| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Cellular Genetics Unit, Institute of Cellular Pathology, and
Laboratory of Human Molecular Genetics, Institute of Cellular Pathology, Université catholique de Louvain, Brussels, Belgium; and
Ludwig Institute for Cancer Research, Brussels, Belgium
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We have conducted a detailed analysis of the Ags recognized by
autologous CTL on the cells of melanoma patient LB33, who has enjoyed a
very favorable clinical evolution and is alive 12 years after the first
appearance of metastases (Fig. 1
)
(10). From a metastasis resected in 1988, we derived the
clonal cell line MEL.A-1 (11). CTL clones derived from
blood lymphocytes collected in 1990 or 1996 were shown to recognize
seven Ags on MEL.A-1 cells (12). These Ags, LB33-A, B, Ca,
Cb, D, K, and L, were defined with a panel of Ag-loss variants derived
from MEL.A-1 by in vitro selection for resistance to lysis by
autologous CTL clones. Three of these Ags were identified. Ag B,
presented on HLA-B44, is generated by a point mutation in an
ubiquitously expressed gene named MUM-1 (melanoma
ubiquitously mutated) (13). Ags K and L, presented on
HLA-B44 and HLA-C6, respectively, are produced by a single point
mutation in another ubiquitously expressed gene, MUM-2
(12). Two overlapping antigenic peptides contain the same
mutated residue and bind to either HLA-B44 or C6 molecules. The MUM-1
and MUM-2 mutations were found in cDNA prepared from melanoma
metastases resected from patient LB33, indicating that they occurred in
vivo. However, they were not found in the 150 tumor samples of various
histological origins that were tested, suggesting that they are unique
to the LB33 tumor cells. In patient LB33, a role for the
anti-MEL.A-1 CTL response in the clinical evolution of the patient
is suggested by the observation that the cells of MEL.B, a metastasis
that appeared and was resected in 1993, were resistant to all these CTL
because of a partial HLA class I loss resulting in loss of expression
of Ags A, B, Ca, Cb, D, K, and L (10, 11).
|
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The clinical course of melanoma patient LB33 and the characterization of the various LB33-MEL clonal cell lines and Ag-loss variants have been described (10, 11). Melanoma cell line LB33-MEL.A was derived from a s.c. metastasis resected from patient LB33 in 1988, and clonal cell line MEL.A-1 was derived from MEL.A by limiting dilution (11). The tumor cell lines were cultured in Iscove’s medium (Life Technologies, Grand Island, NY) supplemented with 10% FCS (Life Technologies), L-arginine (116 mg/L), L-asparagine (36 mg/L), and L-glutamine (216 mg/L). 293-EBNA-1 cells were cultured in DMEM (Life Technologies) with 10% FCS. TNF-sensitive WEHI-164c13 cells were cultured in RPMI 1640 medium (Life Technologies) with 5% FCS (14).
Blood mononuclear cells of patient LB33 were isolated by Lymphoprep (Nycomed, Oslo, Norway) density-gradient centrifugation and cryopreserved in Iscove’s medium supplemented with 10% human serum (HS)3 and 10% DMSO. HS was prepared from pools of plasma from unselected ABO donors. Plasma was supplemented with CaCl2 and bovine thrombin (ICN Pharmaceuticals, Costa Mesa, CA) and allowed to clot for 3 h at 37°C. After centrifugation, serum was decomplemented (30 min at 56°C), filtered through 0.22-µm pore size filters, and UV inactivated (Viralex procedure, PAA Laboratories, Linz, Austria). CTL clone LB33-CTL-159/3 (11) was derived from a pool of 200 CD8 T cells isolated from blood mononuclear cells collected in March 1990, before the patient received autologous vaccines, and stimulated with irradiated cells of a clonal cell line derived from MEL.A-1 in the presence of IL-2 (30 U/ml) and IL-4 (5 U/ml). The microculture was restimulated each week by the addition of irradiated tumor cells and cytokines. After 7 wk, feeder cells (irradiated allogenic EBV-transformed B cells LG2-EBV) were added for the restimulations.
Construction and screening of the cDNA library
Total RNA was extracted from MEL.A-1 cells using the guanidine
isothiocyanate procedure (15).
Poly(A)+ RNA was enriched with an
oligo(dT)-cellulose column (Pharmacia Biotech, Uppsala, Sweden) and
converted to cDNA with the Superscript Choice System (Life
Technologies, Gaithersburg, MD) using an oligo(dT) primer
(5'-ATAAGAATGCGGCCGCTAAACTA(T)18VZ with
V = G or A or C; Z = G or A or T or C) containing a
NotI site. The cDNA was ligated to
HindIII-EcoRI adaptors (Stratagene, Heidelberg,
Germany), phosphorylated, digested with NotI, and inserted
into the HindIII and NotI sites of expression
vector pCEP4 (Invitrogen, San Diego, CA). Escherichia coli
DH5
were transformed by electroporation with the recombinant
plasmids and selected with ampicillin (50 µg/ml). The library was
divided into 528 pools of about 100 cDNA clones. Each pool was
amplified for 4 h, and plasmid DNA was extracted using the QIAprep
8 plasmid kit (Qiagen, Hilden, Germany). 293-EBNA-1 cells (4 x
104/microwell) were cotransfected with 1.5 µl
of Lipofectamine (Life Technologies), 200 ng of DNA from a pool of the
cDNA library, and 50 ng of plasmid pcDNA3 containing an HLA-A*68012
(HLA-A28) cDNA isolated from MEL.A-1 cells. Transfected cells were
tested after 24 h for expression of the Ag in a CTL stimulation
assay. Briefly, CTL were added, and the TNF content of the supernatant
was measured 24 h later by testing its cytotoxic effect on
WEHI-164cl3 cells (14) with a
3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide
colorimetric assay (16).
Sequence analysis and gene expression
cDNA clone 4B was sequenced with the dideoxy chain termination method (Thermosequenase cycle sequencing kit, Amersham, Aylesbury, U.K.). The computer search for sequence homology was performed using the program available at http://www.ncbi.nlm.nih.gov/blast/blast.cgi. Sequence alignments were performed with Geneworks software (Intelligenetics, Mountain View, CA).
Expression of gene MUM-3 was tested with RT-PCR using primers OPC415 (5'-GAAGGTGATATCTTTGCCATAGTCTC) and OPC414 (5'-GAACACATTGTTTGACCTTCAGTCC) on total RNA extracted from a collection of about 20 normal tissues, including blood, brain, heart, kidney, liver, lung, muscle, and skin. Conditions for PCR amplification were (98°C for 1 min (94°C for 1 min, 65°C for 2 min, 72°C for 3 min) for 30 cycles, then 72°C for 15 min).
The screening for MUM-3 mutations in other tumor samples was performed on mRNA extracted from the samples and converted to cDNA with Moloney murine leukemia virus reverse transcriptase using an oligo(dT) primer. This cDNA served as the template for a PCR amplification using primers OPC436 (5'-CTACCACCACACATCCTAACAAGATTA) and OPC455 (5'-CCAAGTGAAATCAGCATAGATGCTG). PCR products were purified using QIAquick PCR purification kit (Qiagen, Valencia, CA) and were sequenced using dideoxy chain method in an ABI-310 automated DNA sequencer (Perkin-Elmer Applied Biosystems, Warrington, U.K.).
The GeneBridge 4 radiation Hybrid Panel (Research Genetics, Huntsville, AL) was used to map the MUM-3 gene. Genomic DNA (25 ng) from each of the 93 radiation hybrid clones were PCR amplified with primers OPC436 (5'-CTACCACCACACATCCTAACAAGATTA) and OPC454 (5'-GAGGACAGTCCTTGTGATAGG). PCR amplification was performed for 33 cycles of 1 min at 94°C, for 2 min at 62°C, and for 3 min at 72°C. PCR results were submitted for analysis to the web sites of the Whitehead Institute for Biomedical Research (http://www-genome.wi.mit.edu/cgibin/contig/rhmapper.pl) and of the Genome Database (http://www.gdb.org/gdb).
For the microsatellite analysis, genomic DNA was extracted from MEL.A-1 and from autologous blood lymphocytes using the Qiagen genomic DNA purification kit. PCR amplification was performed on 20 ng of DNA using pairs of primers specific for 55 microsatellites selected from the Weber 8 set (Research Genetics). The forward primer was labeled with 32P, and conditions for PCR amplification were (95°C for 4 min (94°C for 40 min, 55°C for 50 min, 72°C for 50 min) for 30 cycles, then 72°C for 10 min). The PCR products were separated on a 6.5% acrylamide-bisacrylamide gel and revealed by autoradiography on a Biomax film (Eastman Kodak, Rochester, NY).
Localization of the antigenic peptide
Truncated forms of cDNA clone 4B were obtained by digestion with PvuII or HindIII. cDNA 4B served as the template for PCR amplifications of four sequences differing in their 3' ends and covering the region located between the HindIII and PvuII restriction sites. The forward primer was OPC440 (5'-ACCatgACCTACAGGCTCCTG), which contains a Kozak ATG in-frame with the longest open reading frame of cDNA 4B, and reverse primers were OPC414 (5'-GAACACATTGTTTGACCTTCAGTCC), OPC442 (5'-TAGGATCTTCTACCCAAATCCACC), OPC441 (5'-GCTGTGATTGGTAAAGGCTGAAG), and OPC445 (5'-GTCAGCTTGAGGTTGGAATCTC). PCR conditions were (94°C for 5', (94°C for 1 min, 65°C for 2 min, 72°C for 3 min) for 30 cycles, then 72°C for 15 min). Amplification products were cloned into pcR3.1 (Invitrogen, San Diego, CA) using the TA cloning procedure, and the constructs were cotransfected into 293-EBNA-1 cells with the HLA-A28 cDNA clone.
Peptides were synthesized on solid phase using F-moc for transient NH2-terminal protection as previously described (17) and were characterized using mass spectrometry. All peptides were >80% pure, as indicated by analytical HPLC. Lyophilized peptides were dissolved at 10 mg/ml in DMSO, diluted at 1 mg/ml in PBS, and stored at -20°C. Peptides were incubated for 20 min at room temperature with 51Cr-labeled LB33-EBV-B cells. The CTL clone was added at an E:T cell ratio of 10:1, and chromium release was measured after 4 h.
Extraction of genomic DNA from paraffin-embedded tumor tissues
DNA was extracted, using the QIA Tissue extraction kit (Qiagen), from 6-µm slices of tumor samples fixed in Bouin’s fluid and embedded in paraffin. For the ipsilateral inguinal metastatic lymph node from 1987, one or two sections were used. For the primary melanoma sample from 1985, tumoral tissue from five sections was first microdissected from the normal surrounding tissue with a microdissection laser microscope (P.A.L.M. Mikrolaser Technologie, Wolfratshausen, Germany) (18). Regions of the MUM-1, -2, and -3 genes that encode the antigenic peptides were amplified with PCR using the following forward and reverse primers: MUM-1, OPC194 (5'-AGTTTGCCACTGTTTCTCACTGTC) and OPC195 (5'-CAAACTAGTTGCTTTCTCATGAGGTTA); MUM-2, OPC744 (5'-CTCCCACCACCACTTTCTCCT) and OPC712 (5'-GGCCCCAGGCAGACATGAATT); and MUM-3, OPC743 (5'-CAATGTGTTCATCAGATTCCTTCTG) or OPC436 (5'-CTACCACCACACATCCTAACAAGATTA) and OPC455 (5'-CCAAGTGAAATCAGCATAGATGCTG), or OPC797 (5'-CTCTGAAATCCCATTTACAAGTCAG) and OPC798 (5'-TACCTGATCATTCCAAGTGAAATCAG). PCR products were purified using the QIAquick PCR purification kit and sequenced.
Limiting dilution analysis (LDA)
Blood CD3+CD8+
lymphocytes, labeled with anti-Leu 4-FITC and anti-Leu 2a-PE
(Becton Dickinson, Mountain View, CA), were sorted with a FACS-VANTAGE
(Becton Dickinson) flow cytometer and seeded at 600, 400, 266, 177,
118, 79, 52, 36, and 23 cells/well, 96 wells/cell number, in V-bottom
microwells (Nunc, Rosklide, Denmark). They were stimulated by addition
of 5 x 103 irradiated (10,000 rad) MEL.A-1
cells pretreated with 50 U/ml IFN-
(Roche, Mannheim, Germany), in a
final volume of 100 µl of Iscove’s medium supplemented with 10% HS
and 20 U/ml of human rIL-2 (Eurocetus, Amsterdam, The Netherlands; 1
unit/ml is the concentration needed to obtain half-maximal
proliferation of mouse CTLL-2 cells), 5 U/ml of IL-4 (1 U/ml of IL-4
gives half-maximal proliferation of human blood T lymphocytes
stimulation with PHA; rIL-4 is produced in our laboratory), and 5 ng/ml
of rIL-7 (Genzyme, Cambridge, MA). The microcultures were restimulated
on day 6 by addition of 100 µl of fresh medium containing rIL-2 (20
U/ml) and 5 x 103 irradiated MEL.A-1 cells.
On day 12, 100 µl of medium were discarded, and the cells were
transferred into flat-bottom microwells and restimulated by addition of
100 µl of fresh medium with IL-2 and MEL.A-1 cells as on day 6. On
day 18, the microcultures were duplicated and restimulated as before.
On day 23, the cells were tested for lytic activity. From one set of
microcultures, four aliquots of cells were collected and added to 1,000
51Cr-labeled target cells. The other set of
microcultures was kept for further restimulation and a second lysis
assay to confirm the first results. The numbers of effector cells in
the lysis assays ranged from 3,000 to 15,000/test.
Tetramer analysis
An HLA-A*68012 cDNA clone from MEL.A-1 cells was used as a
template to amplify the sequence coding for the extracellular domains
(aa 1–276 of the mature protein) of the HLA-A28 heavy
chain with primers OPC782
(5'-AGAAGGAGATATACCATGGGtTCaCACagtATGcgcTATTTtTACACtTCCGTGTCCCGG)
and OPC761
(5'-GGGCTGGGAAGATTCGAAGATGTCGTTCAGACCACCACCCGGCTCCCATCTCAGGGTGAGG).
OPC782 contains several base changes (small letters) designed to
optimize protein expression in E. coli BL21(DE3)pLysS. The
PCR product was digested with NcoI and SfuI, and
cloned into a vector derived from pET3D (Stratagene) and
containing a BirA biotinylation site in-frame with the 3' end of the
HLA sequence. Recombinant HLA-A*68012 molecules were folded in vitro
with ß2m (pHN1-ß2m,
provided by P. Moss, Oxford University, Oxford, U.K.) and MUM-3 peptide
as previously described (19). Soluble complexes were
purified by gel filtration and biotinylated using the BirA enzyme
(Avidity LCC, Denver, CO). PE-labeled tetramers were produced by mixing
the biotinylated complexes with Extravidin-PE (Sigma, St. Louis, MO).
Blood mononuclear cells collected from patient LB33 in 1996 were
labeled with an anti-CD8 Ab coupled to allophycocyanin (1/20;
Becton Dickinson) and with the PE-labeled MUM-3 tetramers (0.2 µM
final). CD8+ MUM-3 TCR+
cells were seeded at one cell per well in flat-bottom nanowells, using
the FACS-VANTAGE. They were stimulated with 2 x
103 irradiated (10,000 rad) MEL.A-1 cells,
pretreated with 50 U/ml of IFN- for 48 h, 2 x
104 irradiated (10,0000 rad) blood mononuclear
cells from three donors, and 2 x 104
(10,0000 rad) irradiated LG2-EBV-B cells (A24-A32-B35-B44-C4) in a
final volume of 80 µl of Iscove’s medium supplemented with 10% HS,
100 U/ml of rIL-2, 5 U/ml of rIL-4, and 100 U/ml of rIL-6 (1 U/ml of
IL-6 is the concentration needed to obtain half-maximal proliferation
of mouse 7TD1 cells) (20). Recombinant IL-6 was used in
this experiment, but similar results were obtained with rIL-7 (5
ng/ml). On day 12, 40 µl of medium was discarded, and the lymphocytes
were restimulated by addition of 40 µl of the same mixture of
stimulator, feeder cells, and growth factors as on day 0.
TCR Vß usage was assessed by RT-PCR and sequencing. cDNA served as a template for a PCR amplification using a panel of Vß-specific forward primers and one reverse Cß primer (21, 22). The PCR products were purified and sequenced.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Clonal melanoma cell line MEL.A-1 was derived from a metastasis
resected from patient LB33 in 1988. Autologous CTL clone 159/3,
directed against Ag LB33-A, specifically lysed MEL.A-1, but not the
Ag-loss variant MEL.A-1.1, which is still recognized by the other CTL
clones (11). Another Ag-loss variant, MEL.A-1.4, which had
been selected from MEL.A-1 for resistance to lysis by an anti-D CTL
(11), also proved to resist lysis by CTL 159/3 (Fig. 2A). It had lost expression of
HLA-A28 and C7 molecules. When these cells were transfected with an
HLA-A28 construct, they were recognized by CTL 159/3 (Fig. 2B), indicating that Ag LB33-A was presented by HLA-A28
molecules.
|
C). We concluded that a high
frequency of tumor-specific CTLp was present in the blood of patient
LB33, and that most of them recognized the same Ag. Identification of the gene encoding Ag LB33-A
A cDNA library prepared with mRNA extracted from MEL.A-1 cells was
cloned into expression vector pCEP4, which contains the EBV origin of
replication. About 500 pools of 100 cDNA clones of the library were
cotransfected with the HLA-A28 construct into 293-EBNA1 cells. After
24 h, the transfectants that expressed Ag LB33-A were
detected by their capacity to stimulate the production of TNF by CTL
159/3. One pool of cDNA proved positive. It was subcloned and a cDNA
clone of 4.5 kb, named 4B, was isolated (Fig. 3A). A stable transfectant
derived from the Ag-loss variant MEL.A-1.1 was also recognized by CTL
159/3 (Fig. 3B).
|
Identification of the MUM-3 antigenic peptide
Transfections of truncated forms of cDNA 4B indicated that the
sequence coding for the antigenic peptide was located between nt 626
(HindIII) and 1267 (PvuII) of the cDNA (Fig. 4A). With a set of minigenes
covering this region, the portion of cDNA encoding the Ag was narrowed
down to a 153-bp sequence. This region contains four peptides of nine
residues with a basic amino acid in position 9, as usually found in
peptides that bind to HLA-A*68012 molecules, the HLA-A28 subtype of
patient LB33 (24, 25). One peptide, EAFIQPITR, sensitized
autologous EBV-transformed B cells to lysis by CTL 159/3, with a
half-maximal effect at 1 nM (Fig. 4B).
|
T
mutation was also found in a tumor sample from patient LB33, indicating
that it did not occur in vitro. C to T transition at a dipyrimidine
site, as is the case here, is a classical mutation induced by UV
irradiation (26). Both the normal and the mutated
sequences were found in DNA of MEL.A-1 cells, indicating that the tumor
is heterozygous. MUM-3 fragments corresponding to nt 600–900 of cDNA
4B were amplified by PCR from reverse transcribed mRNA of 150 tumor
samples of various histological origins and sequenced. No mutation was
found in this region of gene MUM-3.
The mutation changes a serine (TCC) into phenylalanine (TTC) at
position 3 of the antigenic peptide recognized by CTL 159/3. The normal
peptide, EASIQPITR, does not sensitize autologous EBV-B cells to lysis
by CTL 159/3, even at 100 nM (Fig. 4B). A competition assay
indicated that the normal peptide binds very poorly to HLA-A28
molecules, suggesting that the phenylalanine residue is part of the
aggretope of the peptide.
Multiple antigenic mutations in the LB33 melanoma cells
Gene MUM-3 contains the third antigenic mutation that
is found in the melanoma cells of patient LB33; we previously described
two other genes, MUM-1 and MUM-2, that also
contain a point mutation leading to the expression of a tumor Ag
recognized by autologous CTL (12, 13). We therefore
considered that the antigenicity of these tumor cells, which may have
determined the very favorable clinical evolution of the patient,
resulted from the presence of an unusually high number of mutations.
The first explanation for the accumulation of mutations could be a
defect in the DNA repair mechanisms. One of them, the mismatch DNA
repair system, corrects errors made by DNA polymerase during
replication. A defect in this DNA repair system results in
microsatellite instability, namely variations in the lengths of small
repetitive regions (microsatellites) in the genome. The lengths of 55
microsatellites were compared in DNA extracted either from MEL.A-1
cells or from autologous blood lymphocytes (Table I). No difference was found, suggesting
that this DNA repair system functions normally in LB33 melanoma cells.
Interestingly, the tumor cells showed loss of heterozygosity for four
markers, two of which are located on chromosome 9 around the p16 locus,
which is frequently altered in melanomas (27, 28, 29).
|
Analysis of the anti-MUM-3 T cell response with soluble HLA-peptide complexes
To obtain more information on the frequency of the anti-MUM-3
T lymphocytes in patient LB33, we made use of multimeric soluble
MHC-peptide complexes to specifically label these T cells. This type of
reagent has proven to be a specific and sensitive tool to enumerate
Ag-specific T lymphocytes (19, 30). Soluble recombinant
HLA-A28 molecules were folded with the mutated MUM-3 peptide,
biotinylated, and multimerized with avidin conjugated to PE. Even
though their m.w., estimated by gel filtration, showed that these
complexes contained more than four HLA molecules, we will refer to them
as tetramers. The MUM-3 tetramers labeled CTL 159/3, but not CTL 202/1,
which is also restricted by HLA-A28 molecules but recognizes the LB33-D
Ag (Fig. 5A).
|
B). To
assess the specificity of the tetramer staining, blood lymphocytes from
four HLA-A28 donors were labeled with MUM-3 tetramers. No staining was
observed. The tetramer-positive cells of patient LB33 were also seeded
at one cell per well, and the presence of a cell was confirmed visually
in 80% of the wells. The lymphocytes were stimulated with irradiated
MEL.A-1, feeder cells, IL-2, IL-4, and IL-6. After 3 wk, clonal
populations of more than a million cells, corresponding to at least 20
divisions, were present in 87% of the wells that initially contained
one cell. Most (58 of 60) of these clones were labeled with the MUM-3
tetramer. Their lytic activity was tested against MEL.A-1 and against
autologous EBV-B cells incubated with the mutated or the normal MUM-3
peptide. All clones were lytic and displayed the same specificity as
CTL 159/3. We conclude that the majority of the tetramer-positive blood
CD8 cells were indeed anti-MUM-3 CTL or CTLp, and that these cells
appeared functional, in so far as they could be restimulated in vitro
with Ag and growth factors. The diversity of the anti-MUM-3 CTL response was analyzed. Most clones (53 of 57) expressed the same TCR Vß-chain, with a (Vß6.5-Jß2.5) rearrangement. The four other anti-MUM-3 clones expressed totally different TCR ß-chains, using Vß7.3, Vß9.1, Vß9.3, or Vß13.1 gene segments.
We followed the frequency of MUM-3-specific CD8 cells in blood samples
collected from patient LB33 between 1990 and 1998. The frequency was
0.4% in 1990 and remained stable at around 1% from 1991 to 1998
(Fig. 1).
Improving the detection of precursors of anti-MUM-3 CTL
In LDAs when the lymphocytes were stimulated for 3 wk with MEL.A-1
cells and growth factors, 0.15% of the blood CD8 T cells collected
from patient LB33 in 1990 were enumerated as anti-MUM-3 (Fig. 2C). Similar frequencies were obtained in limiting dilution
experiments with lymphocytes collected in 1996. Using the tetramers,
the frequency of anti-MUM-3 T cells increased by a factor of 8,
reaching 1.2% of CD8 cells in 1996 (Fig. 5B). That LDA
estimates are lower than enumeration with tetramers was reported in
previous studies on murine and human CTL responses (31, 32). This difference could result from the fact that a fraction
of the anti-MUM-3 T lymphocytes either were terminally
differentiated and unable to proliferate, or could not differentiate
into CTL detected at the end of the LDA. Considering that most of the
tetramer-positive cells, when restimulated in vitro, proliferated and
differentiated into CTL, we ruled out these hypotheses. Another
possibility was that some of the anti-MUM-3 CTL did not proliferate
in the LDA, either because they were not properly restimulated or
because they underwent apoptosis upon restimulation, a phenomenon known
as activation-induced cell death (33). Finally, some of
the anti-MUM-3 CTL could have escaped detection in the LDA lysis
assay because they constituted too small a proportion of the
lymphocytes in microcultures that also contained several other
proliferating clones.
When comparing the protocols of in vitro restimulation that we used in
the LDA and tetramer cloning assays, we observed that the major
difference was the presence, in the latter assay, of feeder cells
consisting of a mixture of irradiated allogeneic EBV-B cells and
irradiated allogeneic blood mononuclear cells. In preliminary
experiments we had observed that when tetramer-positive cells were
sorted and stimulated with MEL.A-1 without feeder cells, they
proliferated for a few days and then stopped dividing. To test whether
the addition of feeder cells could improve the LDA assay, microcultures
were set up with various numbers of CD8 blood lymphocytes, from 1996,
stimulated every 6 days with MEL.A-1 cells and growth factors (IL-2,
IL-4, and IL-7) in the presence or absence of irradiated autologous
blood mononuclear cells. We could not use allogeneic feeder cells as in
the tetramer cloning assay, because these cells would stimulate
alloreactive T cells. On day 27, we counted the wells containing living
cells and calculated the frequencies of precursors of proliferating CD8
T cells in the assay (1/60 and 1/34 in the absence or the presence of
feeder cells, respectively; Fig. 6). In
addition, we observed that on the average, more cells (3- to 5-fold)
were present in microcultures containing feeder cells.
|
). The anti-MUM-3 CTLp frequencies were 1/380 among CD8
cells without feeder cells and 1/120 in the presence of feeder cells, a
frequency now comparable to that (1.2% of CD8 cells) observed by
labeling blood cells from 1996 with the tetramers (Fig. 5B). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Among the 20 reported mutated Ags that are recognized by tumor-specific
CTL, it is remarkable that MUM-3 is not the first helicase; a mutated
murine helicase, named p68, was found to encode an Ag recognized by CTL
on a UV-induced sarcoma (37). p68 contains a DEAD motif
and is probably also an RNA helicase. In addition, a search for genes
that are specifically expressed in tumors recently lead to the
identification of a new gene, which was named HAGE, that
codes for a putative helicase containing a DEAD motif (V. Martelange et
al., manuscript in preparation). It is possible that the MUM-3 and p68
mutations contribute to tumor development, given that mutations in
human helicase genes are found in cancer-prone syndromes such as
xeroderma pigmentosum (38, 39), Bloom’s syndrome
(40), Werner’s disease (which is characterized by
premature aging) (41, 42), X-linked mental retardation
associated with -thalassemia (43), and Cockayne’s
syndrome (38, 44). All the helicases implicated in these
diseases are involved in DNA repair mechanisms.
The frequency of anti-MUM-3 T cells in the blood of patient LB33 is remarkably high, whether it is measured with tetramers or with an optimized protocol of in vitro restimulation with autologous tumor cells in limiting dilution conditions. Considering that the blood contains only 2% of all the lymphocytes present in one individual (45), that 1 ml of blood contains 106 mononuclear cells, and that in patient LB33 20% of these cells are CD8, the total number of anti-MUM-3 CTL in patient LB33 is 6 x 108. Similar or even higher (up to 10% of CD8 cells) frequencies were reported for T cells recognizing EBV, HIV, or HTLV-1 epitopes, suggesting that such frequencies are not exceptional (32, 46, 47). Less information is available concerning the frequencies of blood CD8 T cells that recognize tumor cells. One melanoma patient was reported with a high frequency (2%) of CD8 blood cells labeled with a tetramer containing a tyrosinase peptide (48), but these cells appeared anergic, in so far as they failed to lyse the appropriate target cells in vitro and did not produce cytokines. Frequencies of anti-Melan-A/MART-1 lymphocytes ranging between 0.01 and 0.7% of blood CD8 T cells were found in melanoma patients and, surprisingly, also in healthy donors (48, 49, 50, 51). When these cells were sorted and restimulated in vitro, proliferation was observed, and the responding cells displayed a Melan-A-specific lytic activity. This indicates that at least some of the circulating CD8 cells labeled with Melan-A tetramers are not anergic. All these results concern T cells that recognize antigenic peptides that are not tumor specific but are encoded by genes expressed in melanocytes and melanomas. It may not be a coincidence that such anti-melanocyte T cells are found in healthy individuals and that some of them appear to be nonfunctional in vivo.
The anti-MUM-3 T cells of patient LB33 participate in the first strong CTL response documented that is directed against a strictly tumor-specific Ag. The population of circulating anti-MUM-3 CTL is large and stable over time. A high frequency of anti-MUM-3 T cells was already present in 1990, before the patient received the first injections of irradiated autologous tumor cells. It is possible that the high doses of IL-2 that the patient received in 1988 and 1989 participated in the expansion of the anti-MUM-3 response, but this hypothesis cannot be evaluated because of the absence of lymphocytes collected before 1990. The frequency of anti-MUM-3 CTL appeared to remain stable between 1991 and 1998, suggesting that the CTL were regularly restimulated in vivo, either by a clinically undetectable number of tumor cells, by the irradiated MEL.A-1 cells that were regularly injected as an autologous vaccine, or by a cross-reactive Ag. A databank search found peptide EATIQEITR, which shares seven of nine residues with the mutated MUM-3 peptide, in the sequence of the acyl-coenzyme A synthetase of Mycobacterium tuberculosis, against which patient LB33 was immunized, but this peptide was not recognized by the anti-MUM-3 CTL clones.
The vast majority (93%) of the anti-MUM-3 CTL express the same Vß6.5 TCR, and this dominance of one clone was maintained between 1990 and 1998. The most likely explanation, which we proposed for the CTL response against Ags of the murine mastocytoma cells P815 (52), is that the dominance was installed when the first anti-MUM-3 CTLp, which happened to express a Vß6.5 TCR, was stimulated and started to proliferate well before other anti-MUM-3 CTLp. The dominance was then maintained at each immunization with the autologous tumor cells because the increased frequency of the Vß6.5 CTL decreases the probability that other anti-MUM-3 CTLp could be restimulated before the clearance of the Ag.
The MEL.B cells, derived from a metastasis removed from the patient in
1993, lost the expression of several HLA class I genes, rendering them
resistant to all the anti-MEL.A-1 CTL (11). It is
tempting to believe that the strong anti-MEL.A-1 CTL response
selected the Ag-loss variant MEL.B cells in vivo. However, the
anti-MUM-3 CTL do not appear to have shaped the pattern of Ag
expression on two other metastases that patient LB33 developed in 1994
and 1999 (Fig. 1), because we observed that cell lines derived from
these tumors were sensitive to lysis by anti-MUM-3 CTL. We will try
to understand how these metastases escaped rejection by
anti-MUM-3 CTL.
The strong CTL response of patient LB33 against a mutated tumor Ag is not unique; we recently found that a lung carcinoma patient with a survival exceeding 10 years had 0.5% of his blood CD8 cells labeled with an HLA-A2 tetramer containing a mutated peptide identified in the autologous tumor (V. Karanikas et al., manuscript in preparation). Together, these results indicate that a strong CTL response, measurable in the blood, against a strictly tumor-specific Ag is present in some patients. This contrasts with what has been observed to date in clinical trials with tumor-specific shared Ags encoded by MAGE-A genes. In a recently completed trial, 25 tumor-bearing HLA-A1 melanoma patients received injections of a MAGE-A3 peptide presented by HLA-A1 (53). Tumor regressions were observed in seven patients, and three of these regressions were complete, but no increase in anti-MAGE CTL could be detected in the blood of these patients, including those whose tumor regressed. It is possible that this absence of detectable CTL response results from a modality of immunization that is not very efficient. Our results indicate that it is justified and feasible to evaluate other modalities of immunization against tumor-specific Ags by measuring blood T cell responses with tetramers.
However, it remains to be determined whether a strong tumor-specific T cell response is required for tumor rejection. It is possible that tumor rejection responses are mediated by small numbers of tumor-specific T cells of a type, to be defined, that renders them extremely efficient. This may explain why it has been impossible to date to establish a correlation between tumor and T cell responses in patients vaccinated with tumor-specific or melanocyte differentiation Ags (53, 54, 55). It is worth noting that in these patients the monitored immune responses were those directed against Ags present in the vaccine, leaving open the possibility that strong responses against other Ags developed as a bystander effect of the vaccination. Answering this question will require concomitant analyses of T cell responses in the blood and in regressing tumors of patients responding to vaccination.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Pierre G. Coulie, Cellular Genetics Unit, Institute of Cellular Pathology, Université Catholique de Louvain, avenue Hippocrate 74, UCL 7459, B-1200 Brussels, Belgium.
3 Abbreviations used in this paper: HS, human serum; LDA, limiting dilution analysis.
Received for publication January 3, 2000. Accepted for publication March 17, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-fluorenylmethysoxycarbamylamino-acid on polymide supports: synthesis of substance P and of acyl carrier protein 65–74 decapeptide. J. Chem. Soc. London Perkin Trans. 1:538.
1-w29/Vß1-w24) for the study of human T cell receptor variable V gene segment usage by polymerase chain reaction. Eur. J. Immunol. 22:1261.[Medline]
/ß T-cell receptor repertoire by competitive and quantitative family-specific PCR with exogenous standards and high resolution fluorescence based CDR3 size imaging. J. Immunol. Methods 210:235.[Medline]
This article has been cited by other articles:
|
|
 |
|
  G. Parmiani, A. De Filippo, L. Novellino, and C. Castelli Unique Human Tumor Antigens: Immunobiology and Use in Clinical Trials J. Immunol., February 15, 2007; 178(4): 1975 - 1979. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Udagawa, C. Kudo-Saito, G. Hasegawa, K. Yano, A. Yamamoto, M. Yaguchi, M. Toda, I. Azuma, T. Iwai, and Y. Kawakami Enhancement of Immunologic Tumor Regression by Intratumoral Administration of Dendritic Cells in Combination with Cryoablative Tumor Pretreatment and Bacillus Calmette-Guerin Cell Wall Skeleton Stimulation Clin. Cancer Res., December 15, 2006; 12(24): 7465 - 7475. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sensi and A. Anichini Unique Tumor Antigens: Evidence for Immune Control of Genome Integrity and Immunogenic Targets for T Cell-Mediated Patient-Specific Immunotherapy Clin. Cancer Res., September 1, 2006; 12(17): 5023 - 5032. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Goto, Y. Matsuzaki, S. Kurihara, A. Shimizu, T. Okada, K. Yamamoto, H. Murata, M. Takata, H. Aburatani, D. S.B. Hoon, et al. A new melanoma antigen Fatty Acid-binding protein 7, involved in proliferation and invasion, is a potential target for immunotherapy and molecular target therapy. Cancer Res., April 15, 2006; 66(8): 4443 - 4449. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Somasundaram, R. Swoboda, L. Caputo, L. Otvos, B. Weber, P. Volpe, P. van Belle, S. Hotz, D. E. Elder, F. M. Marincola, et al. Human Leukocyte Antigen-A2-Restricted CTL Responses to Mutated BRAF Peptides in Melanoma Patients. Cancer Res., March 15, 2006; 66(6): 3287 - 3293. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Filaci, M. Fravega, M. Setti, P. Traverso, E. Millo, D. Fenoglio, S. Negrini, F. Ferrera, A. Romagnoli, M. Basso, et al. Frequency of telomerase-specific CD8+ T lymphocytes in patients with cancer Blood, February 15, 2006; 107(4): 1505 - 1512. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Luiten, E. W.M. Kueter, W. Mooi, M. P.W. Gallee, E. M. Rankin, W. R. Gerritsen, S. M. Clift, W. J. Nooijen, P. Weder, W. F. van de Kasteele, et al. Immunogenicity, Including Vitiligo, and Feasibility of Vaccination With Autologous GM-CSF-Transduced Tumor Cells in Metastatic Melanoma Patients J. Clin. Oncol., December 10, 2005; 23(35): 8978 - 8991. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Iwata, T. Fujita, N. Hirao, Y. Matsuzaki, T. Okada, H. Mochimaru, N. Susumu, E. Matsumoto, K. Sugano, N. Yamashita, et al. Frequent Immune Responses to a Cancer/Testis Antigen, CAGE, in Patients with Microsatellite instability-Positive Endometrial Cancer Clin. Cancer Res., May 15, 2005; 11(10): 3949 - 3957. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sensi, G. Nicolini, M. Zanon, C. Colombo, A. Molla, I. Bersani, R. Lupetti, G. Parmiani, and A. Anichini Immunogenicity without Immunoselection: A Mutant but Functional Antioxidant Enzyme Retained in a Human Metastatic Melanoma and Targeted by CD8+ T Cells with a Memory Phenotype Cancer Res., January 15, 2005; 65(2): 632 - 640. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Purev, D. Cai, E. Miller, R. Swoboda, T. Mayer, A. Klein-Szanto, F. M. Marincola, R. Mick, L. Otvos, W. Wunner, et al. Immune Responses of Breast Cancer Patients to Mutated Epidermal Growth Factor Receptor (EGF-RvIII, {Delta}EGF-R, and de2-7 EGF-R) J. Immunol., November 15, 2004; 173(10): 6472 - 6480. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. H. Andersen, J. Fensterle, S. Ugurel, S. Reker, R. Houben, P. Guldberg, T. G. Berger, D. Schadendorf, U. Trefzer, E.-B. Brocker, et al. Immunogenicity of Constitutively Active V599EBRaf Cancer Res., August 1, 2004; 64(15): 5456 - 5460. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. E. Spaner Amplifying cancer vaccine responses by modifying pathogenic gene programs in tumor cells J. Leukoc. Biol., August 1, 2004; 76(2): 338 - 351. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Novellino, N. Renkvist, F. Rini, A. Mazzocchi, L. Rivoltini, A. Greco, P. Deho, P. Squarcina, P. F. Robbins, G. Parmiani, et al. Identification of a Mutated Receptor-Like Protein Tyrosine Phosphatase {kappa} as a Novel, Class II HLA-Restricted Melanoma Antigen J. Immunol., June 15, 2003; 170(12): 6363 - 6370. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Gitelson, C. Hammond, J. Mena, M. Lorenzo, R. Buckstein, N. L. Berinstein, K. Imrie, and D. E. Spaner Chronic Lymphocytic Leukemia-reactive T Cells during Disease Progression and after Autologous Tumor Cell Vaccines Clin. Cancer Res., May 1, 2003; 9(5): 1656 - 1665. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Echchakir, G. Dorothee, I. Vergnon, J. Menez, S. Chouaib, and F. Mami-Chouaib Cytotoxic T lymphocytes directed against a tumor-specific mutated antigen display similar HLA tetramer binding but distinct functional avidity and tissue distribution PNAS, July 9, 2002; 99(14): 9358 - 9363. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Parmiani, C. Castelli, P. Dalerba, R. Mortarini, L. Rivoltini, F. M. Marincola, and A. Anichini Cancer Immunotherapy With Peptide-Based Vaccines: What Have We Achieved? Where Are We Going? J Natl Cancer Inst, June 5, 2002; 94(11): 805 - 818. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Linard, S. Bezieau, H. Benlalam, N. Labarriere, Y. Guilloux, E. Diez, and F. Jotereau A ras-Mutated Peptide Targeted by CTL Infiltrating a Human Melanoma Lesion J. Immunol., May 1, 2002; 168(9): 4802 - 4808. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. F. Greten and J. P. Schneck Development and Use of Multimeric Major Histocompatibility Complex Molecules Clin. Vaccine Immunol., March 1, 2002; 9(2): 216 - 220. [Full Text] [PDF]
|
|
|
|
|
|
D. Valmori, C. Scheibenbogen, V. Dutoit, D. Nagorsen, A. M. Asemissen, V. Rubio-Godoy, D. Rimoldi, P. Guillaume, P. Romero, D. Schadendorf, et al. Circulating Tumor-reactive CD8+ T Cells in Melanoma Patients Contain a CD45RA+CCR7- Effector Subset Exerting ex Vivo Tumor-specific Cytolytic Activity Cancer Res., March 1, 2002; 62(6): 1743 - 1750. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Kiniwa, T. Fujita, M. Akada, K. Ito, T. Shofuda, Y. Suzuki, A. Yamamoto, T. Saida, and Y. Kawakami Tumor Antigens Isolated from a Patient with Vitiligo and T-Cell-infiltrated Melanoma Cancer Res., November 1, 2001; 61(21): 7900 - 7907. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. G. Coulie, V. Karanikas, D. Colau, C. Lurquin, C. Landry, M. Marchand, T. Dorval, V. Brichard, and T. Boon A monoclonal cytolytic T-lymphocyte response observed in a melanoma patient vaccinated with a tumor-specific antigenic peptide encoded by gene MAGE-3 PNAS, August 17, 2001; (2001) 161260098. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. B. Beck-Engeser, P. A. Monach, D. Mumberg, F. Yang, S. Wanderling, K. Schreiber, R. Espinosa III, M. M. Le Beau, S. C. Meredith, and H. Schreiber Point Mutation in Essential Genes with Loss or Mutation of the Second Allele: Relevance to the Retention of Tumor-specific Antigens J. Exp. Med., August 6, 2001; 194(3): 285 - 300. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Karanikas, D. Colau, J.-F. Baurain, R. Chiari, J. Thonnard, I. Gutierrez-Roelens, C. Goffinet, E. V. Schaftingen, P. Weynants, T. Boon, et al. High Frequency of Cytolytic T Lymphocytes Directed against a Tumor-specific Mutated Antigen Detectable with HLA Tetramers in the Blood of a Lung Carcinoma Patient with Long Survival Cancer Res., May 1, 2001; 61(9): 3718 - 3724. [Abstract] [Full Text]
|
|
|
|
|
|
H. Echchakir, F. Mami-Chouaib, I. Vergnon, J.-F. Baurain, V. Karanikas, S. Chouaib, and P. G. Coulie A Point Mutation in the {{alpha}}-Actinin-4 Gene Generates an Antigenic Peptide Recognized by Autologous Cytolytic T Lymphocytes on a Human Lung Carcinoma Cancer Res., May 1, 2001; 61(10): 4078 - 4083. [Abstract] [Full Text]
|
|
|
|
|
|
R. Chiari, G. Hames, V. Stroobant, C. Texier, B. Maillère, T. Boon, and P. G. Coulie Identification of a Tumor-specific Shared Antigen Derived From an Eph Receptor and Presented to CD4 T Cells on HLA Class II Molecules Cancer Res., September 1, 2000; 60(17): 4855 - 4863. [Abstract] [Full Text]
|
|
|
|
|
|
P. G. Coulie, V. Karanikas, D. Colau, C. Lurquin, C. Landry, M. Marchand, T. Dorval, V. Brichard, and T. Boon A monoclonal cytolytic T-lymphocyte response observed in a melanoma patient vaccinated with a tumor-specific antigenic peptide encoded by gene MAGE-3 PNAS, August 28, 2001; 98(18): 10290 - 10295. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
