The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boileau, C.
Right arrow Articles by Perreault, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boileau, C.
Right arrow Articles by Perreault, C.
The Journal of Immunology, 2000, 164: 5713-5720.
Copyright © 2000 by The American Association of Immunologists

Regulation of Extrathymic T Cell Development and Turnover by Oncostatin M1

Catherine Boileau*, Magali Houde*, Gaël Dulude*, Christopher H. Clegg{dagger} and Claude Perreault2,*

* Guy Bernier Research Center, Maisonneuve Rosemont Hospital, Montreal, Quebec, Canada; {dagger} ZymoGenetics, Inc., Seattle, WA 98102


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chronic exposure to oncostatin M (OM) has been shown to stimulate extrathymic T cell development. The present work shows that in OM transgenic mice, 1) massive extrathymic T cell development takes place exclusively the lymph nodes (LNs) and not in the bone marrow, liver, intestines, or spleen; and 2) LNs are the sole site where the size of the mature CD4+ and CD8+ T cell pool is increased (6- to 7-fold). Moreover, when injected into OM transgenic mice, both transgenic and nontransgenic CD4+ and CD8+ T cells preferentially migrated to the LNs rather than the spleen. Studies of athymic recipients of fetal liver grafts showed that lymphopoietic pathway modulated by OM was truly thymus independent, and that nontransgenic progenitors could generate extrathymic CD4+CD8+ cells as well as mature T cells under the paracrine influence of OM. The progeny of the thymic-independent differentiation pathway regulated by OM was polyclonal in terms of Vß usage, exhibited a phenotype associated with previous TCR ligation, and displayed a rapid turnover rate (5-bromo-2'-deoxyuridine pulse-chase assays). This work suggests that chronic exposure to OM 1) discloses a unique ability of LNs to sustain extrathymic T cell development, and 2) increases the number and/or function of LN niches able to support seeding of recirculating mature T cells. Regulation of the lymphopoietic pathway discovered in OM transgenic mice could be of therapeutic interest for individuals with thymic hypoplasia or deficient peripheral T cell niches.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Changes in T lymphocyte function underlie much of the age-related decline in protective immune responses (1). Indeed, senescence-associated thymic atrophy leads to the progressive replacement of virgin T cells by memory cells that display decreased proliferative potential and a restricted repertoire diversity (2, 3, 4, 5). Numerous observations suggest that immune competence has a major influence on life span, and that disturbed T cell responses are implicated in the age-related increase in the incidence of infections, cancer, and autoimmune diseases (6, 7, 8, 9, 10, 11). The mechanisms responsible for thymic involution are unknown (12). Its occurrence may reflect the fact that, from an evolutionary perspective, thymopoiesis can be considered an energy-expensive process, and there is no selective pressure for maintaining the same level of T cell repertoire diversity in aged as in young individuals (12). Importantly, thymic output and the size of peripheral T cell pools are independently regulated. Thus, an increase in thymic export (by thymic grafts) does not bring about a commensurate enlargement of peripheral T cell compartments (5, 13). The size of peripheral T cell compartments, rather, is determined by the number of available T cell niches. The term niche designates an environment that provides local conditions (such as expression of specific chemokines, cytokines, and MHC molecules) required for T cells to seed and survive long term in the peripheral compartment (14, 15). Furthermore, thymic output does not increase in the presence of peripheral T cell depletion (16). Hence, the consequences of the progressive age-associated decline in thymic function are magnified in individuals whose peripheral lymphoid compartments have been rendered hypoplastic by various factors, such as chemotherapy and HIV-1 infection (17, 18, 19, 20, 21).

In athymic subjects, continuous production of new T cells is afforded by proliferation of post-thymic T cells and by extrathymic T cell development (22, 23, 24). In various mouse models, extrathymic differentiation of hemopoietic stem cells has been detected in selected organs, such as bone marrow (25, 26), intestinal cryptopatches (27), and liver (28, 29). However, under normal circumstances, the ability of these organs to replenish and maintain lymph node (LN)3 and spleen T cell compartments is inferior to that of the thymus. Nevertheless, it was recently shown that expression of an oncostatin M (OM) (3) transgene, under the control of the proximal Lck promoter or the CD34 gene promoter, causes thymus atrophy and thymus-independent accumulation of immature and mature T cells in LNs (30, 31, 32). OM is a member of the IL-6 family of cytokines that acts as a growth regulator for many types of mammalian cells (33). In normal mice, this pleiotropic cytokine is produced late in the activation cycle of T cells and macrophages, and its best known activities in vivo are anti-inflammatory (34, 35). Breeding experiments with IL-6-/- and IL-7R-/- mice showed that induction of extrathymic development by the OM transgene occurs in the absence of IL-6, but is strictly dependent on IL-7R signaling (32). Intraperitoneal administration of recombinant human OM produced the same effect in nontransgenic mice (31).

The striking occurrence of extrathymic T cell development in LckOM transgenic mice provides unforeseen evidence for the existence of a lymphopoietic pathway whose regulation could be of therapeutic interest for individuals with senescence- or disease-associated thymic hypoplasia. Thus, the goal of this study was to evaluate the development and turnover of extrathymic T cells produced under the influence of OM. We found that chronic production of OM endowed LNs with the unique ability to sustain T cell development and attract mature T cells. These extrathymically produced T cells had a diversified TCR Vß repertoire, showed a rapid turnover rate, and expressed differentiation markers associated with previous TCR ligation.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice

C57BL/6J (B6; Thy-1.2+) and B6.PL-Thy-1a/Cy (B6.PL; Thy-1.1+) mice were purchased from The Jackson Laboratory (Bar Harbor, ME). LckOM transgenic mice were initially provided by Bristol-Myers Squibb Pharmaceutical Research Institute (Seattle, WA). In LckOM mice, the p56lck proximal promotor targets expression of the bovine OM gene to thymocytes (30, 31). Fertilized oocytes from (C3H x B6)F1 mice were used for pronuclear injections, and transgenic mice were backcrossed with nontransgenic B6 mice. The mice obtained from Bristol-Myers Squibb Pharmaceutical Research Institute that were used in this work had been bred in this manner for >13 generations. LckOM mice used in our experiments were heterozygous. As LckOM females develop ovarian failure at about 10 wk of age, heterozygous transgenic mice were obtained by breeding heterozygous LckOM males with B6 females. The LckOM genotype was confirmed by PCR assay using 200 ng of genomic tail DNA and the following primers: 5'->3' AGTCCCGTACTGCAGGAACA and GCTCACACCATTAAAGTGC. Mice were bred and housed under specific pathogen-free conditions (in sterile ventilated racks in the case of LckOM mice) at the Guy Bernier Research Center according to the standards of the Canadian Committee for Animal Protection.

Thymectomy

At 4–5 wk of age, mice were anesthetized by i.p. injection of 75 mg/kg sodium pentobarbital (Somnotol, MTC Pharmaceuticals, Cambridge, Ontario, Canada), and the thymus was removed with a suction cannula introduced over the suprastrenal notch. Completeness of thymectomy was verified in each animal by visual inspection at the time of sacrifice. Cell transplantation was performed at least 2 wk after surgery.

Bone marrow and fetal liver cell transplantation

Bone marrow collected from the femurs and tibias of LckOM donors was T cell depleted with a specific anti-Thy-1.2 mAb (Cedarlane, Hornby, Canada) and rabbit serum (Low-Tox-M rabbit complement, Cedarlane) as a source of complement. The efficacy of depletion was assessed by flow cytometry. Timed pregnancies were established for B6.PL mice, and fetal liver cells were collected on day 13 postcoitum. Hemopoietic chimeras were created by injecting 4 x 106 LckOM bone marrow cells and 4 x 106 B6.PL fetal liver cells into irradiated (10 Gy) B6 recipients. 5-Bromo-2'-deoxyuridine (BrdU) labeling experiments were initiated in hemopoietic chimeras 75–90 days after transplantation.

Isolation of hepatic and intestinal lymphocytes

Isolation of hepatic and intestinal intraepithelial lymphocytes was performed using density centrifugation as previously described (29, 36).

Monoclonal Abs

The following Abs were obtained from PharMingen (Mississauga, Canada): Cy-Chrome-conjugated anti-CD4 (RM4-5; rat IgG2a,{kappa}), anti-CD8{alpha} (53-6.7; rat IgG2a,{kappa}), biotinylated-anti-CD8{alpha} (53-6.7; rat IgG2a,{kappa}) detected with Cy-Chrome-streptavidin or APC-streptavidin, biotinylated-anti-Thy-1.1 (OX-7; mouse IgG1,{kappa}), biotinylated-anti-Vß3 TCR (KJ25; hamster IgG) detected with FITC-streptavidin, FITC-conjugated anti-Thy-1.2 (53-2.1; rat IgG2a,{kappa}), anti-Vß5.1,2 TCR (MR9-4; mouse IgG1,{kappa}), anti-Vß6 TCR (RR4-7; rat IgG2b,{lambda}), anti-Vß7 TCR (TR310; rat IgG2b,{kappa}), anti-Vß8.1,2 TCR (MR5-2; mouse IgG2a,{kappa}), anti-Vß9 TCR (MR10-2; mouse IgG1,{kappa}), anti-Vß10b TCR (B21.5; rat IgG2a,{lambda}), anti-Vß11 TCR (RR3-15; rat IgG2b,{kappa}), anti-Vß13 TCR (MR12-3; mouse IgG1,{kappa}), anti-Vß14 TCR (14-2; rat IgM,{kappa}), anti-Vß17a TCR (KJ23; mouse IgG2a,{kappa}), PE-conjugated anti-Thy-1.1 (OX-7; mouse IgG2a,{kappa}), PE-conjugated anti-Thy-1.2 (30-H12; rat IgG2b,{kappa}), PE-conjugated anti-CD19 (ID3; rat IgG2a,{kappa}), PE-conjugated anti-CD44 (IM7; rat IgG2b,{kappa}), PE-conjugated anti-CD45RB (23G2; rat IgG2a,{kappa}), PE-conjugated anti-CD62L (MEL-14; rat IgG2a,{kappa}), PE-conjugated anti-CD122 (IL-2R ß-chain; TM-ß1; rat IgG2b,{kappa}), and PE-conjugated anti-NK1.1 (PK136; mouse IgG2a,{kappa}) Abs and their isotypic controls. PE-conjugated-anti-CD8{alpha} was purchased from Cedarlane, FITC-conjugated anti-BrdU was obtained from Becton Dickinson (Mountain View, CA), and Cy5-streptavidin was purchased from Jackson ImmunoResearch Laboratories (West Grove, PA).

Flow cytometry and BrdU labeling

Cell surface staining and BrdU labeling were performed as previously described (37, 38). Analyses were performed with a FACSCalibur flow cytometer using CellQuest software or with a FACScan flow cytometer using LYSIS II software (all from Becton Dickinson).

In vivo cell trafficking

Spleen cells from 12- to 20-wk-old B6 or LckOM donors were labeled with carboxy-fluorescein diacetate succinimidyl ester (CFSE; Molecular Probes, Eugene, OR) as previously described (39). Splenocytes (108) were incubated at 37°C for 15 min in PBS (2 ml) supplemented with CFSE (0.5 µM) and washed twice in cold PBS. Then, unirradiated recipients were injected via the lateral tail vein with a spleen cell suspension containing 43 ± 5 x 106 CFSE-labeled T lymphocytes, and the spleen and mesenteric LNs were removed 36 h later for flow cytometric analysis.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
LNs represent the sole site of massive extrathymic T cell development in LckOM mice

The relative and absolute numbers of lymphocyte subsets found in the thymus, LNs, and spleen of LckOM mice and normal B6 controls, aged 4–20 wk, are depicted in Figs. 1Go and 2, respectively. The most dramatic findings were observed in the LNs, which, at 12 wk, showed a 30-fold increase in cellularity relative to controls (Table IGo). This was caused primarily by a massive accumulation of double-positive CD4+CD8+ lymphocytes that reached a maximum at 12 wk and to a lesser extent by a more progressive increase in the numbers of B cells and single-positive CD4+ and CD8+ lymphocytes that rose progressively from 4–20 wk. Data depicted in Figs. 1Go and 2Go concern mesenteric LNs; other LNs (axillar and cervical) showed the same proportions of various lymphocyte subsets, but were slightly less hypercellular than mesenteric nodes (data not shown). LckOM spleens were also hypercellular. In the spleen, however, increased cellularity was due essentially to an accumulation of B lymphocytes; there was a minimal accumulation of immature T cells and no significant increase in the number of CD4+ or CD8+ T cells. Young (4-wk-old) LckOM mice presented severe thymic hypoplasia with very low numbers of immature thymocytes. Thymic cellularity increased with age in LckOM mice, but this was due mainly to a major accumulation of B cells and, to a lesser extent, to increasing numbers of single-positive CD4+ and CD8+ T cells. Immature thymocytes were virtually absent from the thymus of old (20-wk-old) LckOM mice.



View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 1. Proportion of lymphocyte subsets in the thymus, mesenteric LNs, and spleen of LckOM mice and B6 controls. Based on three-color staining, cells were defined as double-negative T cells (Thy-1+CD4-CD8-), double-positive T cells (Thy-1+CD4+CD8+), single-positive T cells (Thy-1+CD4+CD8- or Thy+CD4-CD8+), or B lymphocytes (Thy-1-CD19+). Results represent the mean of three or four mice per group.

 

View this table:
[in this window]
[in a new window]
  		Table I. Absolute number of lymphocytes in the thymus, mesenteric LNs, and spleen of 12-wk-old LckOM and C57BL/6 mice1

 


View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 2. Absolute numbers of lymphocyte subsets in the thymus, mesenteric LNs, and spleen of LckOM mice and B6 controls. Populations are defined in Fig. 1Go. Results represent the mean of three or four mice per group.

 
Because extrathymic T cell development can take place in the liver (28, 29), intestine (27, 40), and bone marrow (25, 26), we assessed the number of CD4+CD8+ thymocytes as well as single-positive CD4+ and CD8+ T cells in these organs in LckOM mice (Fig. 3Go). We found no notable increase in the number of CD4+CD8+, CD4+, or CD8+ T cells in the bone marrow and intestines compared with B6 mice. A minimal, but statistically significant, accumulation of CD4+CD8+ cells was evident in the liver. Together, these results indicate that LckOM LNs are remarkable in at least two ways. First, assuming that developing thymocytes must go through a CD4+CD8+ stage, we can conclude that the LNs constitute the sole site where massive extrathymic thymopoiesis occurs in LckOM mice. As judged by the number of CD4+CD8+ T cells, the level of T cell production in the LNs of LckOM mice is considerable. Thus, in the mesenteric LNs alone, it reaches a level of 214 x 106 at 12 wk of age (Table IGo). Second, LNs of OM transgenic mice also present a conspicuous increase in the pool size of mature CD4+ and CD8+ T cells (Fig. 2Go). Hence, the mean numbers of single-positive T cells in the mesenteric LNs at 12 and 20 wk of age were 43 and 92 x 106 in the case of LckOM mice comparatively with 7 and 12 x 106 for B6 mice (Table IGo and data not shown).



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 3. T lymphocyte subsets in the bone marrow (tibiae plus femurs), liver, and intestine of LckOM and B6 mice. Populations are defined in Fig. 1Go. DP, Thy-1+CD4+CD8+ cells. The number (mean ± SD) of DP cells in the various organs is shown above the bars. There were three or four mice per group. *, p < 0.05, by Student’s t test.

 
CD4+ and CD8+ T lymphocytes are CD44high in LckOM mice

Analysis of expression of CD44, CD45RA or RB, CD62L, and IL-2Rß gives important information regarding previous Ag encounter by T cell populations. As depicted in Fig. 4Go, the phenotype of LN CD4+ and CD8+ cells was strikingly different in LckOM mice relative to B6 controls. In LckOM mice, most CD4+ T cells were CD44high, CD45RBlow, CD62Llow, and IL-2Rßlow, a phenotype found following TCR engagement by either non-self Ags or self ligands (41, 42, 43). In addition, the vast majority of CD8+ T cells were CD44high, CD45RBhigh, CD62Lhigh, and IL-2Rßhigh. The CD44highCD62Lhigh phenotype is found in two types of CD8+ cells: revertants and class I-restricted T cells triggered by self ligands (42, 43, 44). Thus, the phenotype of both CD4+ and CD8+ T cells of LckOM mice does not correspond to that of resting cells, but, rather, suggests that these cells have sustained significant levels of TCR signaling by heretofore undetermined ligands. Parenthetically, an activated phenotype can also be found in NK T cells that harbor a CD4+CD8- or CD4-CD8- phenotype (45, 46, 47). However, their NK1.1- phenotype shows that LckOM T cells do not correspond to NK T cells (Fig. 4Go). Interestingly, while the aforementioned phenotypic analyses have been performed on LckOM LN cells, similar results were observed in LckOM spleen cells and in LNs and spleen of irradiated B6 mice transplanted with LckOM hemopoietic progenitors (data not shown).



View larger version (38K):
[in this window]
[in a new window]
  		FIGURE 4. Expression of differentiation markers (CD44, CD45RB, CD62L, IL-2Rß, and NK1.1) by CD4+ and CD8+ mesenteric LN T lymphocytes from 6-wk-old LckOM (bold line) and B6 mice (dotted line). Three-color staining was performed with anti-CD4, anti-CD8, and anti-CD44, anti-CD45RB, anti-CD62L, anti-IL-2Rß, or anti-NK1.1 Abs. The percentage of LckOM cells on right side of the marker is indicated. These results are representative of three such experiments.

 
Extrathymic T cells have a polyclonal Vß repertoire and a rapid turnover rate

In LckOM mice, aged 12–20 wk, the total numbers of single-positive CD4+ and CD8+ T cells was significantly increased relative to that in normal mice (Fig. 2Go). Therefore, we asked whether these mature T cells had a polyclonal origin and how their expansion could be explained in kinetic terms. Functional in vitro studies of cytokines of the IL-6 family suggest that OM could have pleiotropic effects on T cell development in vivo. Thus, OM has been shown to support the differentiation of CD34+ cells into CD3+ T cells (48). In addition, IL-6, which shares the gp130 receptor subunit with OM (49), can prolong T cell survival (15) and provide costimulation for naive T cells (50, 51) by preventing apoptosis (52). Therefore, to address these questions, we created hemopoietic chimeras by injecting a 1/1 mixture of B6.PL fetal liver cells and T cell-depleted LckOM bone marrow cells into lethally irradiated thymectomized B6 mice and performed studies specifically on Thy-1.1+ cells (of B6.PL origin). Under these experimental conditions, Thy-1.1+ cells were 100% of extrathymic origin, as they were derived from the differentiation of fetal liver cells in athymic hosts. Furthermore, Thy-1.1+ cells were not transgenic themselves, but, rather, developed under the paracrine influence of OM (Fig. 5Go).



View larger version (37K):
[in this window]
[in a new window]
  		FIGURE 5. TCR repertoire of extrathymic T cells. Hemopoietic chimeras were created by injecting a 1/1 mixture of B6.PL fetal liver cells and T cell-depleted LckOM bone marrow cells into lethally irradiated/thymectomized B6 mice. A, Presence of CD4+CD8+ cells in the mesenteric LNs of hemopoietic chimeras, 75 days after transplantation. B, A large proportion of CD4+CD8+ cells originate from nontransgenic fetal liver cells (i.e., are Thy-1.1+). A dot-plot histogram gated on CD4+CD8+ cells is shown. C, Vß expression patterns in CD4+ and CD8+ splenocytes from euthymic B6 mice (thymic T cells), LckOM mice, and Thy-1.1+ cells (derived from B6.PL fetal liver cells) of hemopoietic chimeras (extrathymic T cells). These results represent the mean of five to seven individuals per group. Error bars represent the SD.

 
Among spleen Thy-1.1+ cells, both CD4+ and CD8+ T cells expressed a TCR Vß repertoire that was as diverse as that of age-matched B6 and LckOM controls when assessed by flow cytometric analysis (Fig. 5Go). Although analyses based on size heterogeneity or on sequence of the CDR3 region will be required to assess more precisely the diversity of extrathymic T cells (53, 54), our results indicate that CD4+ and CD8+ extrathymic T cells have a polyclonal origin.

BrdU pulse-chase experiments were performed to evaluate the turnover of extrathymic T cells in chimeras. Specifically, we sought to determine whether OM-dependent expansion of extrathymic T cell compartments was due to prolonged survival of resting cells or to an increased proliferation rate. During the pulse period, chimeras and control mice were given BrdU-supplemented water for 20 days (38, 55). Again, analyses in chimeras were performed specifically on Thy-1.1+ cells. Results for CD62L+ and CD62L- subsets were analyzed separately, because CD62L- cells divide more rapidly than CD62L+ cells (38, 55) and because, similar to LckOM mice (Fig. 4Go), the proportion of CD4+CD62L- cells was much increased in chimeras relative to that in B6 controls. The key finding was that BrdU-labeled CD4+ and CD8+ cells accumulated more rapidly among extrathymic T cells than in controls. Thus, when CD62L+ and CD62L- subsets in chimeras were compared with their normal counterparts in euthymic controls, the rate of appearance of BrdU-labeled cells was more rapid for extrathymic T cells than for classic T cells (Fig. 6Go). In contrast, the kinetics of BrdU incorporation by Thy-1.1+CD4+CD8+ thymocytes in the chimeras’ mesenteric LNs were similar to those of CD4+CD8+ cells in the thymus of B6 mice (data not shown). After being given BrdU water for 20 days, mice were transferred to normal water to examine the rate of decay of BrdU-labeled cells up to day 70. The disappearance of BrdU-labeled T cells was swifter for extrathymic T cells than for classic T cells (Fig. 6Go). This was conspicuous in the first 10 days after BrdU withdrawal, when the proportion of BrdU+ elements was relatively stable in B6 controls but was sharply decreased in extrathymic T cells. Collectively, these results indicate that extrathymic T cells proliferate actively and have a high turnover rate.



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 6. Incorporation (pulse) and decay (chase) of BrdU label in extrathymic vs conventional CD4+ and CD8+ spleen T cells. Normal B6 mice and hemopoietic chimeras were given BrdU water for 20 days, then BrdU was chased for 50 days by transferring mice to normal drinking water. At various time points, splenocytes were harvested and analyzed by four-color staining. In hemopoietic chimeras, created as described in Fig. 5Go, analyses were performed on Thy-1.1+ T cells, i.e., extrathymic T cells derived from B6.PL fetal liver cells. Each point represents the mean of two or three individuals.

 
LNs of LckOM attract CD4+ and CD8+ T cells

In LckOM mice LNs differ from the spleen as well as other organs not only in that they are the sole site of extrathymic T cell development, but also because the numbers of LN CD4+ and CD8+ T cells are increased ~6- to 7-fold relative to those in age-matched B6 mice (Fig. 2Go). The selective expansion of the LN single-positive T cell compartment is probably due at least to a minimal extent to the accumulation of T cells produced in situ. However, another explanation would be the preferential homing of recirculating extrathymic T cells to the LNs. To evaluate the latter possibility, we assessed the in vivo distribution of CFSE-labeled splenocytes from B6 and LckOM donors 36 h after injection into B6 and LckOM hosts. Fig. 7GoA depicts the results from these studies in the form of mesenteric LN/spleen ratios calculated from the absolute numbers of injected CD4+ and CD8+ T cells that were recovered from these two sites. The notable finding was that, whatever their source (B6 or LckOM) or their type (CD4+ or CD8+), the proportion of T cells that home to the LNs was greatly increased in LckOM recipients. Increased mesenteric LN/spleen ratios in OM transgenic recipients were due to both an increased accumulation of T cells in the LN and decreased homing to the spleen (Fig. 7GoB). It was also observed that the propensity to home to the LN rather than the spleen was greater for B6 than for LckOM T cells. The latter characteristic was T cell autonomous, because when B6 and LckOM splenocytes were coinjected, their respective recovery from the mesenteric LNs and spleen was exactly the same as that shown in Fig. 7Go (data not shown). The preferential LN homing of T cells injected into LckOM hosts was quite remarkable considering that the size of the T cell pool in LckOM LNs was already increased and that, in a variety of experimental models, the recovery of injected T cells was inversely related to the number of host T cells already present in lymphoid organs (22, 43, 56, 57).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 7. Migration of CFSE-labeled LckOM and B6 T cells. Spleen cell suspensions containing 43 ± 5 x 106 CFSE-labeled T lymphocytes derived from LckOM or B6 mice were injected through the tail vein of LckOM or B6 recipients. Recipients were sacrificed after 36 h to assess the numbers of CFSE-labeled T cells in the spleen and mesenteric LNs. A, The mesenteric LN/spleen ratio was calculated from the absolute number of CFSE+ T cells recovered from these two sites. Each dot represents one individual. The bar indicates the mean of the group. MLN/spleen ratio differences in LckOM vs B6 recipients were significant (p < 0.05, by Student’s t test) for CD4+ and CD8+ T cells from B6 as well as LckOM donors. B, Absolute number (mean x 106 ± SD) of CD4+ and CD8+ B6-derived T cells harvested from the spleen and mesenteric LN of B6 and LckOM recipients. There were five to seven mice per group.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Extrathymic T cell development in LckOM mice points to the existence of a novel pathway of T cell maturation whose unique characteristics raise fundamental issues concerning the regulation of T cell production and homeostasis. From a topographical point of view, the LNs of these mice are most peculiar. They are the sole site of a massive extrathymic T cell production, and they display an unusual propensity to attract recirculating CD4+ and CD8+ T cells. The single-positive progeny of this extrathymic pathway is polyclonal, shows a phenotype associated with earlier Ag encounter, and displays a rapid turnover rate.

Why T cell development normally takes place in the thymus is not known yet. No adhesion molecule-ligand pair has been identified on T cell precursors or thymic stroma that explains convincingly a selective entry or a preferential survival of T cell precursors in the thymic microenvironment (58, 59, 60, 61). Accordingly, the reason why extrathymic T cell production induced by OM is limited to the LNs, particularly the mesenteric LNs, is not inherently obvious. The fact that we found no evidence of extrathymic T cell development in other sites reported to have some ability to support T cell production (namely the liver, bone marrow, and intestines) suggests that chronic exposure to OM induces changes that uniquely affect LN stromal (nonlymphoid) cells. An alternative possibility would be that the LN stroma normally expresses a unique structure/molecule that is essential for the homing and development of OM-conditioned prethymic cells. The absence of immature thymocytes in the spleen of LckOM mice discloses unanticipated heterogeneity in the ability of secondary lymphoid organs to sustain T cell development. The latter observation is consistent with recent evidence that the rules governing the development of organized structure in the spleen and LNs are different. Thus, mice deficient either in osteoprotegerin ligand (a TNF family molecule) or in transcription factor Id2 lack LNs but have a normal spleen, while the reverse is observed in Hox11-deficient mice (62, 63, 64). Likewise, B cell/T cell segregation is differentially affected in the spleen vs LNs of LT{alpha}-/- and TNF receptor type I-/- mice (65). Moreover, some CD4-CD8- intrathymic thymocytes (but not prethymic progenitors present in fetal liver) can, when injected into thymectomized nontransgenic mice, develop into both CD4+CD8+ and single-positive T cells in the LNs but not in the spleen (66). Clearly, further investigations must be pursued to decipher the molecular interactions responsible for the striking ability of LNs to support extrathymic T cell development under the influence of OM.

When transplanted into thymectomized hosts together with OM transgenic bone marrow, nontransgenic fetal liver cells yielded a major accumulation of CD4+CD8+ T cells in the LNs and generated mature T cells with a polyclonal Vß repertoire. This suggests that significant levels of thymus-independent positive selection takes place extrathymically (presumably in the LNs) under the paracrine influence of OM; otherwise, CD4+CD8+ would die by neglect (67, 68). This observation is consistent with evidence that thymic epithelial cells are not the only cells that can support positive selection, and that in vivo positive selection can be mediated by hemopoietic cells (69, 70). Nevertheless, it remains to be determined whether the extrathymic pathway modulated by OM follows the same rules regarding positive and negative repertoire selection as the classical thymic pathway. Other important questions that must be addressed concern the immunocompetence of extrathymic T cells and whether they are self tolerant. Because reconstitution of nu/nu mice with LckOM bone marrow restored immune responsiveness to allogeneic mouse melanoma cells, the progeny of the OM-dependent pathway shows at least some level of immunocompetence (31). However, it remains to be determined whether T cells that have differentiated in the LNs can generate protective immune responses against microbial pathogens as efficiently as conventional T cells do.

When injected into 12- to 20-wk-old LckOM mice, T cells harvested from the spleen of normal or LckOM donors preferentially homed to the LNs rather than the spleen. This was somewhat unexpected, because 1) in LckOM recipients the size of the T cell pool was normal in the spleen but was increased 6- to 7-fold in the LNs; and 2) injected T cells usually home preferentially to lymphoid organs that contain less T cells (22, 43, 56, 57). This bias is attributed to the higher number of available (or empty) T cell niches in T-depleted as opposed to T-replete lymphoid organs. Thus, one logical extension of our findings is that the number of T cell niches increases under the influence of sustained OM production. Recently, a number of indications have been presented suggesting that resident dendritic cells represent fundamental constituents of the peripheral T cell niches (71, 72, 73, 74). Because of their abundant expression of MHC class I and class II molecules and their specific chemokine and cytokine expression profile, dendritic cells seem to have a unique ability to control the homing of post-thymic T cells and to provide the continuous TCR ligation required for the survival of naive and memory T cells in the periphery (72, 75, 76, 77). Interestingly, OM and Flt3 ligand act synergistically to enhance the in vitro proliferation of hemopoietic stem cells committed to macrophage/dendritic cell formation (78). Therefore, it will be of great interest to evaluate the influence of OM on the number, phenotype, and function of dendritic cells in vivo. The postulated ability of OM to increase the number of functional T cell niches would be, to our knowledge, unprecedented and could be of medical interest in circumstances where the number of such niches is deficient (38).

T cells that have developed extrathymically under the influence of OM display two striking features that are perhaps related: these T cells have a rapid turnover rate and the phenotype of Ag-experienced cells (CD44highCD45RBlowCD62Llo for CD4+ cells, and CD44highCD45RBhighIL2R-ßhigh for CD8+ cells). As stated above, a CD44high activated phenotype is indicative of previous TCR interaction either with conventional non-self Ag or with peripheral self ligands (42, 43, 44). Two findings argue against the possibility that CD4+ and CD8+ extrathymic T cells have been primed en masse by environmental Ags. First, we observed the same nonnaive phenotype (depicted in Fig. 4Go), without conspicuous skewing of the Vß repertoire, in LckOM mice 4–18 wk of age (data not shown). The second argument is based on the CD62L phenotype of CD8+ elements. Indeed, although some CD8+ cells that respond to non-self Ags can revert to a CD62Lhigh phenotype, a CD8+ compartment composed primarily of CD44highCD62Lhigh elements has been found, to our knowledge, in only one situation: following expansion driven by self-ligands in lymphopenic hosts (44). In the latter situation, it has been proposed that, consecutive to lymphopenia, the increased level of available (empty) T cell niches may allow greater accessibility to niche APCs presenting self ligands or growth factors that promote T cell division (43, 44). LckOM are certainly not lymphopenic. Thus, we surmise that the activated phenotype of LckOM T cells supports the concept that LckOM mice show a major increase in the number and/or function of T cell niches. This strengthens the need to study the effects of OM on the numbers, phenotype, and function of dendritic cells. In this regard, it is noteworthy that IL-6, which belongs to the same family as OM, has been reported to modify the processing of self ligands by dendritic cells and to increase the presentation of otherwise cryptic epitopes (79). Such a mechanism could be instrumental in expanding the size of the peripheral T cell compartment by increasing the reactivity of T cells toward self ligands.


   Acknowledgments
 
We are indebted to Nathalie Beaudoin and the animal caretakers of the Guy Bernier Research Center for their invaluable help during the course of these studies.


   Footnotes
 
1 This work was supported by the National Cancer Institute of Canada (to C.P.). Back

2 Address correspondence and reprint requests to Dr. Claude Perreault, Guy Bernier Research Center, Maisonneuve Rosemont Hospital, 5415 de l’Assomption boulevard, Montreal, Quebec, Canada H1T 2 M4. Back

3 Abbreviations used in this paper: LN, lymph node; B6, C57BL/6J; B6.PL, B6.PL-Thy-1a/Cy; BrdU, 5-bromo-2'-deoxyuridine; CFSE, carboxy-fluorescein diacetate succinimidyl ester; OM, oncostatin M; CD62L, CD62 ligand. Back

Received for publication December 22, 1999. Accepted for publication March 10, 2000.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Miller, R. A.. 1996. The aging immune system: primer and prospectus. Science 273:70.[Abstract]
  2. Weng, N. P., L. Granger, R. J. Hodes. 1997. Telomere lengthening and telomerase activation during human B cell differentiation. Proc. Natl. Acad. Sci. USA 94:10827.[Abstract/Free Full Text]
  3. Tanchot, C., B. Rocha. 1997. Peripheral selection of T cell repertoires: the role of continuous thymus output. J. Exp. Med. 186:1099.[Abstract/Free Full Text]
  4. Mackall, C. L., F. T. Hakim, R. E. Gress. 1997. T-cell regeneration: all repertoires are not created equal. Immunol. Today 18:245.[Medline]
  5. Berzins, S. P., R. L. Boyd, J. F. Miller. 1998. The role of the thymus and recent thymic migrants in the maintenance of the adult peripheral lymphocyte pool. J. Exp. Med. 187:1839.[Abstract/Free Full Text]
  6. Covelli, V., D. Mouton, M. V. Di, Y. Bouthillier, C. Bangrazi, J. C. Mevel, S. Rebessi, G. Doria, G. Biozzi. 1989. Inheritance of immune responsiveness, life span, and disease incidence in interline crosses of mice selected for high or low multispecific antibody production. J. Immunol. 142:1224.[Abstract]
  7. Ferguson, F. G., A. Wikby, P. Maxson, J. Olsson, B. Johansson. 1995. Immune parameters in a longitudinal study of a very old population of Swedish people: a comparison between survivors and nonsurvivors. J. Gerontol. A Biol. Sci. Med. Sci. 50:B378.[Abstract]
  8. Wayne, S. J., R. L. Rhyne, P. J. Garry, J. S. Goodwin. 1990. Cell-mediated immunity as a predictor of morbidity and mortality in subjects over 60. J. Gerontol. 45:M45.
  9. Bender, B. S., J. E. Nagel, W. H. Adler, R. Andres. 1986. Absolute peripheral blood lymphocyte count and subsequent mortality of elderly men: the Baltimore longitudinal study of aging. J. Am. Geriatr. Soc. 34:649.[Medline]
  10. Boersma, W. J., F. A. Steinmeier, J. J. Haaijman. 1985. Age-related changes in the relative numbers of Thy-1- and Lyt-2-bearing peripheral blood lymphocytes in mice: a longitudinal approach. Cell Immunol. 93:417.[Medline]
  11. Miller, R. A., P. Turke, C. Chrisp, J. Ruger, A. Luciano, J. Peterson, K. Chalmers, G. Gorgas, S. VanCise. 1994. Age-sensitive T cell phenotypes covary in genetically heterogeneous mice and predict early death from lymphoma. J. Gerontol. 49:B255.
  12. George, A. J., M. A. Ritter. 1996. Thymic involution with ageing: obsolescence or good housekeeping?. Immunol. Today 17:267.[Medline]
  13. Metcalf, D.. 1963. The autonomous behaviour of normal thymus grafts. Austr. J. Exp. Biol. 41:437.
  14. Freitas, A. A., F. Agenes, G. C. Coutinho. 1996. Cellular competition modulates survival and selection of CD8+ T cells. Eur. J. Immunol. 26:2640.[Medline]
  15. Teague, T. K., P. Marrack, J. W. Kappler, A. T. Vella. 1997. IL-6 rescues resting mouse T cells from apoptosis. J. Immunol. 158:5791.[Abstract]
  16. Gabor, M. J., R. Scollay, D. I. Godfrey. 1997. Thymic T cell export is not influenced by the peripheral T cell pool. Eur. J. Immunol. 27:2986.[Medline]
  17. Mackall, C. L., T. A. Fleisher, M. R. Brown, I. T. Magrath, A. T. Shad, M. E. Horowitz, L. H. Wexler, M. A. Adde, L. L. McClure, R. E. Gress. 1994. Lymphocyte depletion during treatment with intensive chemotherapy for cancer. Blood 84:2221.[Abstract/Free Full Text]
  18. Mackall, C. L., T. A. Fleisher, M. R. Brown, M. P. Andrich, C. C. Chen, I. M. Feuerstein, M. E. Horowitz, I. T. Magrath, A. T. Shad, S. M. Steinberg. 1995. Age, thymopoiesis, and CD4+ T-lymphocyte regeneration after intensive chemotherapy. N. Engl. J. Med. 332:143.[Abstract/Free Full Text]
  19. Mackall, C. L., T. A. Fleisher, M. R. Brown, M. P. Andrich, C. C. Chen, I. M. Feuerstein, I. T. Magrath, L. H. Wexler, D. S. Dimitrov, R. E. Gress. 1997. Distinctions between CD8 + and CD4+ T-cell regenerative pathways result in prolonged T-cell subset imbalance after intensive chemotherapy. Blood 89:3700.[Abstract/Free Full Text]
  20. Hakim, F. T., R. Cepeda, S. Kaimei, C. L. Mackall, N. McAtee, J. Zujewski, K. Cowan, R. E. Gress. 1997. Constraints on CD4 recovery postchemotherapy in adults: thymic insufficiency and apoptotic decline of expanded peripheral CD4 cells. Blood 90:3789.[Abstract/Free Full Text]
  21. McCune, J. M., R. Loftus, D. K. Schmidt, P. Carroll, D. Webster, L. B. Swor-Yim, I. R. Francis, B. H. Gross, R. M. Grant. 1998. High prevalence of thymic tissue in adults with human immunodeficiency virus-1 infection. J. Clin. Invest. 101:2301.[Medline]
  22. Sprent, J., M. Schaefer, M. Hurd, C. D. Surh, Y. Ron. 1991. Mature murine B and T cells transferred to SCID mice can survive indefinitely and many maintain a virgin phenotype. J. Exp. Med. 174:717.[Abstract/Free Full Text]
  23. Rocha, B., D. Guy-Grand, P. Vassalli. 1995. Extrathymic T cell differentiation. Curr. Opin. Immunol. 7:235.[Medline]
  24. Abo, T., H. Watanabe, T. Iiai, M. Kimura, K. Ohtsuka, K. Sato, M. Ogawa, H. Hirahara, S. Hashimoto, H. Sekikawa. 1994. Extrathymic pathways of T-cell differentiation in the liver and other organs. Int. Rev. Immunol. 11:61.[Medline]
  25. Dejbakhsh-Jones, S., L. Jerabek, I. L. Weissman, S. Strober. 1995. Extrathymic maturation of {alpha}ß T cells from hemopoietic stem cells. J. Immunol. 155:3338.[Abstract]
  26. Garcia-Ojeda, M. E., S. Dejbakhsh-Jones, I. L. Weissman, S. Strober. 1998. An alternate pathway for T cell development supported by the bone marrow microenvironment: recapitulation of thymic maturation. J. Exp. Med. 187:1813.[Abstract/Free Full Text]
  27. Saito, H., Y. Kanamori, T. Takemori, H. Nariuchi, E. Kubota, H. Takahashi-Iwanaga, T. Iwanaga, H. Ishikawa. 1998. Generation of intestinal T cells from progenitors residing in gut cryptopatches. Science 280:275.[Abstract/Free Full Text]
  28. Collins, C., S. Norris, G. McEntee, O. Traynor, L. Bruno, H. von Boehmer, J. Hegarty, C. O’Farrelly. 1996. RAG1, RAG2 and pre-T cell receptor {alpha} chain expression by adult human hepatic T cells: evidence for extrathymic T cell maturation. Eur. J. Immunol. 26:3114.[Medline]
  29. Sato, K., K. Ohtsuka, K. Hasegawa, S. Yamagiwa, H. Watanabe, H. Asakura, T. Abo. 1995. Evidence for extrathymic generation of intermediate T cell receptor cells in the liver revealed in thymectomized, irradiated mice subjected to bone marrow transplantation. J. Exp. Med. 182:759.[Abstract/Free Full Text]
  30. Malik, N., H. S. Haugen, B. Modrell, M. Shoyab, C. H. Clegg. 1995. Developmental abnormalities in mice transgenic for bovine oncostatin M. Mol. Cell. Biol. 15:2349.[Abstract]
  31. Clegg, C. H., J. T. Rulffes, P. M. Wallace, H. S. Haugen. 1996. Regulation of an extrathymic T-cell development pathway by oncostatin M. Nature 384:261.[Medline]
  32. Clegg, C. H., H. S. Haugen, J. T. Rulffes, S. L. Friend, A. G. Farr. 1999. Oncostatin M transforms lymphoid tissue function in transgenic mice by stimulating lymph node T-cell development and thymus autoantibody production. Exp. Hematol. 27:712.[Medline]
  33. Malik, N., J. C. Kallestad, N. L. Gunderson, S. D. Austin, M. G. Neubauer, V. Ochs, H. Marquardt, J. M. Zarling, M. Shoyab, C. M. Wei. 1989. Molecular cloning, sequence analysis, and functional expression of a novel growth regulator, oncostatin M. Mol. Cell. Biol. 9:2847.[Abstract/Free Full Text]
  34. Wallace, P. M., J. F. MacMaster, K. A. Rouleau, T. J. Brown, J. K. Loy, K. L. Donaldson, A. F. Wahl. 1999. Regulation of inflammatory responses by oncostatin M. J. Immunol. 162:5547.[Abstract/Free Full Text]
  35. Loy, J. K., T. J. Davidson, K. K. Berry, J. F. Macmaster, B. Danle, S. K. Durham. 1999. Oncostatin M: development of a pleiotropic cytokine. Toxicol. Pathol. 27:151.[Abstract/Free Full Text]
  36. Poussier, P., P. Edouard, C. Lee, M. Binnie, M. Julius. 1992. Thymus-independent development and negative selection of T cells expressing T cell receptor {alpha}ß in the intestinal epithelium: evidence for distinct circulation patterns of gut- and thymus-derived T lymphocytes. J. Exp. Med. 176:187.[Abstract/Free Full Text]
  37. Dulude, G., S. Brochu, P. Fontaine, C. Baron, M. Gyger, D. C. Roy, C. Perreault. 1997. Thymic and extrathymic differentiation and expansion of T lymphocytes following bone marrow transplantation in irradiated recipients. Exp. Hematol. 25:992.[Medline]
  38. Dulude, G., D. C. Roy, C. Perreault. 1999. The effect of graft-versus-host disease on T cell production and homeostasis. J. Exp. Med. 189:1329.[Abstract/Free Full Text]
  39. Wells, A. D., H. Gudmundsdottir, L. A. Turka. 1997. Following the fate of individual T cells throughout activation and clonal expansion: signals from T cell receptor and CD28 differentially regulate the induction and duration of a proliferative response. J. Clin. Invest. 100:3173.[Medline]
  40. Poussier, P., M. Julius. 1994. Thymus independent T cell development and selection in the intestinal epithelium. Annu. Rev. Immunol. 12:521.[Medline]
  41. Walker, P. R., T. Ohteki, J. A. Lopez, H. R. MacDonald, J. L. Maryanski. 1995. Distinct phenotypes of antigen-selected CD8 T cells emerge at different stages of an in vivo immune response. J. Immunol. 155:3443.[Abstract]
  42. Sprent, J.. 1997. Immunological memory. Curr. Opin. Immunol. 9:371.[Medline]
  43. Ernst, B., D. S. Lee, J. M. Chang, J. Sprent, C. D. Surh. 1999. The peptide ligands mediating positive selection in the thymus control T cell survival and homeostatic proliferation in the periphery. Immunity 11:173.[Medline]
  44. Goldrath, A. W., M. J. Bevan. 1999. Low-affinity ligands for the TCR drive proliferation of mature CD8+ T cells in lymphopenic hosts. Immunity 11:183.[Medline]
  45. Watanabe, H., C. Miyaji, Y. Kawachi, T. Iiai, K. Ohtsuka, T. Iwanage, H. Takahashi-Iwanaga, T. Abo. 1995. Relationships between intermediate TCR cells and NK1.1+ T cells in various immune organs. NK1.1+ T cells are present within a population of intermediate TCR cells. J. Immunol. 155:2972.[Abstract]
  46. Eberl, G., H. R. MacDonald. 1998. Rapid death and regeneration of NKT cells in anti-CD3{epsilon}- or IL-12- treated mice: a major role for bone marrow in NKT cell homeostasis. Immunity 9:345.[Medline]
  47. Bendelac, A., M. N. Rivera, S. H. Park, J. H. Roark. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu. Rev. Immunol. 15:535.[Medline]
  48. Pawelec, G., R. Muller, A. Rehbein, K. Hahnel, B. L. Ziegler. 1999. Finite lifespans of T cell clones derived from CD34+ human haematopoietic stem cells in vitro. Exp. Gerontol. 34:69.[Medline]
  49. Peters, M., A. M. Iler, S. Rose-John. 1998. Interleukin-6 and soluble interleukin-6 receptor: direct stimulation of gp130 and hematopoiesis. Blood 92:3495.[Free Full Text]
  50. Uyttenhove, C., P. G. Coulie, J. Van Snick. 1988. T cell growth and differentiation induced by interleukin-HP1/IL-6, the murine hybridoma/plasmacytoma growth factor. J. Exp. Med. 167:1417.[Abstract/Free Full Text]
  51. Lotz, M., F. Jirik, P. Kabouridis, C. Tsoukas, T. Hirano, T. Kishimoto, D. A. Carson. 1988. B cell stimulating factor 2/interleukin 6 is a costimulant for human thymocytes and T lymphocytes. J. Exp. Med. 167:1253.[Abstract/Free Full Text]
  52. Kishimoto, H., J. Sprent. 1999. Strong TCR ligation without costimulation causes rapid onset of Fas-dependent apoptosis of naive murine CD4+ T cells. J. Immunol. 163:1817.[Abstract/Free Full Text]
  53. Gapin, L., Y. Fukui, J. Kanellopoulos, T. Sano, A. Casrouge, V. Malier, E. Beaudoing, D. Gautheret, J. M. Claverie, T. Sasazuki, et al 1998. Quantitative analysis of the T cell repertoire selected by a single peptide-major histocompatibility complex. J. Exp. Med. 187:1871.[Abstract/Free Full Text]
  54. Friedman, T. M., M. Gilbert, C. Briggs, R. Korngold. 1998. Repertoire analysis of CD8+ T cell responses to minor histocompatibility antigens involved in graft-versus-host disease. J. Immunol. 161:41.[Abstract/Free Full Text]
  55. Tough, D. F., J. Sprent. 1994. Turnover of naive- and memory-phenotype T cells. J. Exp. Med. 179:1127.[Abstract/Free Full Text]
  56. Modigliani, Y., G. Coutinho, O. Burlen-Defranoux, A. Coutinho, A. Bandeira. 1994. Differential contribution of thymic outputs and peripheral expansion in the development of peripheral T cell pools. Eur. J. Immunol. 24:1223.[Medline]
  57. von Boehmer, H., K. Hafen. 1993. The life span of naive {alpha}/ß T cells in secondary lymphoid organs. J. Exp. Med. 177:891.[Abstract/Free Full Text]
  58. Imhof, B. A., D. Dunon. 1995. Leukocyte migration and adhesion. Adv. Immunol. 58:345.[Medline]
  59. Anderson, G., N. C. Moore, J. J. Owen, E. J. Jenkinson. 1996. Cellular interactions in thymocyte development. Annu. Rev. Immunol. 14:73.[Medline]
  60. Westermann, J., U. Bode. 1999. Distribution of activated T cells migrating through the body: a matter of life and death. Immunol. Today 20:302.[Medline]
  61. Campbell, J. J., J. Pan, E. C. Butcher. 1999. Developmental switches in chemokine responses during T cell maturation. J. Immunol. 163:2353.[Abstract/Free Full Text]
  62. Roberts, C. W., J. R. Shutter, S. J. Korsmeyer. 1994. Hox11 controls the genesis of the spleen. Nature 368:747.[Medline]
  63. Yokota, Y., A. Mansouri, S. Mori, S. Sugawara, S. Adachi, S. Nishikawa, P. Gruss. 1999. Development of peripheral lymphoid organs and natural killer cells depends on the helix-loop-helix inhibitor Id2. Nature 397:702.[Medline]
  64. Kong, Y. Y., H. Yoshida, I. Sarosi, H. L. Tan, E. Timms, C. Capparelli, S. Morony, A. J. Oliveira-dos-Santos, G. Van, A. Itie, et al 1999. OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature 397:315.[Medline]
  65. Fu, Y. X., D. D. Chaplin. 1999. Development and maturation of secondary lymphoid tissues. Annu. Rev. Immunol. 17:399.[Medline]
  66. Antica, M., R. Scollay. 1999. Development of T lymphocytes at extrathymic sites. J. Immunol. 163:206.[Abstract/Free Full Text]
  67. Jameson, S. C., K. A. Hogquist, M. J. Bevan. 1995. Positive selection of thymocytes. Annu. Rev. Immunol. 13:93.[Medline]
  68. Anderson, G., K. J. Hare, E. J. Jenkinson. 1999. Positive selection of thymocytes: the long and winding road. Immunol. Today 20:463.[Medline]
  69. Zinkernagel, R. M., A. Althage. 1999. On the role of thymic epithelium vs. bone marrow-derived cells in repertoire selection of T cells. Proc. Natl. Acad. Sci. USA 96:8092.[Abstract/Free Full Text]
  70. Zerrahn, J., A. Volkmann, M. C. Coles, W. Held, F. A. Lemonnier, D. H. Raulet. 1999. Class I molecules on hematopoietic cells can support intrathymic positive selection of T cell receptor transgenic T cells. Proc. Natl. Acad. Sci. USA 96:11470.[Abstract/Free Full Text]
  71. Baggiolini, M.. 1998. Chemokines and leukocyte traffic. Nature 392:565.[Medline]
  72. Nesic, D., S. Vukmanovic. 1998. MHC class I is required for peripheral accumulation of CD8+ thymic emigrants. J. Immunol. 160:3705.[Abstract/Free Full Text]
  73. Sallusto, F., P. Schaerli, P. Loetscher, C. Schaniel, D. Lenig, C. R. Mackay, S. Qin, A. Lanzavecchia. 1998. Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation. Eur. J. Immunol. 28:2760.[Medline]
  74. Willimann, K., D. F. Legler, M. Loetscher, R. Stuber Roos, M. Belen Delgado, I. Clark-Lewis, M. Bagglioni, B. Moser. 1998. The chemokine SLC is expressed in T cell areas of lymph nodes and mucosal lymphoid tissues and attracts activated T cells via CCR7. Eur. J. Immunol. 28:2025.[Medline]
  75. Tanchot, C., B. Rocha. 1998. The organization of mature T-cell pools. Immunol. Today 19:575.[Medline]
  76. Tanchot, C., F. A. Lemonnier, B. Perarnau, A. A. Freitas, B. Rocha. 1997. Differential requirements for survival and proliferation of CD8 naive or memory T cells. Science 276:2057.[Abstract/Free Full Text]
  77. Sallusto, F., B. Palermo, D. Lenig, M. Miettinen, S. Matikainen, I. Julkunen, R. Forster, R. Burgstahler, M. Lipp, A. Lanzavecchia. 1999. Distinct patterns and kinetics of chemokine production regulate dendritic cell function. Eur. J. Immunol. 29:1617.[Medline]
  78. Metcalf, D.. 1997. Murine hematopoietic stem cells committed to macrophage/dendritic cell formation: stimulation by Flk2-ligand with enhancement by regulators using the gp130 receptor chain. Proc. Natl. Acad. Sci. USA 94:11552.[Abstract/Free Full Text]
  79. Drakesmith, H., D. O’Neil, S. C. Schneider, M. Binks, P. Medd, E. Sercarz, P. Beverley, B. Chain. 1998. In vivo priming of T cells against cryptic determinants by dendritic cells exposed to interleukin 6 and native antigen. Proc. Natl. Acad. Sci. USA 95:14903.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Vet PatholHome page
T.S.-C. Juan, B. Bolon, R. A. Lindberg, Y. Sun, G. Van, and F. A. Fletcher
Mice Overexpressing Murine Oncostatin M (OSM) Exhibit Changes in Hematopoietic and Other Organs that Are Distinct from Those of Mice Overexpressing Human OSM or Bovine OSM
Vet. Pathol., January 1, 2009; 46(1): 124 - 137.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
L. L. Veinotte, T. Y. F. Halim, and F. Takei
Unique subset of natural killer cells develops from progenitors in lymph node
Blood, April 15, 2008; 111(8): 4201 - 4208.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M.-E. Blais, S. Brochu, M. Giroux, M.-P. Belanger, G. Dulude, R.-P. Sekaly, and C. Perreault
Why T Cells of Thymic Versus Extrathymic Origin Are Functionally Different
J. Immunol., February 15, 2008; 180(4): 2299 - 2312.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
R. Terra, I. Louis, R. Le Blanc, S. Ouellet, J. C. Zuniga-Pflucker, and C. Perreault
T-cell generation by lymph node resident progenitor cells
Blood, July 1, 2005; 106(1): 193 - 200.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
B. Hardy, Y. Niv, L. Fadaeev, and A. Raiter
BAT mAb induces lymphopoiesis in nude mice
Int. Immunol., May 1, 2005; 17(5): 615 - 619.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
M.-E. Blais, G. Gerard, M. M. Martinic, G. Roy-Proulx, R. M. Zinkernagel, and C. Perreault
Do thymically and strictly extrathymically developing T cells generate similar immune responses?
Blood, April 15, 2004; 103(8): 3102 - 3110.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
E. Donskoy, D. Foss, and I. Goldschneider
Gated Importation of Prothymocytes by Adult Mouse Thymus Is Coordinated with Their Periodic Mobilization from Bone Marrow
J. Immunol., October 1, 2003; 171(7): 3568 - 3575.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
I. Louis, G. Dulude, S. Corneau, S. Brochu, C. Boileau, C. Meunier, C. Cote, N. Labrecque, and C. Perreault
Changes in the lymph node microenvironment induced by oncostatin M
Blood, August 15, 2003; 102(4): 1397 - 1404.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
R. Terra, N. Labrecque, and C. Perreault
Thymic and Extrathymic T Cell Development Pathways Follow Different Rules
J. Immunol., July 15, 2002; 169(2): 684 - 692.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
D. Zeng, P. Hoffmann, F. Lan, P. Huie, J. Higgins, and S. Strober
Unique patterns of surface receptors, cytokine secretion, and immune functions distinguish T cells in the bone marrow from those in the periphery: impact on allogeneic bone marrow transplantation
Blood, February 15, 2002; 99(4): 1449 - 1457.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boileau, C.
Right arrow Articles by Perreault, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boileau, C.
Right arrow Articles by Perreault, C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS