|
|
||||||||

,
*
Division of Rheumatology and Clinical Immunology, Department of Medicine,
University of Pittsburgh Arthritis Institute, and
Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Many of the factors regulating the humoral immune response to foreign
Ags have been identified. It has been shown that T cell-dependent B
cell activation resulting in the production of specific Abs requires
both cognate interaction between T and B cells and T cell-derived
cytokines (14, 15, 16). T-B cell interaction is governed by
distinct sets of receptor/ligand pairs, such as CD40 on mature B cells
and CD40 ligand (CD40L) on activated T cells. In addition, various
cytokines derived from T cells, including IL-1, IL-2, IL-4, IL-6,
IL-10, and IFN-
, have been shown to have human B cell growth and/or
differentiation factor activities (16, 17).
To identify the cell surface and soluble factors involved in autoantibody production in SSc, we have developed a culture system capable of reconstituting the components necessary for the synthesis of anti-topo I Ab in vitro (13). Using bulk PBMC in this system, we found that the production of anti-topo I Ab is dependent on cognate and HLA-DR-restricted T-B cell interaction. Assessment of the cytokine requirements necessary for this process was not feasible due to the heterogeneity of the T cells in the cultures. In this report we present the analysis of cytokine profiles and T cell function involved in promoting anti-topo I Ab production using T cell clones derived from SSc subjects and healthy individuals.
| Materials and Methods |
|---|
|
|
|---|
Blood samples were obtained from two subjects with SSc who had serum anti-topo I Ab (T1 and T2) and from three healthy controls (D1, D2, and D3). All subjects were North American Caucasians and had been analyzed in our previous study (18). They were selected based on the presence of HLA-DR11 (DRB1*1101 or *1104), as determined by the PCR-restriction fragment length polymorphism method (19). Subjects with HLA-DR11 were chosen for these studies because HLA-DR11 was previously shown to be associated with the presence of serum anti-topo I Ab (10, 11) and topo I-specific T cell proliferative responses (12) in North American Caucasians. The SSc subjects fulfilled the American College of Rheumatology (formerly termed American Rheumatism Association) preliminary criteria for the classification of SSc (20). Serum anti-topo I Ab was identified by double immunodiffusion (8), immunoprecipitation using 35S-labeled HeLa cell extracts (21), and anti-topo I ELISA (7). Sera from SSc subjects were positive for anti-topo I Ab by all three methods, and sera from healthy controls were confirmed to be negative for anti-topo I-Ab by all three methods.
Antigens
Five recombinant topo I proteins (F3F7) encompassing together the entire 765-aa sequence of topo I were prepared as soluble maltose-binding protein (MBP)-topo I fusion proteins as described previously (7). These included F3 (aa 193), F4 (aa 43224), F5 (aa 209386), F6 (aa 363563), and F7 (aa 541765). An equimolar mixture of these five recombinant proteins was regarded as topo I and was used as the Ag for the anti-topo I ELISA, the topo I-induced T cell proliferation assay, and the in vitro anti-topo I Ab production assay. MBP, the fusion partner of the recombinant topo I-fusion proteins, was prepared and used as a negative control Ag.
Cell preparations
A total of 15 topo I-specific T cell clones were analyzed in
this study. All T cell clones had a
CD3+CD4+CD8-
phenotype, and other characteristics, including antigenic specificity
and TCR
ß usage, were reported previously (18). Seven
clones were generated from anti-topo I-positive SSc subjects and
included T1-1 and T1-3 (from subject T1), and T2-3, T2-4, T2-5, T2-6,
and T2-7 (from subject T2). Eight clones were generated from healthy
control subjects and included D1-1 (from subject D1), D2-5A, D2-8A,
D2-15A, D2-24, and D2-14 (from subject D2), and D3-5 and D3-6 (from
subject D3). Topo I-specific T cell clones were maintained in RPMI 1640
containing 10% human AB serum (Sigma, St. Louis, MO), 2 mM
L-glutamine, 50 U/ml penicillin, and 50 µg/ml
streptomycin by stimulation with irradiated (9000 rad) autologous
EBV-transformed B cells (as APCs), topo I (20 µg/ml), and rIL-2 (100
U/ml; Life Technologies, Grand Island, NY) at 7- to 10-day intervals.
Before use, topo I-specific T cell clones were rested for 710 days
and recovered on a Ficoll-Paque (Pharmacia, Piscataway, NJ) density
gradient to remove residual Ag and APCs. For the analysis of cytokine
profiles and the in vitro anti-topo I Ab production assay, T cell
clones were cultured in complete medium in which human serum was
replaced by FBS.
B cell-enriched fractions were obtained from PBMC as described previously (13) with some modifications. Briefly, adherent cells were removed from PBMC by adherence to plastic flasks. Then fractions highly enriched for B cells were prepared from the nonadherent cells by two purifications using nylon wool columns. To minimize contaminating T cells in the B cell fraction, T cells were further depleted by incubation with anti-CD4 and anti-CD8 mAb-coupled magnetic beads (Dynal, Oslo, Norway). Flow cytometric analysis revealed that the B cell fraction contained >90% CD22+ B cells and <2% CD3+ T cells.
Detection of cytokine expression
Topo I-specific T cell clones or PBMC (1 x
105 cells) in 1 ml of complete medium were
cultured in 24-well plates in the presence of PHA (1 µg/ml). The
cells were harvested 18 h later, and T cell clones were isolated
by incubation with anti-CD4 mAb-coupled magnetic beads. The culture
supernatants were collected, filtered through a 0.22-µm pore size
filter, and stored at -20°C until assayed. The amount of IL-6
protein in the culture supernatants was measured by ELISA (Advanced
Magnetics, Cambridge, MA). To analyze cytokine mRNA expression, total
cellular RNA was purified from T cell clones or PBMC using a
phenol/guanidine isothiocyanate extraction procedure (Trizol, Life
Technologies). First-strand cDNA was synthesized from 1 µg of total
RNA using Moloney murine leukemia virus reverse transcriptase (Life
Technologies) with random hexamer priming. Aliquots of the cDNA (50 ng
of total RNA equivalent) were amplified with specific primers by PCR
for 35 cycles (or 40 cycles for IL-4). The sense and antisense
primers used were as follows: IFN-
,
GGTCATTCAGATGTAGCGGAT (sense) and GACAGTTCAGCCATCACTTGG
(antisense); IL-2, ATGTACAGGATGCAACTCCTG (sense) and
TCAAGTTAGTGTTGAGATGAT GCTTTGAC (antisense) (22); IL-4,
TGCCTCCAAGAACACAACTG (sense) and AACGTACTCTG GTTGGCTTC (antisense)
(23); IL-6, GGATCCTCCTTCTCCACAAGCGCCTTCGGTCCA (sense) and
AAGCTTGTTCCTCACTACTCTCAAATCTGTTCTG (antisense) (24);
IL-10, GCGACTCTATAGACTCTAGGA (sense) and
CCGAGACACTGGAAGGTGAAT (antisense); TGF-ß, GCCCTGGACACCAACTATTGCT
(sense) and AGGCTCCAAATGTAGGGGCAGG (antisense) (25);
TCR
, TCCAGTGACAAGTCTGTCTGCCTA (sense) and
TTGCTCCAGGCCACAGCACTGTT (antisense); and ß-actin,
TTCATGGATGCCACAGGATTC (sense) and TTCTACAATGAGCTGCGTGTG (antisense).
PCR products were analyzed by electrophoresis on 2%
agarose gels and were visualized by ethidium bromide staining. In some
topo I-specific T cell clones, cytokine mRNA expression was examined
without stimulation.
Ag-induced T cell proliferation assay
Topo I-induced T cell proliferation was determined as described previously (12). Briefly, T cell clones (2 x 104 cells) were cultured with autologous irradiated EBV-transformed B cells (2 x 104) in the presence of topo I or MBP (20 µg/ml). After 48 h of incubation, [3H]thymidine (1 µCi/well) was pulsed for 16 h, and the cells were harvested. Incorporated [3H]thymidine was quantified by liquid scintillation counting.
Analysis of in vitro anti-topo I Ab production
Production of anti-topo I Ab from cultured cells was measured as described previously (13) with modifications. Topo I-specific T cell clones (3 x 105 cells) were cultured in duplicate in 24-well tissue culture clusters (Corning, Corning, NY) with peripheral blood B cells (3 x 105) in the presence of Ag (topo I or MBP; 20 µg/ml) and pokeweed mitogen (PWM; 1 µg/ml) with or without exogenous IL-2 (100 U/ml). The cells were washed after 60 h of culture and then cultured without Ag for additional 7 days. Culture supernatants were then harvested, and anti-topo I Ab levels were measured by topo I-specific ELISA (7). Unless stated otherwise, samples were analyzed for total anti-topo I Ab, defined as the total of IgG, IgA, and IgM isotypes of anti-topo I Ab. To examine the isotypes of the anti-topo I Ab produced, IgG, IgA, and IgM anti-topo I Ab isotypes were determined by isotype-specific ELISAs (7). All samples were tested in duplicate, and the results were calculated as the mean of duplicate values minus the reference blank well mean. Unless indicated otherwise, SD are <15% of the mean value or <0.010 (OD405). The presence of anti-topo I Ab in culture supernatants was assessed by immunoprecipitation using 35S-labeled HeLa cell extracts (13, 21). In some samples the specificity of anti-topo I reactivity in the ELISA was confirmed by ELISA inhibition assay, in which topo I and MBP (100 µg/ml) were used as competitors (7).
The effect of blocking interactions with MHC class II molecules on in vitro anti-topo I Ab production was determined by the addition of mAbs (1 µg/ml) specific for HLA-DR (L243) or HLA-DQ (1a3) (Leinco, St. Louis, MO). Anti-CD40L mAb (1 µg/ml; 2431, Ancell, Bayport, MN) was used to block the CD40-CD40L interaction. Serial concentrations of anti-IL-6 mAb (2.5, 10, 25, and 50 µg/ml; Genzyme, Cambridge, MA) were used to neutralize IL-6 activity in the cultures. Purified mouse IgG1 and IgG2a mAbs against irrelevant specificities (Leinco) were used as isotype controls. In some experiments serial amounts (as indicated in the figures) of exogenous rIL-2, rIL-4, or rIL-6 (Life Technologies) were added to the cultures. Unless otherwise indicated, all mAbs and exogenous cytokines were added to the cultures at the initiation of the cultures and added again after the cells were washed on day 3.
| Results |
|---|
|
|
|---|
Fifteen topo I-specific T cell clones were analyzed for cytokine
mRNA expression, including IFN-
, IL-2, IL-4, IL-6, IL-10, and
TGF-ß, with TCR
and ß-actin as controls. Shown in Fig. 1
are the PCR-amplified products stained
by ethidium bromide. Table I
summarizes
the cytokine mRNA expression of all topo I-specific T cell clones.
Individual T cell clones expressed different sets of cytokines. Of
seven topo I-specific T cell clones derived from anti-topo
I-positive SSc subjects, T1-1 and T2-3 expressed IFN-
and IL-2, but
did not express IL-4, IL-6, or IL-10. This pattern of cytokine
expression is consistent with that of a Th1 cell subset. Clones T2-4
and T2-7 had patterns of cytokine mRNA expression consistent with a Th2
phenotype, with signals for IL-4, IL-6, and/or IL-10 and lacking
signals for IFN-
or IL-2. The remaining three clones from SSc
subjects (T1-3, T2-5, and T2-6) expressed both Th1 and Th2 cytokines.
In contrast, all eight topo I-specific T cell clones generated from
healthy donors expressed both Th1 cytokines and Th2 cytokines in
various combinations. Only a trace amount of IL-10 mRNA was detected in
clones T2-5 and T2-7 without PHA stimulation, indicating that
expression of T cell-derived cytokines required T cell activation.
|
|
Anti-topo I Ab was measured in supernatants of cultures containing
individual topo I-specific T cell clones and autologous B cells
stimulated with topo I and PWM in the presence or the absence of
exogenous IL-2 (Table I
). When anti-topo I Ab levels in ELISA were
compared with the immunoprecipitation results, all culture supernatants
representing anti-topo I Ab levels
0.047 precipitated a 100-kDa
protein, which was consistent with topo I. In ELISA inhibition assay,
anti-topo I reactivity in samples that immunoprecipitated topo I
was completely inhibited by the addition of topo I, but not by MBP
(data not shown). Of seven topo I-specific T cell clones derived from
anti-topo I-positive SSc subjects, clones T1-3, T2-5, and T2-6
induced anti-topo I Ab production, whereas clones T1-1 and T2-3
were unable to provide help to B cells regardless of IL-2. Anti-topo I
Ab was detected in the supernatants of cultures containing clones T2-4
and T2-7 when supplemented with exogenous IL-2. The only anti-topo
I Ab isotype detected was IgG. B cells from all subjects cultured alone
did not produce anti-topo I Ab regardless of exogenous IL-2 (data
not shown). Anti-topo I Ab was not found in culture supernatants
stimulated with the control Ag MBP (data not shown). In contrast,
cultures containing the eight topo I-specific T cell clones derived
from healthy controls, and autologous B cells did not produce
anti-topo I Ab.
The lack of anti-topo I Ab production by B cells derived from healthy controls could be due to the lack of helper function in topo I-specific T cells and/or the absence of circulating B cells capable of producing anti-topo I Ab in healthy subjects. To test these two possibilities, topo I-specific T cell clones and B cells from anti-topo I-positive SSc subjects and HLA-DR-matched healthy subjects were cultured in different combinations. Topo I-specific T cell clones derived from healthy controls were cultured with B cells from anti-topo I-positive SSc subjects T1 and T2 in the presence or the absence of exogenous IL-2. B cells from a healthy control subject (D2) were used as a negative control. The topo I-specific T cell clones used were D1-1, D2-5A, D2-24, and D3-5, because they showed topo I-specific proliferative responses when EBV-transformed B cells generated from T1, T2, and D2 were used as APCs (data not shown). Furthermore, these T cell clones showed significant proliferation after stimulation with topo I peptides presented on mouse L cell transfectants carrying DRB1*1101 (M. Kuwana, H. Inoko, and T. M. Wright, unpublished observations).
As shown in Table II
, significant levels
of IgG anti-topo I Ab were detected in supernatants of cultures
containing clones D2-5A and D3-5 when they were incubated with B cells
from SSc subjects, but not when cultured with B cells from a control
subject D2. By contrast, five topo I-specific T cell clones generated
from SSc subjects (T1-3, T2-4, T2-5, T2-6, and T2-7), which induced
anti-topo I Ab production from autologous SSc B cells, did not
stimulate anti-topo I Ab production by B cells from healthy
controls D1 or D2, although these clones showed topo I-specific
proliferation in the cultures with EBV-transformed B cells from D1 and
D2 (data not shown). Anti-topo I Ab was not detected even when 3
x 106 (10 times more) B cells from the healthy
control D1 were used (data not shown). These results indicate that topo
I-specific T cells from anti-topo I-positive SSc subjects as well
as those from healthy individuals can drive anti-topo I Ab
production from SSc B cells, and that circulating B cells capable of
producing IgG anti-topo I Ab were present only in anti-topo
I-positive SSc subjects.
|
Seven topo I-specific T cell clones (T1-3, T2-4, T2-5, T2-6, T2-7,
D2-5A, and D3-5) were able to induce anti-topo I Ab production from
HLA-DR-matched SSc B cells, but four clones (T1-1, T2-3, D1-1, and
D2-24) were not. When the cytokine profiles of topo I-specific T cell
clones were compared according to their ability to drive anti-topo
I Ab production (Table I
), it was evident that the seven clones that
provided help to SSc B cells expressed IL-6 mRNA, whereas none of four
clones lacking the helper function expressed IL-6 mRNA. In particular,
the five clones (T2-4, T2-5, T2-6, T2-7, and D2-5A) that induced large
amounts of anti-topo I Ab (>0.1 OD405) had
the highest signal for IL-6 mRNA (Fig. 1
and Table I
), although the PCR
products were not quantitated. Using an ELISA we found that these five
clones secreted detectable levels of IL-6 into supernatants upon PHA
stimulation (306, 788, 512, 526, and 182 pg/ml, respectively), whereas
IL-6 was not detected in the supernatants of the remaining clones.
Therefore, IL-6 secreted by topo I-specific T cell clones appeared to
be involved in the activation of B cells to produce anti-topo
I Ab.
All except two topo I-specific T cell clones expressed IL-2 mRNA, and the remaining two clones, T2-4 and T2-7, induced anti-topo I Ab production if IL-2 was added to the cultures, suggesting that endogenous or exogenous IL-2 was also necessary for helper function. No additional relationships were found between the helper function and cytokine mRNA expression, including those of IL-4 and IL-10.
Effect of IL-6 neutralization on anti-topo I Ab production
To further examine the role of IL-6 in the production of
anti-topo I Ab, the effect of IL-6 neutralization by anti-IL-6
mAb was tested. B cells from anti-topo I-positive SSc subject T2
were cultured with the topo I-specific T cell clones T2-4, T2-6, and
D2-5A (Fig. 2
). Anti-IL-6 mAb inhibited
anti-topo I Ab production in a dose-dependent fashion, reaching a
plateau at a concentration of 25 µg/ml, and isotype control mouse
IgG1 mAb (25 µg/ml) had no effect. The maximal inhibitions observed
at 25 µg/ml of anti-IL-6 mAb in cultures of T2-4, T2-6, and D2-5A
were 63, 65, and 70%, respectively, suggesting that B cell activation
is mediated by other factors besides IL-6. As shown in Fig. 2
, anti-topo I Ab production was also blocked by addition of
anti-HLA-DR or anti-CD40L mAb, but not by anti-HLA-DQ mAb,
confirming our previous observations regarding the MHC class II
restriction of this response using bulk PBMC cultures
(13). Similar results were obtained when topo I-specific T
cell clones T2-5, T2-7, and D3-5 were used or when B cells from an
another anti-topo I-positive SSc subject T1 were used (data not
shown).
|
|
To examine whether the inability of some topo I-specific T cell
clones to provide help to SSc subject B cells could be due to the lack
of endogenous IL-6 in the cultures, the effect of exogenous IL-6 on in
vitro anti-topo I Ab production was examined (Fig. 4
). The possible involvement of another
Th2 cytokine, IL-4, in this process was also studied. IL-6 did not
induce anti-topo I Ab production when it was present only during
the initial phase (days 03) of the cultures, but it did induce
anti-topo I Ab production when it was added on day 3, indicating
again that IL-6 promotes anti-topo I Ab production in the late
phase of culture. However, IL-6-induced anti-topo I Ab production
was completely abolished when the cells were cultured with
anti-HLA-DR or anti-CD40L mAb. B cells alone did not produce
anti-topo I Ab when stimulated with IL-4, IL-6, or IL-4 and IL-6 in
combination (data not shown). When serial concentrations (0.25 ng/ml)
of IL-4 or IL-6 were tested (Fig. 5
),
enhancement of anti-topo I Ab production by IL-6 was dose dependent
and reached a plateau at a concentration of 1 ng/ml, whereas IL-4
failed to augment anti-topo I Ab production at any concentration.
Moreover, when both of these cytokines were added together, IL-4 did
not enhance, but instead seemed to inhibit slightly the effects of IL-6
(Fig. 4
). Taken together, these results identify IL-6 as a major B
cell-activating factor produced by autoreactive T cells that promotes
anti-topo I Ab production. In addition, IL-6-induced anti-topo
I Ab production requires both HLA-DR and CD40 engagement in the early
phase of the T-B cell collaboration.
|
|
To examine the role of IL-2 in anti-topo I Ab production, IL-2
was added to the cultures of B cells from an anti-topo I-positive
SSc subject T2 with two T cell clones, T2-4 or T2-7, that lack IL-2
expression (Fig. 6
). IL-2 markedly
augmented anti-topo I Ab production induced by T2-4 and T2-7. IL-2
was required for the entire 10-day culture period for maximal effect.
When IL-2 was added 18 h after the initiation of culture, there
was no stimulation of anti-topo I Ab production (Fig. 6
A). Experiments using serial concentrations of IL-2
(10200 U/ml) showed that a minimal amount of IL-2 (10 U/ml) was
adequate for induction of anti-topo I Ab production and larger
amounts had no additional effect (Fig. 6
B). Similar to their
effects on IL-6 stimulation, anti-HLA-DR and anti-CD40L mAbs
blocked IL-2-induced anti-topo I Ab production. Also shown in Fig. 6
is the finding that anti-IL-6 mAb inhibited IL-2-induced
anti-topo I Ab production, indicating that IL-2 was not able to
induce anti-topo I Ab production without IL-6. Similar results were
obtained with B cells from an additional anti-topo I-positive SSc
subject T1 (data not shown). These results suggest that IL-2 is
essential in the T-B cell collaboration leading to anti-topo I Ab
production, especially in the very early phase of the cultures.
|
Our results indicated that both IL-2 and IL-6 are necessary to
induce anti-topo I Ab production by autoreactive B cells from SSc
subjects. To test whether IL-2 or IL-6 secreted by different topo
I-specific T cell clones could synergistically provide help to B cells,
we set up cultures containing B cells from anti-topo I-positive SSc
subject T2 and autologous Th1 (T2-3) and Th2 (T2-4 or T2-7) clones in
various ratios (Fig. 7
). Anti-topo I Ab
was detected in the supernatants of cultures containing B cells
incubated with the mixture of clones T2-3 and T2-4 or T2-7, clones T2-4
or T2-7 supplemented with IL-2, and clone T2-3 supplemented with IL-6.
The maximum production of autoantibody was observed when clone T2-3
(Th1) was cultured with either clone T2-4 (Th2) or clone T2-7 (Th2) in
a ratio of 1:2. These results indicate that simultaneous activation of
Th1 and Th2 clones can produce complementary cytokines (IL-2 and IL-6),
leading to the activation of autoreactive B cells. Thus, in contrast to
the well-described antagonism between Th1 and Th2 cells, we observed
synergy between these T cells in promoting autoantibody production.
|
| Discussion |
|---|
|
|
|---|
Our results showed that T cell help resulting in the secretion of IgG anti-topo I Ab is mainly mediated by IL-6, because 1) IL-6 mRNA and protein expression were detected exclusively in topo I-specific T cell clones that were able to drive anti-topo I Ab production; 2) neutralization of IL-6 abolished anti-topo I Ab production; and 3) exogenous IL-6 augmented the helper function of topo I-specific T cell clones lacking IL-6 expression. The cellular origin of IL-6 is not certain, because IL-6 could be secreted by activated B cells in an autocrine or a paracrine pathway (26). However, it is likely that IL-6 is mostly released by activated topo I-specific T cells, because topo I-specific T cell clones lacking IL-6 mRNA and protein expression did not provide help to B cells, but did provide help if exogenous IL-6 was present. In contrast, IL-4, which is reported to be the most efficient differentiation factor of B cells (16), had little effect on anti-topo I Ab production. This result may be due to differences in the modulatory effect of cytokines on the secretion of human Ig depending on the state of B cell differentiation. The circulating B cells producing IgG anti-topo I Ab in our assay system are presumed to be memory B cells, which have already undergone isotype switching and affinity maturation. IL-6 is reported to be a major growth factor for differentiated Ab-secreting B cells (27), although IL-4 is shown to be actively involved in the process of B cell proliferation and isotype switching, especially the IgE response (16, 28).
IL-2 was also necessary for the induction of anti-topo I Ab production in our system, although target cells of the IL-2 were not identified. IL-2 was first reported as a T cell growth factor (29), but was subsequently found to be a major cytokine promoting the growth and differentiation of B cells in humans (17, 30, 31). It is likely that IL-2 is acting primarily to enhance the proliferation and viability of topo I-specific T cells in our experiments, because 1) IL-2 was essential to maintain our topo I-specific T cell clones, similar to the requirements of other Ag-specific T cell clones (32); and 2) IL-2 was essential in the acute phase of T-B cell interaction (<18 h after the cultures were initiated), and this time was the most consistent with Ag-induced T cell proliferation rather than T cell-dependent B cell activation in light of the delayed kinetics of Ab production. However, Lipsky and colleagues have reported that IL-6 augmented B cell differentiation and proliferation only in the presence of IL-2 (17, 33). The possibility that IL-2 is also acting synergistically with IL-6 in driving B cell differentiation and anti-topo I Ab secretion cannot be excluded.
Peripheral blood B cells from systemic lupus erythematosus (SLE) patients are shown to produce polyclonal Ig as well as autoantibodies, including anti-DNA Abs, independent of T cell help (34, 35). Spontaneous production of B cell-stimulating factors such as IL-6 by B cells (36, 37) and constitutive expression of high affinity IL-6R on B cells (38) are proposed to be responsible for the polyclonal B cell hyper-reactivity in SLE. Although it is apparent from these studies and our present work that involvement of IL-6 in autoantibody production is common in both SLE and SSc, the production of anti-topo I Ab by SSc patients B cells required T cell help and was dependent on Ag stimulation. This indicates an important difference between the regulation of autoantibody responses in SLE and SSc, i.e., an Ag-specific immune response in SSc vs a polyclonal immune response in SLE. This hypothesis is further supported by the finding that hypergammaglobulinemia, a common feature in SLE patients, occurs in a minority of SSc patients and is most often found in the setting of overlap conditions (1).
Th cells are divided into Th1 and Th2 subsets according to patterns of cytokine production in response to antigenic stimulation (39). The development of several autoimmune diseases, such as insulin-dependent diabetes mellitus (40), has been shown to be controlled by the Th1, rather than the Th2, phenotype of autoreactive T cells in murine models. Because Th2 cells, which mainly produce IL-4, IL-6, and IL-10, preferentially regulate the humoral immune response, it was presumed that topo I-specific Th2 cells would be primarily involved in anti-topo I Ab responses. However, our results indicate that the T function capable of inducing anti-topo I Ab production was associated with individual cytokine profiles rather than Th1/Th2 phenotypes. Th1-like topo I-specific clones could drive B cells to produce anti-topo I Ab if the cultures were supplemented with IL-6, and this result is consistent with the findings observed in mice (41). In addition, most topo I-specific T cell clones expressed both Th1 and Th2 cytokines, and the patterns of cytokine expression were heterogeneous, supporting the concepts that the human T cell cytokine profile is not controlled by a simple binary switch between two sets of genes, and each cytokine gene expression is regulated independently (42). In addition, our studies support the role for synergy between T cells with complementary cytokine production in regulating B cell function.
A striking finding in this study is that topo I-specific T cells derived from healthy individuals were capable of driving HLA-DR-matched SSc B cells to produce anti-topo I Ab. We recently reported that topo I-specific T cells in anti-topo I-positive SSc subjects and those in healthy controls had similar characteristics, including a predominant CD4+ helper phenotype, restriction by HLA-DR, recognition of major T cell epitope(s) located between aa 276386 of topo I, and a dominant usage of TCR Vß20.1a (18). Taken together, these findings further confirm that there are no substantial differences between topo I-specific T cells between anti-topo I-positive SSc patients and healthy individuals. The only difference we detected was restricted cytokine profiles (Th1 or Th2 cytokines only) in four of seven topo I-specific T cell clones derived from anti-topo I-positive SSc subjects compared with expression of both Th1 and Th2 cytokines (Th0-like) in all eight topo I-specific T cell clones derived from healthy control subjects. It has been shown that naive T cells have the potential to express both Th1 and Th2 cytokines, and the cytokine environment during T cell activation can determine the dominant cytokine profile (43). Taken together with our previous observation that T cells from anti-topo I-positive SSc subjects displayed accelerated topo I-specific proliferative kinetics in vitro (12), this finding strongly suggests that circulating topo I-specific T cells in anti-topo I-positive SSc patients are activated due to ongoing or recent antigenic stimulation in vivo.
In contrast, circulating B cells capable of producing IgG anti-topo I Ab were present only in the peripheral blood of anti-topo I-positive SSc subjects and were absent in healthy controls. A possible explanation for this difference is that topo I-specific B cell precursors are not deleted or anergized in anti-topo I-positive SSc patients as they may be in healthy individuals. However, potentially autoreactive B cells are known to exist in the fetal and neonatal B cell repertoire (44, 45). Furthermore, recent idiotypic analysis of human anti-topo I Abs showed oligoclonal and preferential VH gene utilization in B cells producing anti-topo I Ab, suggesting activation of a limited B cell population (46). Because B cells producing anti-topo I Ab in our assay system are memory B cells, which have been already activated by antigenic stimulation and T cell help in vivo, it is more likely that topo I-specific precursor B cells exist in both anti-topo I-positive SSc patients and healthy individuals but are activated only in anti-topo I-positive SSc patients, like topo I-specific T cells.
Sercarz et al. (47) proposed a concept that relatively large number of T cells specific for cryptic self-determinants, which are generated at subthreshold levels in the thymus in normal circumstances, are present in the normal T cell repertoire (reviewed in Ref. 48). When cryptic determinants are presented at high concentrations, T cells reactive with self proteins are activated and subsequently cause an autoimmune B cell response because B cell tolerance is mainly dependent on T cell tolerance (16). Since our current and previous studies (12, 13) have shown that topo I-responsive T and B cells are components of the normal immune repertoire and are activated in vivo exclusively in anti-topo I-positive SSc patients, it is possible that the expression of cryptic determinants of topo I, which may be associated with the pathogenesis of SSc, is responsible for activation of topo I-specific immune responses in anti-topo I-positive SSc patients. It has been shown that altered self protein, including complex formation with other proteins and post-translational protein modifications, can elicit autoreactive T and B cell responses in animal models (49, 50). In this regard, the complex of topo I with viral proteins (51, 52) or heat shock proteins (53) as well as cleavage of topo I in a metal-catalyzed oxidation reaction (54) have been reported and lend support to this mechanism for breaking self tolerance. Alternatively, protection of topo I by binding to other proteins (53) could generate cryptic peptides and initiate an autoimmune response to topo I, because peptides derived from topo I may not be processed and presented effectively via the MHC class II pathway under normal circumstances because it is a nuclear protein and extremely sensitive to proteolytic degradation (55).
In summary, our results demonstrated that IL-6 and IL-2, secreted by activated topo I-specific T cells in conjunction with MHC/peptide-TCR and CD40-CD40L interactions, mediate T-B cell collaboration, resulting in anti-topo I Ab responses. In addition, the absence of serum anti-topo I Ab in healthy individuals may be due to the lack of memory B cells capable of producing IgG anti-topo I Ab and not to the lack of topo I-specific T cells. These studies further define the mechanisms that regulate topo I-specific T and B cell responses, a process that will probably provide clues to the pathogenesis of SSc and other autoimmune diseases.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Institute for Advanced Medical Research, Keio University School of Medicine, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan. ![]()
3 Address correspondence and reprint requests to Dr. Timothy M. Wright, Division of Rheumatology and Clinical Immunology, Department of Medicine, University of Pittsburgh School of Medicine, BST South 711, Pittsburgh, PA 15261. ![]()
4 Abbreviations used in this paper: SSc, systemic sclerosis; CD40L, CD40 ligand; MBP, maltose binding protein; topo I, DNA topoisomerase I; PWM, pokeweed mitogen; SLE, systemic lupus erythematosus. ![]()
Received for publication August 17, 1999. Accepted for publication March 28, 2000.
| References |
|---|
|
|
|---|
ß usage by autoreactive T cell clones specific for DNA topoisomerase I: recognition of an immunodominant epitope. J. Immunol. 158:485.[Abstract]
in human B cell activation, growth and differentiation. Eur. J. Immunol. 16:825.
This article has been cited by other articles:
![]() |
H. Takahashi, M. Amagai, T. Nishikawa, Y. Fujii, Y. Kawakami, and M. Kuwana Novel System Evaluating In Vivo Pathogenicity of Desmoglein 3-Reactive T Cell Clones Using Murine Pemphigus Vulgaris J. Immunol., July 15, 2008; 181(2): 1526 - 1535. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Tulunay, S Yavuz, H Direskeneli, and E Eksioglu-Demiralp CD8+CD28-, suppressive T cells in systemic lupus erythematosus Lupus, July 1, 2008; 17(7): 630 - 637. [Abstract] [PDF] |
||||
![]() |
H. Yasuoka, H. Ihn, T. A. Medsger Jr, M. Hirakata, Y. Kawakami, Y. Ikeda, and M. Kuwana A Novel Protein Highly Expressed in Testis Is Overexpressed in Systemic Sclerosis Fibroblasts and Targeted by Autoantibodies J. Immunol., December 15, 2003; 171(12): 6883 - 6890. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kuwana, Y. Kawakami, and Y. Ikeda Suppression of autoreactive T-cell response to glycoprotein IIb/IIIa by blockade of CD40/CD154 interaction: implications for treatment of immune thrombocytopenic purpura Blood, January 15, 2003; 101(2): 621 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Veldman, A. Stauber, R. Wassmuth, W. Uter, G. Schuler, and M. Hertl Dichotomy of Autoreactive Th1 and Th2 Cell Responses to Desmoglein 3 in Patients with Pemphigus Vulgaris (PV) and Healthy Carriers of PV-Associated HLA Class II Alleles J. Immunol., January 1, 2003; 170(1): 635 - 642. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Ascherman, T. B. Oriss, C. V. Oddis, and T. M. Wright Critical Requirement for Professional APCs in Eliciting T Cell Responses to Novel Fragments of Histidyl-tRNA Synthetase (Jo-1) in Jo-1 Antibody-Positive Polymyositis J. Immunol., December 15, 2002; 169(12): 7127 - 7134. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kodama, T. Hirotani, Y. Suzuki, S. Ogawa, and K. Yamazaki Cardiomyogenic Differentiation in Cardiac Myxoma Expressing Lineage-Specific Transcription Factors Am. J. Pathol., August 1, 2002; 161(2): 381 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Arai, K. Yoshida, J. Kaburaki, H. Inoko, Y. Ikeda, Y. Kawakami, and M. Kuwana Autoreactive CD4+ T-cell clones to {beta}2-glycoprotein I in patients with antiphospholipid syndrome: preferential recognition of the major phospholipid-binding site Blood, September 15, 2001; 98(6): 1889 - 1896. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kuwana, J. Kaburaki, H. Kitasato, M. Kato, S. Kawai, Y. Kawakami, and Y. Ikeda Immunodominant epitopes on glycoprotein IIb-IIIa recognized by autoreactive T cells in patients with immune thrombocytopenic purpura Blood, July 1, 2001; 98(1): 130 - 139. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |