|
|
||||||||


,
Departments of
*
Pediatrics and
Internal Medicine and
Sealy Center for Molecular Sciences, University of Texas Medical Branch, Galveston, TX 77555
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Although the pathophysiology of RSV-induced airway injury is not well understood, autopsy and in vivo studies suggest that the inflammatory response, triggered by the infection of respiratory epithelial cells, is an essential component (5). IL-8 is known to be a potent chemoattractant and activator for neutrophils, T cells, basophils, and primed eosinophils (reviewed in Ref. 6). High concentrations of IL-8 have been detected in nasal and bronchioalveolar lavage fluids of children with RSV respiratory infections (7, 8) and in middle ear effusions of children with viral otitis media (9). It is therefore likely that this cytokine plays a major role in the recruitment of inflammatory cells to the lung following infection by RSV.
Using the model of infecting well-differentiated lung type II alveolar
epithelial cells (A549), we have previously shown that RSV replication
in airway epithelial cells results in increased IL-8 gene expression
and protein release (10). Nuclear run-on assays have shown
that the enhanced IL-8 synthesis was primarily due to increased gene
transcription. Mutational analysis of the IL-8 promoter demonstrated
that NF-
B binding was absolutely required for RSV- and TNF-induced
IL-8 gene transcription (10, 11). However, the
participation of upstream regulatory elements was not investigated.
Previous studies have shown that regulation of IL-8 gene expression is cell type and stimulus specific (12). The current view on how a cell can respond dynamically to a variety of different stimuli is that combinations of ubiquitous, signal- and tissue-specific activators can be assembled into a nucleoprotein complex called enhanceosome (13). In the enhanceosome model, the arrangement of different activator recognition sites and bound activators generates a network of protein-protein and protein-DNA interactions that is unique to a given enhancer for each stimulus. Each enhanceosome provides a specific activation surface that is chemically and spatially complementary to target surfaces of coactivators and to the basal transcriptional machinery; in this way, they can be recruited to DNA to generate synergistic transcription.
In the few studies performed in alveolar epithelial cells, in which the
regulation of IL-8 gene transcription after RSV infection was examined,
there has been controversy regarding the need for replicating virus, as
well as the promoter region required for IL-8 activation
(14, 15, 16, 17). Therefore, the purpose of this study was to
clarify which promoter elements are involved in regulation of IL-8 gene
transcription following RSV infection and to define whether there are
different requirements from cytokine stimulation. Our results indicate
that NF-
B binding site is not only necessary, but sufficient for
activation of IL-8 transcription after TNF stimulation. In contrast,
IL-8 induction by RSV infection requires the participation of several
additional upstream response elements. Among them we have identified a
previously unrecognized regulatory element, with similarity to the
consensus IFN-stimulated response element (ISRE), that plays an
important role in RSV-activated gene transcription.
| Materials and Methods |
|---|
|
|
|---|
The human Long strain of RSV (A2) was grown in Hep-2 cells and purified by centrifugation on discontinuous sucrose gradients, as described elsewhere (18). The virus titer of the purified RSV pools was 7.58.5 log PFU/ml using a methylcellulose plaque assay. No contaminating cytokines, including IL-1, TNF, IL-6, IL-8, GM-CSF, and IFN, were found in these sucrose-purified viral preparations (19). LPS, assayed using the Limulus hemocyanin agglutination assay, was not detected. Virus pools were aliquoted, quick frozen on dry ice/alcohol, and stored at -70°C until used.
Cell culture and infection of epithelial cells with RSV
A549, human alveolar type II-like epithelial cells (American Type Culture Collection, Manassas, VA), were maintained in F12K medium containing 10% (v/v) FBS, 10 mM glutamine, 100 IU/ml penicillin, and 100 µg/ml streptomycin. Cell monolayers were infected with RSV at multiplicity of infection (MOI) of 1, as described (10). An equivalent amount of a 20% sucrose solution was added to uninfected A549 cells, as control.
Plasmid construction
The 5' deletion constructs of the human IL-8 (hIL-8) promoter were produced by PCR using -1498/+44 hIL-8 luciferase (LUC) reporter plasmid as a template and a downstream oligonucleotide hybridizing from nt +86 to +55 of the LUC cDNA (10). Upstream primers were used to produce 5' deletions at -162, -132, and -99 nt by incorporating a unique BamHI restriction site immediately upstream. The PCR products were restricted with BamHI and HindIII, gel purified, and subcloned into the poLUC reporter vector (11).
Site mutations of the IL-8 RSVRE in the context of -162/+44 hIL-8 promoter were introduced by PCR using the following upstream mutagenic primer (mutations underlined): 5'-ACTCCGTATTTGAGGCCCCCCTCTTCTGTGGAT-3' and the downstream luciferase oligonucleotide: 5'-TTATGTTTTTGGCGTCTTCCATTTTA-3'.
Site-directed mutations of the IL-8 NF-IL6 site in the context of -162/+44 hIL-8 promoter were introduced using the technique of PCR "SOEING" (11) using the following mutagenic primers (mutations underlined): 5'-GCCATCAGCTACGAGTCGTGGAATTTCCTCTGA-3' and 5'-GAAATTCCACGACTCGTAGCTGATGGCCCATCC-3'. For the AP-1 binding site mutation, the primers 5'-GAGTGTGATATCTCAGGTTTGCCCTGA-3' and 5'-CAAACCTGAGATATCACACTTCCTA-3' were used.
Multimeric binding sites were constructed by ligation of three copies
of the NF-
B, 5'-GATCCATCAGCTACGAGTCGTGGAATTTCCTCTA-3'; AP-1,
5'-GATCCGAGTGTGATGACTCAGGTTTGCCCTTTA-3'; and NF-IL6,
5'-GATCCATCAGTTGCAAATCGTTTAATTTCCTCTA-3' DNA sequences (having
previously annealed them to complementary overlapping
oligonucleotides) upstream of the -54 hIL-8 LUC promoter. Before
ligation, 100 pmol of the duplex oligonucleotides were phosphorylated
with T4 kinase and ligated with
T4 DNA ligase, and trimers were isolated by
nondenaturing gel electrophoresis (PAGE).
Plasmids were purified by ion exchange (Qiagen, Chatsworth, CA) or on CsCl gradient and sequenced in their entirety, before transfection, by the dideoxy chain termination method using the Sequenase version 2.0 kit (Amersham, Arlington Heights, IL).
Cell transfection
Logarithmically growing A549 cells were transfected in triplicate in 60-mm petri dishes by DEAE-dextran, as previously described (10). Cells were incubated in 2 ml of HEPES-buffered DMEM (10 mM HEPES, pH 7.4) containing 20 µl of 60 mg/ml DEAE-dextran (Pharmacia) premixed with 6 µg IL-8 LUC reporter plasmid and 1 µg CMV-ß galactosidase internal control plasmid. After 3 h, media was removed, and 0.5 ml of 10% (v/v) DMSO in PBS was added to the cells for 2 min. Cells were then washed with PBS and cultured overnight in 10% FBS/DMEM. The next morning, cells were either infected with RSV at MOI of 1 or stimulated with TNF, 20 ng/ml. At 12 h postinfection or 6 h after TNF stimulation, cells were lysed to independently measure luciferase and ß-galactosidase reporter activity, as previously described (20). Luciferase was then normalized to the internal control ß-galactosidase activity. All experiments were performed in duplicate or triplicate, using at least two different plasmid preparations.
Electrophoretic mobility shift assay (EMSA)
Nuclear extracts of uninfected and infected A549 cells were prepared using hypotonic/nonionic detergent lysis, as previously described (10). To prevent contamination of nuclear extracts with cytoplasmic proteins, isolated nuclei were purified by centrifugation through 1.7 M sucrose buffer A for 30 min, at 12,000 rpm, before nuclear protein extraction. Proteins were normalized by protein assay (Protein Reagent; Bio-Rad, Hercules, CA) and used to bind to duplex oligonucleotides corresponding to the IL-8 RSVRE wild-type (WT) and mutated (MUT; mutations underlined) and to the IL-8 AP-1 binding site: RSVRE (WT), GATCCACCGTATTTGATAAGGAAGAAATAGGAGTGTTA GTGGCATAAACTATTCCTTC TTTA TCC TCACAATCTAG; RSVRE (MUT), GATCCACCGTATTTGATAAGGCCCCCCTCTTCTGTGGAGTGGCATAAACTATTCCGGGGGGAGAAGACACCTCTAG; AP-1, GATCCGAGTGTGATGACTCAGGTTT GCCCTTA GCTCACACTACTGAGTCCAAACGGGAATCTAG.
Nuclear extracts, used for binding to the AP-1 site, were prepared form control and infected A549 cells that have been serum starved, before and throughout the period of infection, for a total of 24 h.
DNA-binding reactions using the RSVRE probe contained 1015 µg total protein, 5% glycerol, 12 mM HEPES, 80 mM NaCl, 5 mM DTT, 1 µg of poly(dA-dT), and 40,000 cpm of 32P-labeled double-stranded oligonucleotide in a total volume of 20 µl. Binding reactions for the AP-1 probe contained 1015 µg total protein, 5% glycerol, 12 mM HEPES, 80 mM NaCl, 5 mM DTT, 5 mM MgCl2, 0.5 mM EDTA, 1 µg of poly(dI-dC), and 40,000 cpm of 32P-labeled double-stranded oligonucleotide in a total volume of 20 µl. The nuclear proteins were incubated with the probe for 15 min at room temperature and then fractionated by 6% nondenaturing PAGE in TBE buffer (22 mM Tris-HCl, 22 mM boric acid, 0.25 mM EDTA, pH 8). In competition assays, 10 pmol of unlabeled competitors were added at the same time of probe addition. After electrophoretic separation, gels were dried and exposed for autoradiography using Kodak XAR film at -70°C using intensifying screens.
Microaffinity isolation assay
A549 cells were labeled overnight with [35S]methionine and [35S]cysteine and harvested to prepare nuclear extracts. Microaffinity purification of proteins binding to RSVRE was performed using a two-step biotinylated (Bt) DNA-streptavidin capture assay (11). In this assay, duplex oligonucleotides were chemically synthesized containing 5' Bt on a flexible linker (Genosys, The Woodlands, TX). Five hundred micrograms of nuclear extracts were incubated with 50 pmol of duplex oligonucleotide in the presence of 8 µg poly(dA-dT) (as nonspecific competitor) in 1000 µl (final volume) of binding buffer (8% (v/v) glycerol, 5 mM DTT, 80 mM NaCl, 12 mM HEPES (pH 7.8), at 4°C for 30 min. One hundred microliters of a 50% slurry of prewashed streptavidin-agarose beads were then added to the sample, and incubated at 4°C for an additional 20 min with gentle rocking. Pellets were washed twice with 500 µl binding buffer, and proteins were eluted from beads with 100 µl of 1 M NaCl. Proteins were desalted on a G50 column and incubated again with the oligonucleotides. The washed pellets were resuspended in 100 µl 1x SDS-PAGE buffer, boiled, and fractionated on a 10% SDS-polyacrylamide gel. After electrophoretic separation, gels were dried and exposed for autoradiography using Kodak XAR film at -70°C using intensifying screens.
In the microaffinity isolation/Western blot assay, RSVRE-binding proteins were isolated from control and 12-h RSV-infected nuclear extracts, as previously described, in the absence or presence of 10-fold molar excess of nonbiotinylated RSVRE WT oligonucleotide. After electrophoresis separation, proteins were transferred to polyvinylidene difluoride membrane for Western blot analysis.
Western immunoblot
Cytoplasmic and nuclear proteins were prepared as previously described, fractionated by SDS-PAGE, and transferred to polyvinylidene difluoride membranes (11). Membranes were blocked with 5% albumin in TBS-Tween and incubated overnight with a rabbit polyclonal Ab to IRF-1 (Santa Cruz Biotechnology, Santa Cruz, CA). For secondary detection, we used a horseradish-coupled donkey anti-rabbit Ab in the enhanced chemiluminescence assay (Amersham).
Statistical analysis
Data from experiments involving multiple samples subject to each treatment were analyzed by the Student Newman Keuls t test for multiple pairwise comparisons.
| Results |
|---|
|
|
|---|
To define the regions of the IL-8 promoter involved in regulating
gene expression after RSV infection or TNF stimulation, A549 cells were
transiently transfected with plasmids containing serial deletions of
the 5' flanking region of the IL-8 gene, linked to the luciferase
reporter gene. A schematic diagram of the promoter is shown in Fig. 1
. We have previously shown that a
-162/+44 nt fragment retains the same RSV and TNF inducibility as
longer fragments of the IL-8 promoter (up to -1.4 kb)
(10). Luciferase activity was measured after 12 h of
RSV infection or 6 h of TNF stimulation, time points that we have
previously shown to correspond to peak reporter gene induction after
each stimulus (10, 11). As shown in the Fig. 2
A, RSV infection induced
luciferase activity of the -162/+44 hIL-8/LUC by 6.7-fold compared
with uninfected cells. Deletion from -162 to -132 nt reduced to half
the inducibility of the luciferase activity (3.7-fold), without
affecting basal activity, suggesting the presence of a positive
regulatory element in this region of the promoter. Further deletion to
-99 nt reduced the basal activity of the promoter by 23-fold and
completely abolished the RSV-induced luciferase activity, indicating
that the sequence between -132 and -99 nt is also critically involved
in IL-8 gene activation by RSV. TNF was also a potent inducer of IL-8
transcription, producing a 35-fold increase of the -162/+44 hIL-8/LUC
(Fig. 2
B). The 5' deletion to -132 nt did not affect the
response of the IL-8 promoter to TNF stimulation. Deletion to -99 nt
did not change the TNF stimulation of the promoter in terms of fold
induction (43-fold), although the overall activity of the promoter was
reduced in proportion to the reduction of the basal
activity. A further deletion to -54 nt instead greatly
diminished, although did not completely abolish, the TNF-induced
luciferase activity, demonstrating that the region from -99 to -54 nt
is required for IL-8 gene activation by TNF. These data indicate a
stimulus-selective role for two regions in the IL-8 promoter upstream
of -99: 1, a region between -132 and -99 nt, that contains a
functional AP-1 binding site; and 2, a region from -162 to -132 nt,
which has not been investigated. Because this latter region functions
as a positive regulatory element only in RSV infection, we term it
RSVRE. Therefore, while the presence of RSVRE and AP-1 binding sites is
necessary for RSV inducibility of the IL-8 promoter, TNF inducibility
of the promoter stimulation mainly requires an intact NF-
B/NF-IL6
binding site.
|
|
We have previously shown that RSV infection as well as TNF
stimulation of A549 cells resulted in increased binding of the subunits
RelA, NF-
B1, and c-Rel to the IL-8 NF-
B site (10, 11). Because the 5' deletion analysis of the promoter showed
that the RSVRE and the region containing an AP-1 binding site are two
important regulatory elements in RSV-induced IL-8 transcription, we
performed EMSA to determine whether RSV infection produced changes in
the abundance of DNA-binding proteins that recognize these two regions
of the IL-8 promoter. As shown in Fig. 3
A, a single nucleoprotein
complex (C3) was formed by sucrose cushion-purified control nuclear
extracts, using the oligonucleotide corresponding to the RSVRE, while
two other complexes, termed C1 and C2, were faintly detected. RSV
infection increased the binding of C1 and C2 starting at 6 h
postinfection, with a peak in binding intensity at 12 h
postinfection. The sequence specificity of the RSVRE
complexes was examined by competition with unlabeled oligonucleotides
in EMSA (Fig. 3
B). C1 and C2 were competed by the WT
oligonucleotide, but not by the MUT one, indicating binding
specificity. Specificity was also shown by the absence of C1 and C2
binding to the radiolabeled RSVRE MUT probe. Analysis of the RSVRE
sequence identified two potential sites for transcription factor
binding: a GATA site between -151 and -147 nt, and a site between
-144 and -132 nt, containing an ISRE-like motif in the sense strand
and a HNF-3b-like motif in the minus strand (21, 22, 23).
Mutation of the GATA site did not affect RSVRE-binding and competition
assays, using oligonucleotides corresponding to consensus sequences of
GATA and HNF binding sites, could not identify the RSVRE as one of
them, as neither site could compete for C1/C2 binding (data not
shown).
|
70 kDa and two of 5055 kDa bind specifically to the
RSVRE WT probe. These proteins were not captured by the Bt RSVRE MUT or
unrelated APRE-M2 probes.
|
|
As analysis of the RSVRE sequence revealed the presence of an
ISRE-like site, we sought to investigate whether RSV infection of A549
cells could activate the viral-inducible transcription factor IRF-1,
which modulates transcription of ISRE-containing genes, such as human
IFN-ß (24). Western blot was performed on cytoplasmic
and sucrose cushion-purified nuclear extracts of A549 cells control and
infected for various length of time. IRF-1 protein was expressed at low
levels in the cytoplasm and nucleus of control cells and was highly
inducible following RSV infection, starting between 3 and 6 h
postinfection, as shown in Fig. 6
.
|
|
To establish precisely the role of the individual cis
elements of the IL-8 promoter in conferring responsiveness to either
RSV infection or TNF stimulation, we introduced site-directed mutations
of these sites in the context of the -162 hIL-8 promoter. These
mutations correspond to sequences known to disrupt binding of the
relevant transcription factor (Fig. 3
) (11). A549 cells
were transiently transfected with the WT and MUT plasmids, and
luciferase activity was measured after 12 h of RSV infection or
6 h of TNF stimulation. As shown in Fig. 8
A, the RSV-induced promoter
activity was reduced to
55% of wild type by site mutations of the
RSVRE site. Mutation of the AP-1 site affected both the basal activity
and the RSV inducibility of the promoter, the latter being reduced to
50%. The NF-IL6 site mutant also showed lower inducibility (60%
reduction) compared with the WT promoter, with no effect on the basal
activity. When we introduced simultaneous mutations of RSVRE and either
the AP-1 or the NF-IL6 binding site, the IL-8 promoter was no longer
inducible following RSV infection. These results suggest that all three
binding sites contribute to IL-8 promoter induction after RSV
infection, and that cooperation among these different sites is required
for full activation of the promoter.
|
B site is sufficient to confer TNF
inducibility to the IL-8 promoter. RSV infection requires the combination of multiple promoter elements to activate transcription
To determine whether these sites could be independently induced by
RSV infection or TNF stimulation, A549 cells were transfected with
reporter genes containing multimers of the IL-8 AP-1, NF-
B, or
NF-IL6 elements ligated upstream of the IL-8 TATA box. As shown in Fig. 9
, activity of the NF-
B multimer was
highly inducible (18-fold) by TNF, whereas the other sites were not
significantly affected by TNF stimulation. Although the AP-1 site was
not TNF inducible, it was strongly induced (
8-fold) by the
diacylglycerol agonist, PMA. In contrast, although RSV infection was
able to activate the -162/+44 hIL-8/LUC expression, it was unable to
stimulate the reporter activity of any isolated multimer. These data
suggest that the NF-
B site is the TNF-inducible element of the IL-8
promoter, whose presence is both necessary and sufficient for
TNF-activated IL-8 gene transcription. They also indicate distinct,
combinatorial requirements for RSV-induced IL-8 transcriptional
activation.
|
|
| Discussion |
|---|
|
|
|---|
Chemokines are a novel class of small cytokines that are able to recruit and activate leukocytes, and therefore have a significant role as potent mediators of immune/inflammatory responses (25). The C-X-C chemokine IL-8, in particular, is likely to play a major role in the pathogenesis of RSV infection because it is a strong chemoattractant for the majority of inflammatory cells present in the cellular infiltrate of RSV-infected lungs (6, 26), and it has been detected in nasal and bronchial lavage fluids of children infected with RSV (7, 8).
We have previously shown that RSV infection and TNF stimulation of
alveolar epithelial cells strongly induce IL-8 gene expression and
protein release (10, 11). The enhanced protein synthesis
was primarily due to increased gene transcription, and both stimuli
required NF-
B activation for gene expression. The mechanisms of IL-8
gene induction have been investigated in a variety of cell types, and
deletion and mutational analysis of the promoter indicates that IL-8
gene is activated in a cell-type and stimulus-specific manner
(12), suggesting that different sets of nuclear factors
might be necessary for IL-8 gene transcription. Because identification
of the pleiotropic mechanisms required for IL-8 promoter activation is
important for rational design of therapeutic agents that can block its
expression in the lung, in this study we performed a detailed analysis
of IL-8 promoter activation in airway epithelial cells comparing two
important proinflammatory stimuli, RSV infection and TNF
stimulation.
Analysis of promoter deletions indicates that the region from nt -99
to +44 is necessary and sufficient for TNF-induced IL-8 transcription.
On the other hand, RSV-induced IL-8 activation requires the
participation of a previously unrecognized response element spanning
from -162 to -132 nt, which we term the RSV response element (RSVRE),
and a previously characterized element spanning -132 to -100 nt,
containing a functional AP-1 binding site. Several studies have
investigated the minimal enhancer region of the IL-8 promoter necessary
to confer the responsiveness to cytokines such as TNF and IL-1. In
human cells derived from fibrosarcoma, astrocytoma, and glioblastoma
tumors, as well as in Hela cells, TNF activates IL-8 through a
cis element encompassing -97 to -69 nt, a region that
contains the NF-IL6 and NF-
B sites (27, 28), similarly
to what we have observed in the alveolar epithelial cells. However, the
presence of these two binding sites is not always sufficient for IL-8
gene activation. An intact AP-1 binding site, located from -126 to
-120 nt, is in fact required for TNF induction of the IL-8 promoter in
gastric cancer cells, hepatoma cells, and Jurkat T cells, as well as in
a lung epithelial cell line (29, 30). These results
suggest that the combination of the minimal enhancer region essential
for TNF-induced IL-8 gene activation differs among cell types, possibly
due to a different distribution of transcription factors or
coactivators of transcription.
Our observation that RSV infection of alveolar epithelial cells
requires the presence of two additional regulatory elements for full
promoter inducibility, compared with TNF stimulation, indicates the
presence of stimulus-specific requirements for IL-8 gene induction
within the same cell type. Previous work in alveolar epithelial cells
has shown similar inducibility of the -132 and -99/+44 IL-8 promoters
after both RSV infection and TNF stimulation (14, 15, 16).
These studies have also shown IL-8 gene induction with inactivated RSV.
In our hands, the UV-inactivated virus is unable to induce IL-8 gene
expression (10), and indeed the deletion of the -162 to
-132 nt region strongly reduces the RSV inducibility of the IL-8
promoter, while a further deletion to -99 nt completely abrogrates it.
The differences of our study compared with the previous ones might be
explained by their use of nonpurified viral preparations, known to be
contaminated by IL-1
and possibly TNF (19), extremely
potent IL-8 and NF-
B stimulants, and by the use in transient
transfection assays of a nonquantitative reporter gene, such as the
chloramphenicol acetyl transferase, in which subtle differences could
be missed (31).
The results of site-directed mutation experiments clearly show that the
RSVRE, AP-1, and NF-IL6 binding sites are all necessary for RSV-induced
activation of the IL-8 promoter, while TNF stimulation requires mainly
an intact NF-
B site. Our data are in agreement with previous studies
showing that AP-1 and NF-IL6 binding sites are important in RSV-induced
IL-8 promoter activity (14, 15). However, our results also
indicate the involvement of a previously unidentified regulatory
element of the IL-8 promoter, the RSVRE, that plays an important role
in activation of IL-8 gene expression during RSV infection. The RSVRE
shows sequence similarity with the consensus ISRE site, and our results
suggest that can bind the transcription factor IRF-1, which is
activated in A549 cells following RSV infection. IRF-1 belongs to a
growing family of transcription factors, the IRFs. To date, 10 members
of this family have been identified, and their expression is either
constitutive and/or inducible after IFN/cytokine stimulation or in
response to viral infection (24). IRF-1 is of particular
interest, as this virus-inducible protein activates IFN-ß, a gene
highly expressed in RSV-infected epithelium (M. Jamaluddin, unpublished
data). Interestingly, on the IFN-ß gene, IRF-1 activates
transcription only when NF-
B is coexpressed (32),
indicating a common mechanism of activation with our studies on IL-8.
Our observation extends the sites that cooperate with IRF-1 to include
NF-IL6 and AP-1. Whether these sites are promoter/context specific or
is a more general requirement of IRF-1 will need further investigation.
Our data also show that IRF-1 is binding within a larger complex with
additional proteins because we observed an unknown 70-kDa protein in
the microaffinity-binding assay (Fig. 4
). Future studies will determine
whether other members of the IRF family, such as IRF-3 and IRF-7, which
have also been shown to play an important role in IFN-ß gene
induction (33), can bind to the RSVRE and regulate IL-8
promoter activation following RSV infection. The RSVRE is not only
stimulus specific, but is possibly also cell type specific, because we
were not able to demonstrate its involvement in IL-8 gene regulation in
a similar model of intestinal epithelial cells infected with rotavirus
(A. Casola, unpublished data).
Several studies have suggested an important role for NF-IL6 in
cytokine-induced IL-8 promoter activation (27, 34, 35).
Our mutational experiments show only a modest reduction of TNF
inducibility of the NF-IL6-MUT -162/+44 IL-8 LUC, suggesting that the
NF-
B site is the major regulatory element in TNF-induced IL-8
activation. Furthermore, we were not able to show NF-IL6 binding after
TNF stimulation, either by gel-shift assay or microaffinity isolation
(11). A possible explanation is that the role of NF-IL6
was tested in the context of the -162/+44 IL-8 promoter. In this
study, other binding sites, such as AP-1, could have redundant activity
and could be used alternatively for NF-IL6 site.
Further evidence that the mechanisms of activation of IL-8 promoter are
different in the RSV infection and TNF stimulation is provided by the
results of transient transfections of IL-8 multimer binding sites.
Although TNF is able to stimulate the reporter activity of plasmids
containing multimers of the NF-
B site, and not of the NF-IL6 and
AP-1 sites, none of the multimers is activated by RSV infection. The
RSV-induced reporter activity is instead partially reconstituted by the
addition of the RSVRE to the uninducible -99/+44 IL-8 promoter,
suggesting again that RSV infection requires a different network of
protein-protein and protein-DNA interactions to activate IL-8 gene
transcription, in comparison with cytokine stimulation. Although both
TNF and RSV can induce NF-
B nuclear translocation and DNA binding,
the ability of NF-
B to transactivate the IL-8 promoter is different
between the two stimuli. This difference in NF-
B activation could be
due to the induction of distinct intracellular signaling pathways
affecting posttranslational modifications of NF-
B and the
recruitment of different coactivators to the IL-8 promoter. The
activity of transcription factors is regulated at multiple levels: the
level of synthesis, subcellular localization, and posttranslational
modifications. RelA/p65 has been shown to be phosphorylated either
constitutively or in an inducible manner by stimuli such as LPS, IL-1,
and TNF (36, 37, 38). This event has been associated with an
increase in p65 transcriptional activity, without modification of
nuclear translocation or DNA-binding affinity, and with increased
association with the coactivators p300/CPB (37).
Our findings that multiple binding sites contribute to the IL-8
promoter induction after RSV infection and that cooperation among these
different sites is required for full activation of the promoter support
the enhanceosome model for IL-8 gene transcription. An enhanceosome is
a nuclear protein complex assembled at a given enhancer, in which
various combinations of ubiquitous, signal- and tissue-specific
activators allow different interactions with coactivators and with the
basal transcriptional machinery, recruiting them to DNA to generate
synergistic transcription (13, 39). In the case of
alveolar epithelial cells, we have demonstrated that NF-
B is
necessary and sufficient for activation of IL-8 transcription after TNF
stimulation. In contrast, IL-8 induction by RSV infection requires the
cooperation of various elements of the promoter. Among them we have
identified a previously unrecognized ISRE-like regulatory element that
plays an important role in RSV-activated IL-8 gene transcription.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. A. R. Brasier, Division of Endocrinology, MRB 8.138, University of Texas Medical Branch, 301 University Boulevard, Galveston, TX 77555-1060. ![]()
3 Abbreviations used in this paper: RSV, respiratory syncytial virus; Bt, biotin (biotinylated); hIL, human IL; HNF, hepatocyte nuclear factor; IRF-1, IFN regulatory factor-1; ISRE, IFN-stimulated responsive element; LUC, luciferase; MOI, multiplicity of infection; MUT, mutated; RSVRE, RSV-responsive element; WT, wild type. ![]()
Received for publication June 10, 1999. Accepted for publication March 21, 2000.
| References |
|---|
|
|
|---|
-induced interleukin-8 transcription in type II pulmonary epithelial cells: dependence on nuclear abundance of Rel A, NF-
B1, and c-Rel transcription factors. J. Biol. Chem. 273:3551.
B and NF-IL-6. J. Infect. Dis. 174:262.[Medline]
B in respiratory syncytial virus-induced interleukin-8 gene expression in airway epithelium. J. Infect. Dis. 177:1275.[Medline]
B activation and interleukin-8 gene expression in A549 cells. J. Virol. 70:9079.[Abstract]
mediates the enhanced expression of intercellular adhesion molecule-1 in pulmonary epithelial cells infected with respiratory syncytial virus. Am. J. Respir. Cell Mol. Biol. 13:602.[Abstract]
B p65) transcription factor: one mechanism for the renin angiotensin system (RAS) positive feedback loop in hepatocytes. Mol. Endocrinol. 10:252.
B and cis-regulatory enhancer binding protein-like factor binding elements inactivating the interleukin-8 gene by pro-inflammatory cytokines. J. Biol. Chem. 265:21128.
B. Mol. Cell. Biol. 13:7191.
and interferon
synergistically induce interleukin 8 production in a human gastric cancer cell line through acting concurrently on AP-1 and NF-
B-like binding sites of the interleukin 8 gene. J. Biol. Chem. 267:22506.
B/rel proteins and interferon regulatory factors. J. Virol. 68:4707.
B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc. Natl. Acad. Sci. USA 90:10193.
B p65 and Fos/Jun transcription factors produces potentiated biological function. EMBO J. 12:3879.[Medline]
B is regulated by the I
B-associated PKAc subunit through a cyclic AMP-independent mechanism. Cell 89:413.[Medline]
B p65 by PKA stimulates transcriptional activity by promoting a novel bivalent interaction with the coactivator CBP/p300. Mol. Cell 1:661.[Medline]
B-dependent transcription by tumor necrosis factor-
is mediated through phosphorylation of RelA/p65 on serine 529. J. Biol. Chem. 273:29411.This article has been cited by other articles:
![]() |
Q. Wang, D. R. Nagarkar, E. R. Bowman, D. Schneider, B. Gosangi, J. Lei, Y. Zhao, C. L. McHenry, R. V. Burgens, D. J. Miller, et al. Role of Double-Stranded RNA Pattern Recognition Receptors in Rhinovirus-Induced Airway Epithelial Cell Responses J. Immunol., December 1, 2009; 183(11): 6989 - 6997. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Liu, H. Li, J. Cepeda, Y. Xia, J. A. Kempf, H. Ye, L. Q. Zhang, and S. Q. Ye Regulation of Inflammatory Cytokine Expression in Pulmonary Epithelial Cells by Pre-B-cell Colony-enhancing Factor via a Nonenzymatic and AP-1-dependent Mechanism J. Biol. Chem., October 2, 2009; 284(40): 27344 - 27351. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okabayashi, S.-i. Yokota, Y. Yoto, H. Tsutsumi, and N. Fujii Fosfomycin Suppresses Chemokine Induction in Airway Epithelial Cells Infected with Respiratory Syncytial Virus Clin. Vaccine Immunol., June 1, 2009; 16(6): 859 - 865. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Castro, D. Kolli, A. Guerrero-Plata, R. P. Garofalo, and A. Casola Cigarette Smoke Condensate Enhances Respiratory Syncytial Virus-Induced Chemokine Release by Modulating NF-kappa B and Interferon Regulatory Factor Activation Toxicol. Sci., December 1, 2008; 106(2): 509 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Bao, D. Kolli, T. Liu, Y. Shan, R. P. Garofalo, and A. Casola Human Metapneumovirus Small Hydrophobic Protein Inhibits NF-{kappa}B Transcriptional Activity J. Virol., August 15, 2008; 82(16): 8224 - 8229. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liao, X. Bao, T. Liu, S. Lai, K. Li, R. P. Garofalo, and A. Casola Role of retinoic acid inducible gene-I in human metapneumovirus-induced cellular signalling J. Gen. Virol., August 1, 2008; 89(8): 1978 - 1986. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Mullan, M. Riley, D. Clarke, A. Tatler, A. Sutcliffe, A. J. Knox, and L. Pang {beta}-Tryptase Regulates IL-8 Expression in Airway Smooth Muscle Cells by a PAR-2-Independent Mechanism Am. J. Respir. Cell Mol. Biol., May 1, 2008; 38(5): 600 - 608. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sillanpaa, P. Kaukinen, K. Melen, and I. Julkunen Hepatitis C virus proteins interfere with the activation of chemokine gene promoters and downregulate chemokine gene expression J. Gen. Virol., February 1, 2008; 89(2): 432 - 443. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Fennewald, E. P. Scott, L. Zhang, X. Yang, J. F. Aronson, D. G. Gorenstein, B. A. Luxon, R. E. Shope, D. W. C. Beasley, A. D. T. Barrett, et al. Thioaptamer decoy targeting of AP-1 proteins influences cytokine expression and the outcome of arenavirus infections J. Gen. Virol., March 1, 2007; 88(3): 981 - 990. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Bentley, D. C. Newcomb, A. M. Goldsmith, Y. Jia, U. S. Sajjan, and M. B. Hershenson Rhinovirus Activates Interleukin-8 Expression via a Src/p110{beta} Phosphatidylinositol 3-Kinase/Akt Pathway in Human Airway Epithelial Cells J. Virol., February 1, 2007; 81(3): 1186 - 1194. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wagoner, M. Austin, J. Green, T. Imaizumi, A. Casola, A. Brasier, K. S. A. Khabar, T. Wakita, M. Gale Jr., and S. J. Polyak Regulation of CXCL-8 (Interleukin-8) Induction by Double-Stranded RNA Signaling Pathways during Hepatitis C Virus Infection J. Virol., January 1, 2007; 81(1): 309 - 318. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. O'Hara, A. Bhattacharyya, R. C. Mifflin, M. F. Smith, K. A. Ryan, K. G.-E. Scott, M. Naganuma, A. Casola, T. Izumi, S. Mitra, et al. Interleukin-8 Induction by Helicobacter pylori in Gastric Epithelial Cells is Dependent on Apurinic/Apyrimidinic Endonuclease-1/Redox Factor-1 J. Immunol., December 1, 2006; 177(11): 7990 - 7999. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nanua, S. M. Zick, J. E. Andrade, U. S. Sajjan, J. R. Burgess, N. W. Lukacs, and M. B. Hershenson Quercetin Blocks Airway Epithelial Cell Chemokine Expression Am. J. Respir. Cell Mol. Biol., November 1, 2006; 35(5): 602 - 610. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. A. Koo, P. McPoland, J. P. Wagoner, O. J. Kane, V. Lohmann, and S. J. Polyak Relationships between Hepatitis C Virus Replication and CXCL-8 Production In Vitro. J. Virol., August 1, 2006; 80(16): 7885 - 7893. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wen, Y. Nong, J. G. Morgan, P. Gangurde, A. Bielecki, J. DaSilva, M. Keaveney, H. Cheng, C. Fraser, L. Schopf, et al. A Selective Small Molecule I{kappa}B Kinase beta Inhibitor Blocks Nuclear Factor {kappa}B-Mediated Inflammatory Responses in Human Fibroblast-Like Synoviocytes, Chondrocytes, and Mast Cells J. Pharmacol. Exp. Ther., June 1, 2006; 317(3): 989 - 1001. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jamaluddin, S. Choudhary, S. Wang, A. Casola, R. Huda, R. P. Garofalo, S. Ray, and A. R. Brasier Respiratory Syncytial Virus-Inducible BCL-3 Expression Antagonizes the STAT/IRF and NF-{kappa}B Signaling Pathways by Inducing Histone Deacetylase 1 Recruitment to the Interleukin-8 Promoter J. Virol., December 15, 2005; 79(24): 15302 - 15313. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Easton, J. B. Domachowske, and H. F. Rosenberg Animal Pneumoviruses: Molecular Genetics and Pathogenesis Clin. Microbiol. Rev., April 1, 2004; 17(2): 390 - 412. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Liu, S. Castro, A. R. Brasier, M. Jamaluddin, R. P. Garofalo, and A. Casola Reactive Oxygen Species Mediate Virus-induced STAT Activation: ROLE OF TYROSINE PHOSPHATASES J. Biol. Chem., January 23, 2004; 279(4): 2461 - 2469. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zimmer, M. Rohn, G. P. McGregor, M. Schemann, K.-K. Conzelmann, and G. Herrler Virokinin, a Bioactive Peptide of the Tachykinin Family, Is Released from the Fusion Protein of Bovine Respiratory Syncytial Virus J. Biol. Chem., November 21, 2003; 278(47): 46854 - 46861. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Melchjorsen, L. N. Sorensen, and S. R. Paludan Expression and function of chemokines during viral infections: from molecular mechanisms to in vivo function J. Leukoc. Biol., September 1, 2003; 74(3): 331 - 343. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. M. Zhu, D. A. Bradbury, L. Pang, and A. J. Knox Transcriptional Regulation of Interleukin (IL)-8 by Bradykinin in Human Airway Smooth Muscle Cells Involves Prostanoid-dependent Activation of AP-1 and Nuclear Factor (NF)-IL-6 and Prostanoid-independent Activation of NF-{kappa}B J. Biol. Chem., August 1, 2003; 278(31): 29366 - 29375. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Strahle, D. Garcin, P. Le Mercier, J. F. Schlaak, and D. Kolakofsky Sendai Virus Targets Inflammatory Responses, as Well as the Interferon-Induced Antiviral State, in a Multifaceted Manner J. Virol., July 15, 2003; 77(14): 7903 - 7913. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Young and G. D. Parks Simian Virus 5 Is a Poor Inducer of Chemokine Secretion from Human Lung Epithelial Cells: Identification of Viral Mutants That Activate Interleukin-8 Secretion by Distinct Mechanisms J. Virol., June 15, 2003; 77(12): 7124 - 7130. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, M. Jamaluddin, S. Wang, B. Tian, R. P. Garofalo, A. Casola, and A. R. Brasier Ribavirin Treatment Up-Regulates Antiviral Gene Expression via the Interferon-Stimulated Response Element in Respiratory Syncytial Virus-Infected Epithelial Cells J. Virol., May 15, 2003; 77(10): 5933 - 5947. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mukaida Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L566 - L577. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Tian and A. R. Brasier Identification of a Nuclear Factor Kappa B-dependent Gene Network Recent Prog. Horm. Res., January 1, 2003; 58(1): 95 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Casola, A. Henderson, T. Liu, R. P. Garofalo, and A. R. Brasier Regulation of RANTES promoter activation in alveolar epithelial cells after cytokine stimulation Am J Physiol Lung Cell Mol Physiol, December 1, 2002; 283(6): L1280 - L1290. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, S. Kartha, S. Iasvovskaia, A. Tan, R. K. Bhat, J. M. Manaligod, K. Page, A. R. Brasier, and M. B. Hershenson Regulation of human airway epithelial cell IL-8 expression by MAP kinases Am J Physiol Lung Cell Mol Physiol, October 1, 2002; 283(4): L690 - L699. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Pazdrak, B. Olszewska-Pazdrak, T. Liu, R. Takizawa, A. R. Brasier, R. P. Garofalo, and A. Casola MAPK activation is involved in posttranscriptional regulation of RSV-induced RANTES gene expression Am J Physiol Lung Cell Mol Physiol, August 1, 2002; 283(2): L364 - L372. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, B. A. Luxon, A. Casola, R. P. Garofalo, M. Jamaluddin, and A. R. Brasier Expression of Respiratory Syncytial Virus-Induced Chemokine Gene Networks in Lower Airway Epithelial Cells Revealed by cDNA Microarrays J. Virol., October 1, 2001; 75(19): 9044 - 9058. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Casola, R. P. Garofalo, H. Haeberle, T. F. Elliott, R. Lin, M. Jamaluddin, and A. R. Brasier Multiple cis Regulatory Elements Control RANTES Promoter Activity in Alveolar Epithelial Cells Infected with Respiratory Syncytial Virus J. Virol., July 15, 2001; 75(14): 6428 - 6439. [Abstract] [Full Text] |
||||
![]() |
M. Nourbakhsh, S. Kalble, A. Dorrie, H. Hauser, K. Resch, and M. Kracht The NF-kappa B Repressing Factor Is Involved in Basal Repression and Interleukin (IL)-1-induced Activation of IL-8 Transcription by Binding to a Conserved NF-kappa B-flanking Sequence Element J. Biol. Chem., February 2, 2001; 276(6): 4501 - 4508. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Casola, N. Burger, T. Liu, M. Jamaluddin, A. R. Brasier, and R. P. Garofalo Oxidant Tone Regulates RANTES Gene Expression in Airway Epithelial Cells Infected with Respiratory Syncytial Virus. ROLE IN VIRAL-INDUCED INTERFERON REGULATORY FACTOR ACTIVATION J. Biol. Chem., June 1, 2001; 276(23): 19715 - 19722. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |