL-6 secreted by activated topo I-specific T cells promotes anti-topo I Ab production in the late phase of B cell activation. IL-2 is also necessary during this process, in particular during the early phase of the T-B cell interaction. This regulatory process is highly analogous to that of the Ab response to foreign Ags (16) and further supports the hypothesis that the production of autoantibodies in SSc is an Ag-driven process and is not due to an intrinsic lymphocyte abnormality.

Our results showed that T cell help resulting in the secretion of IgG anti-topo I Ab is mainly mediated by IL-6, because 1) IL-6 mRNA and protein expression were detected exclusively in topo I-specific T cell clones that were able to drive anti-topo I Ab production; 2) neutralization of IL-6 abolished anti-topo I Ab production; and 3) exogenous IL-6 augmented the helper function of topo I-specific T cell clones lacking IL-6 expression. The cellular origin of IL-6 is not certain, because IL-6 could be secreted by activated B cells in an autocrine or a paracrine pathway (26). However, it is likely that IL-6 is mostly released by activated topo I-specific T cells, because topo I-specific T cell clones lacking IL-6 mRNA and protein expression did not provide help to B cells, but did provide help if exogenous IL-6 was present. In contrast, IL-4, which is reported to be the most efficient differentiation factor of B cells (16), had little effect on anti-topo I Ab production. This result may be due to differences in the modulatory effect of cytokines on the secretion of human Ig depending on the state of B cell differentiation. The circulating B cells producing IgG anti-topo I Ab in our assay system are presumed to be memory B cells, which have already undergone isotype switching and affinity maturation. IL-6 is reported to be a major growth factor for differentiated Ab-secreting B cells (27), although IL-4 is shown to be actively involved in the process of B cell proliferation and isotype switching, especially the IgE response (16, 28).

IL-2 was also necessary for the induction of anti-topo I Ab production in our system, although target cells of the IL-2 were not identified. IL-2 was first reported as a T cell growth factor (29), but was subsequently found to be a major cytokine promoting the growth and differentiation of B cells in humans (17, 30, 31). It is likely that IL-2 is acting primarily to enhance the proliferation and viability of topo I-specific T cells in our experiments, because 1) IL-2 was essential to maintain our topo I-specific T cell clones, similar to the requirements of other Ag-specific T cell clones (32); and 2) IL-2 was essential in the acute phase of T-B cell interaction (<18 h after the cultures were initiated), and this time was the most consistent with Ag-induced T cell proliferation rather than T cell-dependent B cell activation in light of the delayed kinetics of Ab production. However, Lipsky and colleagues have reported that IL-6 augmented B cell differentiation and proliferation only in the presence of IL-2 (17, 33). The possibility that IL-2 is also acting synergistically with IL-6 in driving B cell differentiation and anti-topo I Ab secretion cannot be excluded.

Peripheral blood B cells from systemic lupus erythematosus (SLE) patients are shown to produce polyclonal Ig as well as autoantibodies, including anti-DNA Abs, independent of T cell help (34, 35). Spontaneous production of B cell-stimulating factors such as IL-6 by B cells (36, 37) and constitutive expression of high affinity IL-6R on B cells (38) are proposed to be responsible for the polyclonal B cell hyper-reactivity in SLE. Although it is apparent from these studies and our present work that involvement of IL-6 in autoantibody production is common in both SLE and SSc, the production of anti-topo I Ab by SSc patients’ B cells required T cell help and was dependent on Ag stimulation. This indicates an important difference between the regulation of autoantibody responses in SLE and SSc, i.e., an Ag-specific immune response in SSc vs a polyclonal immune response in SLE. This hypothesis is further supported by the finding that hypergammaglobulinemia, a common feature in SLE patients, occurs in a minority of SSc patients and is most often found in the setting of overlap conditions (1).

Th cells are divided into Th1 and Th2 subsets according to patterns of cytokine production in response to antigenic stimulation (39). The development of several autoimmune diseases, such as insulin-dependent diabetes mellitus (40), has been shown to be controlled by the Th1, rather than the Th2, phenotype of autoreactive T cells in murine models. Because Th2 cells, which mainly produce IL-4, IL-6, and IL-10, preferentially regulate the humoral immune response, it was presumed that topo I-specific Th2 cells would be primarily involved in anti-topo I Ab responses. However, our results indicate that the T function capable of inducing anti-topo I Ab production was associated with individual cytokine profiles rather than Th1/Th2 phenotypes. Th1-like topo I-specific clones could drive B cells to produce anti-topo I Ab if the cultures were supplemented with IL-6, and this result is consistent with the findings observed in mice (41). In addition, most topo I-specific T cell clones expressed both Th1 and Th2 cytokines, and the patterns of cytokine expression were heterogeneous, supporting the concepts that the human T cell cytokine profile is not controlled by a simple binary switch between two sets of genes, and each cytokine gene expression is regulated independently (42). In addition, our studies support the role for synergy between T cells with complementary cytokine production in regulating B cell function.

A striking finding in this study is that topo I-specific T cells derived from healthy individuals were capable of driving HLA-DR-matched SSc B cells to produce anti-topo I Ab. We recently reported that topo I-specific T cells in anti-topo I-positive SSc subjects and those in healthy controls had similar characteristics, including a predominant CD4+ helper phenotype, restriction by HLA-DR, recognition of major T cell epitope(s) located between aa 276–386 of topo I, and a dominant usage of TCR Vß20.1a (18). Taken together, these findings further confirm that there are no substantial differences between topo I-specific T cells between anti-topo I-positive SSc patients and healthy individuals. The only difference we detected was restricted cytokine profiles (Th1 or Th2 cytokines only) in four of seven topo I-specific T cell clones derived from anti-topo I-positive SSc subjects compared with expression of both Th1 and Th2 cytokines (Th0-like) in all eight topo I-specific T cell clones derived from healthy control subjects. It has been shown that naive T cells have the potential to express both Th1 and Th2 cytokines, and the cytokine environment during T cell activation can determine the dominant cytokine profile (43). Taken together with our previous observation that T cells from anti-topo I-positive SSc subjects displayed accelerated topo I-specific proliferative kinetics in vitro (12), this finding strongly suggests that circulating topo I-specific T cells in anti-topo I-positive SSc patients are activated due to ongoing or recent antigenic stimulation in vivo.

In contrast, circulating B cells capable of producing IgG anti-topo I Ab were present only in the peripheral blood of anti-topo I-positive SSc subjects and were absent in healthy controls. A possible explanation for this difference is that topo I-specific B cell precursors are not deleted or anergized in anti-topo I-positive SSc patients as they may be in healthy individuals. However, potentially autoreactive B cells are known to exist in the fetal and neonatal B cell repertoire (44, 45). Furthermore, recent idiotypic analysis of human anti-topo I Abs showed oligoclonal and preferential VH gene utilization in B cells producing anti-topo I Ab, suggesting activation of a limited B cell population (46). Because B cells producing anti-topo I Ab in our assay system are memory B cells, which have been already activated by antigenic stimulation and T cell help in vivo, it is more likely that topo I-specific precursor B cells exist in both anti-topo I-positive SSc patients and healthy individuals but are activated only in anti-topo I-positive SSc patients, like topo I-specific T cells.

Sercarz et al. (47) proposed a concept that relatively large number of T cells specific for cryptic self-determinants, which are generated at subthreshold levels in the thymus in normal circumstances, are present in the normal T cell repertoire (reviewed in Ref. 48). When cryptic determinants are presented at high concentrations, T cells reactive with self proteins are activated and subsequently cause an autoimmune B cell response because B cell tolerance is mainly dependent on T cell tolerance (16). Since our current and previous studies (12, 13) have shown that topo I-responsive T and B cells are components of the normal immune repertoire and are activated in vivo exclusively in anti-topo I-positive SSc patients, it is possible that the expression of cryptic determinants of topo I, which may be associated with the pathogenesis of SSc, is responsible for activation of topo I-specific immune responses in anti-topo I-positive SSc patients. It has been shown that altered self protein, including complex formation with other proteins and post-translational protein modifications, can elicit autoreactive T and B cell responses in animal models (49, 50). In this regard, the complex of topo I with viral proteins (51, 52) or heat shock proteins (53) as well as cleavage of topo I in a metal-catalyzed oxidation reaction (54) have been reported and lend support to this mechanism for breaking self tolerance. Alternatively, protection of topo I by binding to other proteins (53) could generate cryptic peptides and initiate an autoimmune response to topo I, because peptides derived from topo I may not be processed and presented effectively via the MHC class II pathway under normal circumstances because it is a nuclear protein and extremely sensitive to proteolytic degradation (55).

In summary, our results demonstrated that IL-6 and IL-2, secreted by activated topo I-specific T cells in conjunction with MHC/peptide-TCR and CD40-CD40L interactions, mediate T-B cell collaboration, resulting in anti-topo I Ab responses. In addition, the absence of serum anti-topo I Ab in healthy individuals may be due to the lack of memory B cells capable of producing IgG anti-topo I Ab and not to the lack of topo I-specific T cells. These studies further define the mechanisms that regulate topo I-specific T and B cell responses, a process that will probably provide clues to the pathogenesis of SSc and other autoimmune diseases.


    Acknowledgments
 
We thank Gigi Allias and Carol Blair for coordinating the blood sample collection, Dr. Robert Lanciotti for technical assistance, Drs. Angus Thomson and Yoshinori Suminami for providing PCR primers for detection of cytokine mRNAs, Dr. Susan McCarthy for assisting with the FACS analysis, and Drs. Olivera Finn and Hidetoshi Inoko for their helpful advice.


    Footnotes
 
1 This work was supported by grants from the National Institutes of Health, Scleroderma Federation; the United Scleroderma Foundation; the Arthritis Foundation, Western Pennsylvania Chapter (Shoemaker Fund and Fellowship); the RGK Foundation (Austin, TX); and the Scleroderma Research Fund (Boston, MA). Back

2 Current address: Institute for Advanced Medical Research, Keio University School of Medicine, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan. Back

3 Address correspondence and reprint requests to Dr. Timothy M. Wright, Division of Rheumatology and Clinical Immunology, Department of Medicine, University of Pittsburgh School of Medicine, BST South 711, Pittsburgh, PA 15261. Back

4 Abbreviations used in this paper: SSc, systemic sclerosis; CD40L, CD40 ligand; MBP, maltose binding protein; topo I, DNA topoisomerase I; PWM, pokeweed mitogen; SLE, systemic lupus erythematosus. Back

Received for publication August 17, 1999. Accepted for publication March 28, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Medsger, T. A., Jr. 1993. Systemic sclerosis (scleroderma), localized forms of scleroderma, and calcinosis. In Arthritis and Allied Conditions, 12th Ed. D. J. McCarty and W. J. Koopman, eds. Lea & Febiger, Philadelphia, p. 1253.
  2. Tan, E. M.. 1989. Antinuclear antibodies: diagnostic markers for autoimmune diseases and probes for cell biology. Adv. Immunol. 44:93.[Medline]
  3. Wang, J. C.. 1985. DNA topoisomerases. Annu. Rev. Biochem. 54:665.[Medline]
  4. Merino, A., K. R. Madden, W. S. Lane, J. J. Champoux, D. Reinberg. 1993. DNA topoisomerase I is involved in both repression and activation of transcription. Nature 365:227.[Medline]
  5. Kretzschmar, M., M. Meisterernst, R. G. Roeder. 1993. Identification of human DNA topoisomerase I as a cofactor for activator-dependent transcription by RNA polymerase II. Proc. Natl. Acad. Sci. USA 90:11508.[Abstract/Free Full Text]
  6. Shero, J. H., B. Bordwell, N. F. Rothfield, W. C. Earnshaw. 1986. High titers of autoantibodies to topoisomerase I (Scl-70) in sera from scleroderma patients. Science 231:737.[Abstract/Free Full Text]
  7. Kuwana, M., Jr T. A. Medsger, T. M. Wright. 1995. Detection of anti-DNA topoisomerase I antibody by an enzyme-linked immunosorbent assay using overlapping recombinant polypeptides. Clin. Immunol. Immunopathol. 76:266.[Medline]
  8. Kuwana, M., J. Kaburaki, T. Mimori, T. Tojo, M. Homma. 1993. Autoantigenic epitopes on DNA topoisomerase I: clinical immunogenetic associations in systemic sclerosis. Arthritis Rheum. 36:1406.[Medline]
  9. Kuwana, M., J. Kaburaki, Y. Okano, H. Inoko, K. Tsuji. 1993. The HLA-DR and DQ genes control the autoimmune response to DNA topoisomerase I in systemic sclerosis (scleroderma). J. Clin. Invest. 92:1296.
  10. Reveille, J. D., E. Durban, M. J. MacLeod-St. Clair, R. Goldstein, R. Moreda, R. D. Altman, F. C. Arnett. 1992. Association of amino acid sequences in the HLA-DQB1 first domain with the antitopoisomerase I autoantibody response in scleroderma (progressive systemic sclerosis). J. Clin. Invest. 90:973.
  11. Morel, P. A., H. J. Chang, J. W. Wilson, C. Conte, S. L. Saidman, J. D. Bray, D. J. Tweardy, Jr T. A. Medsger. 1994. Severe systemic sclerosis with anti-topoisomerase I antibodies is associated with an HLA-DRw11 allele. Hum. Immunol. 40:101.[Medline]
  12. Kuwana, M., Jr T. A. Medsger, T. M. Wright. 1995. T cell proliferative response induced by DNA topoisomerase I in patients with systemic sclerosis and healthy donors. J. Clin. Invest. 96:586.
  13. Kuwana, M., Jr T. A. Medsger, T. M. Wright. 1995. T and B cell collaboration is essential for the autoantibody response to DNA topoisomerase I in systemic sclerosis. J. Immunol. 155:2703.[Abstract]
  14. Parker, D. C.. 1993. T cell dependent B cell activation. Annu. Rev. Immunol. 11:331.[Medline]
  15. Clark, E. A., J. A. Ledbetter. 1994. How B and T cells talk to each other. Nature 367:425.[Medline]
  16. Abbas, A. K., A. H. Lichtman, and J. S. Pober. 1994. Cellular and Molecular Immunology, 2nd Ed. Saunders, Philadelphia.
  17. Lipsky, P. E.. 1989. The control of antibody production by immunomodulatory molecules. Arthritis Rheum. 32:1345.[Medline]
  18. Kuwana, M., Jr T. A. Medsger, T. M. Wright. 1997. Highly restricted TCR{alpha}ß usage by autoreactive T cell clones specific for DNA topoisomerase I: recognition of an immunodominant epitope. J. Immunol. 158:485.[Abstract]
  19. Inoko, H., M. Ota. 1993. PCR-RFLP. , , ed. Handbook of HLA Typing Techniques 9. CRC Press, Boca Raton.
  20. Subcommittee for Scleroderma Criteria of the American Rheumatism Association Diagnostic and Therapeutic Criteria Committee. 1980. Preliminary criteria for the classification of systemic sclerosis (scleroderma). Arthritis Rheum. 23:581.
  21. Kuwana, M., J. Kaburaki, T. Mimori, T. Tojo, M. Homma. 1993. Autoantibody reactive with three classes of the RNA polymerases in sera from patients with systemic sclerosis. J. Clin. Invest. 91:1399.
  22. Leung, J. C. K., C. K. W. Lai, Y. L. Chui, R. T. H. Ho, C. H. S. Chan, K. N. Lai. 1992. Characterization of cytokine gene expression in CD4+ and CD8+ T cells after activation with phorbol myristate acetate and phytohaemagglutinin. Clin. Exp. Immunol. 90:147.[Medline]
  23. Bouabula, M., P. Legoux, B. Pességué, B. Delpech, X. Dumont, M. Piechaczyk, P. Casellas, D. Shire. 1992. Quantitation of cytokine gene expression using a polymerase chain reaction method involving co-amplification with an internal multispecific control. J. Biol. Chem. 267:21830.[Abstract/Free Full Text]
  24. Guba, S. C., C. I. Sartor, L. R. Gottschalk, J. Ye-Hu, T. Mulligan, S. G. Emerson. 1992. Bone marrow stromal fibroblasts secrete interleukin-6 and granulocyte-macrophage colony-stimulating factor in the absence of inflammatory stimulation: demonstration by serum-free bioassay, enzyme-linked immunosorbent assay, and reverse transcriptase polymerase chain reaction. Blood 80:1190.[Abstract/Free Full Text]
  25. Brenner, C. A., A. W. Tam, P. A. Nelson, E. G. Engleman, N. Suzuki, K. E. Fry, J. W. Larrick. 1989. Message amplification phenotyping (MAPPing): a technique to simultaneously measure multiple mRNAs from small numbers of cells. BioTechniques. 7:1096.[Medline]
  26. Xia, X., H.-K. Lee, S. C. Clark, Y. S. Choi. 1989. Recombinant interleukin (IL) 2-induced human B cell differentiation is mediated by autocrine IL 6. Eur. J. Immunol. 19:2275.[Medline]
  27. Muraguchi, A., T. Hirano, B. Tang, T. Matsuda, Y. Horii, K. Nakajima, T. Kishimoto. 1988. The essential role of B cell stimulatory factor 2 (BSF-2/IL-6) for the terminal differentiation of B cells. J. Exp. Med. 167:332.[Abstract/Free Full Text]
  28. Parronchi, P., A. Tiri, D. Macchia, M. de Carli, P. Biswas, C. Simonelli, E. Maggi, G. del Prete, M. Ricci, S. Romagnani. 1990. Noncognate contact-dependent B cell activation can promote IL-4-dependent in vitro human IgE synthesis. J. Immunol. 144:2102.[Abstract]
  29. Smith, K. A.. 1980. T-cell growth factor. Immunol. Rev. 51:335.
  30. Nakagawa, N., T. Nakagawa, D. J. Volkman, Jr J. L. Ambrus, A. S. Fauci. 1987. The role of interleukin 2 in inducing Ig production in a pokeweed mitogen-stimulated mononuclear cell system. J. Immunol. 138:795.[Abstract]
  31. Jelinek, D. F., J. B. Splawski, P. E. Lipsky. 1986. The role of interleukin 2 and interferon-{gamma} in human B cell activation, growth and differentiation. Eur. J. Immunol. 16:825.
  32. Shu, S., T. Chou, S. A. Rosenberg. 1986. In vitro sensitization and expansion with viable tumor cells and interleukin 2 in the generation of specific therapeutic effector cells. J. Immunol. 136:3891.[Abstract]
  33. Splawski, J. B., L. M. McAnally, P. E. Lipsky. 1990. IL-2 dependence of the promotion of human B cell differentiation by IL-6 (BSF-2). J. Immunol. 144:562.[Abstract]
  34. Sakane, T., N. Suzuki, S. Takada, Y. Ueda, Y. Murakawa, T. Tsuchida, Y. Yamauchi, T. Kishimoto. 1988. B cell hyperreactivity and its relation to distinct clinical features and the degree of disease activity in patients with systemic lupus erythematosus. Arthritis Rheum. 31:80.[Medline]
  35. Tanaka, Y., F. Shirakawa, T. Ota, H. Suzuki, S. Eto, U. Yamashita. 1988. Mechanism of spontaneous activation of B cells in patients with systemic lupus erythematosus: analysis with anti-class II antibody. J. Immunol. 140:761.[Abstract]
  36. Tanaka, Y., K. Saito, F. Shirakawa, T. Ota, H. Suzuki, S. Eto, U. Yamashita. 1988. Production of B cell-stimulating factors by B cells in patients with systemic lupus erythematosus. J. Immunol. 141:3043.[Abstract]
  37. Kitani, A., M. Hara, T. Hirose, M. Harigai, K. Suzuki, M. Kawakami, Y. Kawaguchi, T. Hidaka, M. Kawagoe, H. Nakamura. 1992. Autostimulatory effects of IL-6 on excessive B cell differentiation in patients with systemic lupus erythematosus: analysis of IL-6 production and IL-6R expression. Clin. Exp. Immunol. 88:75.[Medline]
  38. Nagafuchi, H., N. Suzuki, Y. Mizushima, T. Sakene. 1993. Constitutive expression of IL-6 receptors and their role in the excessive B cell function in patients with systemic lupus erythematosus. J. Immunol. 151:6525.[Abstract]
  39. Salgame, P., J. S. Abrams, C. Clayberger, H. Goldstein, J. Convit, R. L. Modlin, B. R. Bloom. 1991. Differing lymphokine profiles of functional subsets of human CD4 and CD8 T cell clones. Nature 254:279.
  40. Katz, J. D., C. Benoist, D. Mathis. 1995. T helper cell subsets in insulin-dependent diabetes. Science 268:1185.[Abstract/Free Full Text]
  41. Coffman, R. L., B. W. Seymour, D. A. Lebman, D. D. Hiraki, J. A. Christiansen, B. Schrader, H. M. Cherwinski, H. F. J. Savelkoul, F. D. Finkelman, M. W. Bond, et al 1988. The role of helper T cell products in mouse B cell differentiation and isotype regulation. Immunol. Rev. 102:5.[Medline]
  42. Kelso, A.. 1995. Th1 and Th2 subsets: paradigms lost?. Immunol. Today. 16:374.[Medline]
  43. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12:635.[Medline]
  44. Digherio, G., P. Lymberi, D. Holmberg, I. Lundquist, A. Coutinho, S. Avrameas. 1983. High frequency of natural autoantibodies in normal newborn mice. J. Immunol. 134:765.[Abstract]
  45. Sanz, I., H. Dang, M. Takei, N. Talal, J. D. Capra. 1989. VH sequence of a human anti-Sm autoantibody: evidence that autoantibodies can be unmutated copies of germline genes. J. Immunol. 142:883.[Abstract]
  46. Vazques-Abad, D., V. Pascual, N. F. Rothfield. 1993. Analysis of human antitopoisomerase-I idiotypes. J. Clin. Invest. 92:1302.
  47. Moudgil, K. D., E. E. Sercarz. 1994. The T cell repertoire against cryptic self determinants and its involvement in autoimmunity and cancer. Clin. Immunol. Immunopathol. 73:283.[Medline]
  48. Lanzavecchia, A.. 1995. How can cryptic epitopes trigger autoimmunity. J. Exp. Med. 181:1945.[Free Full Text]
  49. Lipham, W. J., T. M. Redmond, H. Takahashi, J. A. Berzofsky, B. Wiggert, G. J. Chander, I. Grey. 1991. Recognition of peptides that are immunogenic but cryptic: mechanisms that allow lymphocytes sensitized against cryptic peptides to initiate pathogenic autoimmune process. J. Immunol. 146:3757.[Abstract]
  50. Dong, X., K. J. Hamilton, M. Satoh, J. Wang, W. H. Reeves. 1994. Initiation of autoimmunity to the p53 tumor suppressor protein by complexes of p53 and SV40 large T antigen. J. Exp. Med. 179:1243.[Abstract/Free Full Text]
  51. Mann, K.. 1993. Topoisomerase activity is associated with purified SV40 T antigen. Nucleic Acids Res. 21:1697.[Abstract/Free Full Text]
  52. Yamada, Y., N. Yamamoto, K. Maeno, Y. Nishiyama. 1990. Role of DNA topoisomerase I in the replication of herpes simplex virus type 2. Arch. Virol. 110:121.[Medline]
  53. Ciavarra, R. P., C. Goldman, K.-K. Wen, B. Tadeschi, F. J. Castora. 1994. Heat stress induces hsc70/nuclear topoisomerase I complex formation in vivo: evidence for hsc70-mediated ATP-independent reactivation in vitro. Proc. Natl. Acad. Sci. USA 91:1751.[Abstract/Free Full Text]
  54. Casciola-Rosen, L. F., F. Wigley, A. Rosen. 1997. Scleroderma autoantigens are uniquely fragmented by metal-catalyzed oxidation reactions: implications for pathogenesis. J. Exp. Med. 185:71.[Abstract/Free Full Text]
  55. Samuels, D. S., N. Shimizu. 1994. The predominant form of mammalian DNA topoisomerase I in vivo has a molecular mass of 100 kDa. Mol. Biol. Rep. 19:99.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
H. Takahashi, M. Amagai, T. Nishikawa, Y. Fujii, Y. Kawakami, and M. Kuwana
Novel System Evaluating In Vivo Pathogenicity of Desmoglein 3-Reactive T Cell Clones Using Murine Pemphigus Vulgaris
J. Immunol., July 15, 2008; 181(2): 1526 - 1535.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
A Tulunay, S Yavuz, H Direskeneli, and E Eksioglu-Demiralp
CD8+CD28-, suppressive T cells in systemic lupus erythematosus
Lupus, July 1, 2008; 17(7): 630 - 637.
[Abstract] [PDF]


Home page
J. Immunol.Home page
H. Yasuoka, H. Ihn, T. A. Medsger Jr, M. Hirakata, Y. Kawakami, Y. Ikeda, and M. Kuwana
A Novel Protein Highly Expressed in Testis Is Overexpressed in Systemic Sclerosis Fibroblasts and Targeted by Autoantibodies
J. Immunol., December 15, 2003; 171(12): 6883 - 6890.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Kuwana, Y. Kawakami, and Y. Ikeda
Suppression of autoreactive T-cell response to glycoprotein IIb/IIIa by blockade of CD40/CD154 interaction: implications for treatment of immune thrombocytopenic purpura
Blood, January 15, 2003; 101(2): 621 - 623.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Veldman, A. Stauber, R. Wassmuth, W. Uter, G. Schuler, and M. Hertl
Dichotomy of Autoreactive Th1 and Th2 Cell Responses to Desmoglein 3 in Patients with Pemphigus Vulgaris (PV) and Healthy Carriers of PV-Associated HLA Class II Alleles
J. Immunol., January 1, 2003; 170(1): 635 - 642.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. P. Ascherman, T. B. Oriss, C. V. Oddis, and T. M. Wright
Critical Requirement for Professional APCs in Eliciting T Cell Responses to Novel Fragments of Histidyl-tRNA Synthetase (Jo-1) in Jo-1 Antibody-Positive Polymyositis
J. Immunol., December 15, 2002; 169(12): 7127 - 7134.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
H. Kodama, T. Hirotani, Y. Suzuki, S. Ogawa, and K. Yamazaki
Cardiomyogenic Differentiation in Cardiac Myxoma Expressing Lineage-Specific Transcription Factors
Am. J. Pathol., August 1, 2002; 161(2): 381 - 389.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Arai, K. Yoshida, J. Kaburaki, H. Inoko, Y. Ikeda, Y. Kawakami, and M. Kuwana