|
|
||||||||

*
Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892; and
Howard Hughes Medical Institute-National Institutes of Health Research Scholars Program, Bethesda, MD 20814
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
on challenge in vitro or mediate classic delayed type
hypersensitivity reactions on challenge in vivo. Depending on the
study, this has been attributed either to deletion/anergy of the
Ag-specific T cells or to their differentiation along a Th2 pathway
(13, 14, 15, 16). On the other hand, under certain unusual
circumstances, cells from animals primed repeatedly with neuroantigens
in IFA have induced disease (17). The mechanism of action of microbial adjuvants in promoting the differentiation of autoimmune effector T cells remains to be elucidated. The first aim of this study was to attempt to define the component(s) of whole microbial preparations that are responsible for their in vivo disease-promoting effects. We focused our efforts on the role of microbial DNA because it stimulates production of IL-12 (18, 19, 20, 21), a cytokine that we and others have previously demonstrated to play a critical role in pathogenesis of EAE as well as other organ-specific autoimmune diseases (22, 23, 24, 25, 26, 27). We demonstrate that CpG-containing oligodeoxynucleotides (ODN) that mediate some of the immunomodulatory functions of bacterial DNA could completely substitute for heat-killed mycobacteria and prime encephalitogenic myelin-reactive T cells in vivo. The second aim of the study was to further define the phenotype of autoantigen-specific T cells that are primed in the absence of microbial adjuvants. We demonstrate that T cells from animals primed with myelin basic protein (MBP) in IFA fully retain the capacity to differentiate into encephalitogenic T cells when reactivated under conducive (Th1-polarizing) conditions in vitro. Furthermore, our studies suggest that exposure to Ag in IFA partially activates T cells to differentiate along the Th1 pathway. Taken together, these observations have important implications both for our understanding of the role of environmental factors in the pathogenesis of autoimmune disease and for therapeutic strategies that use soluble Ags to tolerize or deviate the immune response.
| Materials and Methods |
|---|
|
|
|---|
Female SJL mice were obtained from the National Cancer Institute (Fredrick, MD) at 68 wk of age and housed in a pathogen-free facility. Mice were between 8 and 12 wk of age when experiments were initiated.
Peptides and oligonucleotides
MBP87106 (VVHFFKNIVTPRTPPPSQGK) was synthesized and purified by HPLC by the Laboratory of Molecular Structure, Peptide Synthesis Laboratory (National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD). ODN were purchased from Operon Technologies (Alameda, CA) and were phosphorothioate modified to increase their resistance to nuclease degradation. The sequences were as follows: CpG ODN, ATAATCGACGTTCAAGCAAG; control (non-CpG) ODN, ATAATAGAGCTTCAAGCAAG (28). The LPS content of the ODN was <1 ng LPS/mg DNA in all instances, as measured by Limulus amebocyte assay (BioWhittaker, Walkersville, MD).
Generation of MBP87106-specific LN cells for cell transfer, mRNA measurements, and analysis of cytokine production
Mice were immunized with MBP87106 (100 µg) emulsified in an equal volume of CFA, IFA, or IFA containing CpG ODN (60 µg) by s.c. injection at four sites over the flanks. In some experiments, mice were injected i.p. with a neutralizing mAb to IL-12, C17.8 (a gift of Dr. G. Trinchieri, Wistar Institute, Philadelphia, PA), or normal rat IgG (Sigma, St. Louis, MO). Ten days later, draining LN (inguinal and axillary) were removed and processed as previously described (23). Cells were cultured with or without MBP87106 (50 µg/ml) in RPMI containing 10% FCS and standard supplements. In some experiments, recombinant IL-12 (gift of S. Wolf, Genetics Institute, Cambridge, MA) or anti-IL-12 (C17.8) were added on day 1 of culture. Supernatants were sampled at 24-h intervals for quantification of cytokine levels. For Northern blot analyses, cells were harvested at 72 h, washed, and used for RNA extraction. For adoptive transfer, cells were harvested at 96 h and washed extensively. Viable cells were counted by trypan blue exclusion and injected i.p. into naive syngeneic recipients (5 x 107 cells/mouse). Recipients were examined daily by two observers, one of whom was blinded, for signs of EAE and rated for severity of neurological impairment as previously described (23).
Proliferation assays
LN cells (4 x 105 in 0.2 ml) were cultured with various concentrations of Ag or medium alone in triplicate for 4 days in 96-well round-bottom plates (Costar, Cambridge, MA) Wells were pulsed for the final 16 h of culture with 1 µCi [3H]TdR (Amersham, Arlington, Heights, IL), and incorporated radioactivity was measured using a Betaplate scintillation counter (Wallac, Gaithersburg, MD).
Northern blot analysis
Total RNA was isolated from LN cell cultures using RNAzol RNA isolation solvent (Tel-Test, Friendswood, TX). Samples (10 µg total RNA per lane) were run on a 1.2% agarose gels containing MOPS buffer and formaldehyde and blotted onto a Hybond-N nylon membrane (Amersham). Membranes were baked for 2 h at 80°C and then probed for murine IL-12Rß2 subunit or ß-actin. Oligonucleotide probes were synthesized or purchased as previously described (29). PCR fragments (50 ng) were labeled with [32P]dCTP using an oligolabeling kit (Pharmacia, Piscataway, NJ). Blots were prehybridized for 1 h at 42°C, followed by overnight hybridization with labeled probe at 42°C. Blots were then washed for 30 min in 2x SSC, 0.1% SDS buffer (room temperature) followed by 30 min in 0.1x SSC, 0.1% SDS buffer (55°C for IL-12Rß2; 65°C for ß-actin).
Cytokine ELISA
IL-2, IL-3, IL-4, IL-10, and IFN-
were quantified using a
sandwich ELISA technique based on noncompeting pairs of Abs as
previously described (23). The lower limit of detection
for each assay was 30 pg/ml or less.
| Results |
|---|
|
|
|---|
Female SJL mice were immunized with
MBP87106, the immunodominant peptide of MBP
that binds I-As, emulsified with either IFA
containing 1 mg/ml heat-killed Mycobacterium tuberculosis
(CFA), IFA mixed with an immunostimulatory CpG-containing
oligonucleotide (CpG ODN/IFA), or IFA alone. Draining LNs were removed
10 days later, dispersed into single-cell suspensions, and cultured
with or without MBP87106 to measure Ag-specific
lymphoproliferation and cytokine production. LN cells from all three
treatment groups mounted significant proliferative responses (Fig. 1
A) and produced similar
quantities of IL-3 (Fig. 1
B). IL-2 was produced in low
amounts by all groups (<100 pg/ml). Therefore, we concluded that
MBP-reactive T cells were neither deleted nor anergized as a
consequence of being primed in the absence of microbial adjuvants.
Indeed, the fact that we were able to detect equivalent MBP-specific
responses during the secondary stimulation of polyclonal LN cell
populations indicated that the autoreactive T cells had expanded in the
IFA-primed mice as well as in their CFA- and CpG ODN/IFA-primed
cohorts.
|
and transferred disease after in vitro restimulation (Fig. 1The adjuvant effects of CpG-ODN are IL-12 dependent
We next used cytokine gene knockout mice to determine the relative
importance of IFN-
and IL-12 in the development of encephalitogenic
T cells that were induced after priming with MBP/IFA/CpG ODN. We have
previously demonstrated that IL-12-deficient (-/-) C57BL/6 mice are
resistant to EAE induced by immunization with bovine MBP in CFA,
whereas IFN-
-/- mice are highly susceptible.
Disease was suppressed in IFN-
-/- mice by
neutralization of IL-12 (24). These studies demonstrated
that encephalitogenicity is induced by an IL-12-dependent,
IFN-
-independent pathway and that IFN-
paradoxically suppresses
EAE at some point in the pathogenic process.
In keeping with these earlier results, IL-12-/-
C57BL/6 mice were resistant to EAE induction after immunization with
MBP in CpG ODN/IFA. Furthermore, IFN-
-/-
mice were equally susceptible to EAE induced using either MBP in CFA or
CpG ODN/IFA but did not develop disease when immunized with MBP in IFA
alone (Fig. 2
). These results suggest
that the adjuvanticity of both intact mycobacteria and CpG-ODN is
secondary to their ability to directly induce IL-12 or that they act
synergistically with endogenous IL-12 to promote Th1 differentiation
and encephalitogenicity. Furthermore, both microbial products achieve
their adjuvant effects in the absence of IFN-
.
|
-/- C57BL/6 mice were primed with bovine
MBP in IFA s.c. and simultaneously injected with CpG ODN i.p., i.v., or
in the foot pad. Whereas 100% of mice developed severe EAE when
MBP87106 and CpG ODN were combined in a single
emulsion, they remained asymptomatic when
MBP87106/IFA and CpG ODN were administered at
independent sites (Fig. 2Ag in IFA partially primes Th1 effector cells
MBP-reactive LN cells from IFA-primed mice neither secreted
detectable quantities of IFN-
in vitro nor transferred disease into
naive syngeneic recipients (Fig. 1
, C and D).
Because it has recently been reported that foreign Ag-reactive T cells
primed using CFA differentiate into Th1 effectors, whereas T cells of
the same specificities primed using IFA default to a Th2 lineage
(13), we tested whether T cells from donors immunized with
MBP87106 in IFA produce IL-4 and IL-10 on in
vitro challenge. We were unable to detect either cytokine in the
supernatants of any of the cultures in multiple experiments (data not
shown).
An alternative possibility was that MBP-reactive T cells primed with
IFA alone were in an intermediate stage of development that would allow
them to mature into Th1 encephalitogenic effector cells after
reactivation under Th1 polarizing conditions. Expression of the ß2
subunit of the IL-12 receptor (IL-12Rß2) is a critical step in Th1
differentiation (30). Furthermore, we have found that the
ability of myelin protein-specific CD4+ T cells
to induce EAE correlates with their ability to up-regulate IL-12Rß2
on antigenic stimulation (29). We therefore compared
IL-12Rß2 expression in LN cells from animals immunized with
MBP87106/IFA or
MBP87106/CpG ODN/IFA after restimulation with
Ag in vitro. T cells from animals primed with Ag in CpG ODN/IFA
significantly up-regulated IL-12ß2 mRNA upon in vitro challenge with
Ag alone. IL-12Rß2 mRNA expression was dependent on the presence of
endogenous IL-12 because it was abrogated by the addition of
anti-IL-12. By contrast, IL-12Rß2 mRNA was only modestly induced
by the reactivation of T cells that had been primed with
MBP87106 in IFA only. However, when recombinant
IL-12 was added, these T cells up-regulated IL-12Rß2 mRNA expression
and secreted IFN-
to levels comparable with those of MBP-reactive T
cells that had been exposed to CpG ODN in vivo (Fig. 3
, A and B). More
importantly, the MBP87106/IFA primed LN cells
were able to transfer moderate-severe EAE in 100% of naive syngeneic
recipients after stimulation with IL-12 (Fig. 3
C).
|
and transferred EAE to naive
recipients after reactivation with IL-12, LN cells from
anti-IL-12-treated donors, that were restimulated in the presence
of IL-12, failed to produce IFN-
and were unable to induce EAE on
passive transfer (Fig. 4
|
| Discussion |
|---|
|
|
|---|
There is a wealth of circumstantial evidence supporting the conclusion that the major, if not the only, role of microbial adjuvants in EAE is to induce IL-12 production by APC during a crucial stage in the development of myelin-reactive T cells. We, as well as others, have established the importance of IL-12 in the pathogenesis of EAE (22, 23, 24, 25, 26). Furthermore, the disease-promoting actions of both CpG ODN/IFA and CFA correlate with their capacity to induce autoreactive Th1 differentiation, and neither adjuvant is effective in the absence of IL-12. Nonetheless, it is still possible that CpG ODNs stimulate APCs to produce other soluble factors such as type I IFNs or IL-18 (34, 35, 36, 37) and/or induce the expression of cell surface molecules such as MHC class II or CD80/CD86 (38) that act synergistically with IL-12 during autoimmune pathogenesis. It has also been recently reported that CpG ODNs provide potent growth and maturation signals for dendritic cells (39, 40), have direct effects on NK cells and B cells (41, 42, 43), and may have APC-independent effects on T cells (41, 44). The experimental model described in this study should prove to be very useful in determining which of the pleiotropic effects of CpG are most important in the activation of autoreactive T cells
For a control group in all of our studies, we immunized animals with Ag in IFA alone. IFA contains only mineral oil, which functions as a local Ag depot. T cells isolated from the draining LN of IFA immunized animals mounted as strong an Ag-specific lymphoproliferative response as T cells isolated from CFA-primed mice. Similar results were recently reported by other groups (13, 33). By contrast, several earlier studies found that immunization with Ags in the absence of microbial adjuvants lead to deletion, anergy, or active suppression of the targeted T cell population (14, 16, 45, 46, 47, 48, 49). In most of the latter studies, Ags were administered in relatively large quantities and delivered by alternate routes when used as a tolerogen in IFA as opposed to as an immunogen in CFA. The paradoxical outcomes may have resulted from the targeting of different classes of APCs in the spleen and LN, respectively.
Chu et al. (28) demonstrated that immunization of
mice with Ag in IFA, as opposed to CFA or CpG ODN/IFA, resulted in the
production of comparable amounts of total Ag-specific IgG but failed to
generate IFN-
producing LN cells (28). These results
and others (13, 15) have fostered the concept that T cells
primed by Ag in CFA exclusively differentiate along a Th1 pathway,
whereas those primed by Ag in IFA default to a Th2 lineage. In many of
these studies, a Th2 response is defined by the expansion of
IL-5-producing effector cells in the setting of a stable or diminished
IFN-
-producing population, and the induction of specific IgG1 but
not IgG2a Abs. Our results strongly suggest that the concept that
immunization with Ag in IFA results in a polar Th2 response is an
oversimplification. T cells harvested from the draining LNs of
MBP87106/IFA-primed mice appear to be in a
transitional state and have yet to undergo terminal differentiation
along a conventional Th pathway. After challenge in vitro, these cells
do not produce detectable levels of IFN-
, IL-4, or IL-10. Unlike Th2
cells, they express IL-12Rß2, but at a level that is considerably
lower than that expressed by typical Th1 cells primed with CpG ODN or
CFA. Nevertheless, the level is sufficient to permit Th1 autoimmune
effector differentiation after exposure to high doses of exogenous
IL-12 in vitro. The capacity of anti-IL-12 to prevent the
development of this unique population of cells after immunization with
Ag in IFA contradicts the view that they are Th2 precursors because
IL-12 antagonizes, rather than promotes, Th2 differentiation
(50).
One possible explanation for the differences between our results and those of Yip et al. (13) is that we have studied the response to an autoantigen, whereas they studied responses to foreign Ags. Autoreactive T cells that escape negative selection in the thymus tend to bear TCRs with a relatively low affinity (51). It is possible that the foreign Ag-reactive T cells which bear higher affinity TCR are more likely to produce IL-4 during in vivo priming in the absence of microbial adjuvants and, consequently, to commit to a Th2 phenotype. If lower affinity autoreactive T cells fail to secrete IL-4, they may maintain IL-12 receptor expression (although at a relatively low level) and subsequently be able to differentiate into Th1 cells when reactivated under polarizing conditions. Alternatively, immunization with Ag in IFA may result in a mixed Th response with partial activation of Th1 cells and more complete activation of Th2 cells irrespective of the nature of the Ag used as an immunogen.
Myelin-reactive T cells exist in healthy individuals
(52) and remain a potential reservoir of pathogenic
effectors which, when appropriately stimulated, could precipitate an
autoimmune state. We have previously characterized a population of T
cells in B.10.S mice after immunization with MBP in CFA (23, 29). These cells closely resemble the population of T cells
generated by immunization of SJL mice with MBP in IFA. Both populations
fail to produce IFN-
in vitro when restimulated with Ag, fail to
up-regulate their IL-12Rß2 chain, and fail to transfer EAE. Moreover,
after exposure to IL-12, both differentiate into pathogenic Th1
effector cells. Because some myelin Ags are expressed in peripheral
sites (53), it is possible that in healthy individuals
similar "benign" populations of autoreactive effector cells are
activated in a noninflammatory setting at some point during their life
spans. If this occurs, they would acquire the characteristics of memory
cells and thereby resemble the "pre-Th1" cells we have described.
Our data suggest that such T cells may be capable of fully
differentiating into Th1 effectors on reactivation in an inflammatory
milieu. Hence, our findings may explain, in part, the association
between autoimmune episodes and infectious illnesses/vaccinations
(1, 2, 3, 4, 5, 6, 7, 8, 9). They also raise a cautionary note regarding the
use of DNA vaccinations with vectors containing immunostimulatory CpG
motifs due to the possibility of triggering autoimmune phenomena in a
predisposed individual. It has recently been shown that bacterial DNA
can exacerbate Theilers virus murine encephalitis and can enhance
relapsing remitting EAE induced by immunization with proteolipid
protein (54).
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Ethan M. Shevach, Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Building 10, Room 11N315, Bethesda, MD 20892. ![]()
3 Abbreviations used in this paper: MS, multiple sclerosis; EAE, experimental allergic encephalomyelitis; LN, lymph node; MBP, myelin basic protein; ODN, oligodeoxynucleotide; IL-12Rß2, the ß2 subunit of the IL-12 receptor. ![]()
Received for publication November 22, 1999. Accepted for publication March 20, 2000.
| References |
|---|
|
|
|---|
production by stimulation of interleukin-12 and tumor necrosis factor-
. Cell. Immunol. 167:72.[Medline]
. Proc. Natl. Acad. Sci. USA 93:2879.
-producing cells and increased expression of macrophage-associated inducible nitric oxide synthase as immunomodulatory mechanisms. Am. J. Pathol. 148:375.[Abstract]
in host defense against mycobacteria and Salmonella in mice and men. Curr. Opin. Immunol. 11:346.[Medline]
-dependent mechanisms. Proc. Natl. Acad. Sci. USA 96:6970.
production in cells from allergic individuals and inhibit IgE synthesis in vitro. Eur. J. Immunol. 29:2344.[Medline]
production in vitro. J. Immunol. 163:3642.This article has been cited by other articles:
![]() |
M. A. Kroenke, T. J. Carlson, A. V. Andjelkovic, and B. M. Segal IL-12- and IL-23-modulated T cells induce distinct types of EAE based on histology, CNS chemokine profile, and response to cytokine inhibition J. Exp. Med., July 7, 2008; 205(7): 1535 - 1541. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Lampropoulou, K. Hoehlig, T. Roch, P. Neves, E. C. Gomez, C. H. Sweenie, Y. Hao, A. A. Freitas, U. Steinhoff, S. M. Anderton, et al. TLR-Activated B Cells Suppress T Cell-Mediated Autoimmunity J. Immunol., April 1, 2008; 180(7): 4763 - 4773. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Asagiri, T. Hirai, T. Kunigami, S. Kamano, H.-J. Gober, K. Okamoto, K. Nishikawa, E. Latz, D. T. Golenbock, K. Aoki, et al. Cathepsin K-Dependent Toll-Like Receptor 9 Signaling Revealed in Experimental Arthritis Science, February 1, 2008; 319(5863): 624 - 627. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Herrmann, M. Kellert, A. Spreer, J. Gerber, H. Eiffert, M. Prinz, and R. Nau Minocycline delays but does not attenuate the course of experimental autoimmune encephalomyelitis in Streptococcus pneumoniae-infected mice J. Antimicrob. Chemother., January 1, 2007; 59(1): 74 - 79. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Touil, D. Fitzgerald, G.-X. Zhang, A. Rostami, and B. Gran Cutting Edge: TLR3 Stimulation Suppresses Experimental Autoimmune Encephalomyelitis by Inducing Endogenous IFN-beta J. Immunol., December 1, 2006; 177(11): 7505 - 7509. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Herrmann, M. Kellert, H. Schmidt, A. Mildner, U. K. Hanisch, W. Bruck, M. Prinz, and R. Nau Streptococcus pneumoniae Infection Aggravates Experimental Autoimmune Encephalomyelitis via Toll-Like Receptor 2. Infect. Immun., August 1, 2006; 74(8): 4841 - 4848. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. V. Bagaeva, P. Rao, J. M. Powers, and B. M. Segal CXC chemokine ligand 13 plays a role in experimental autoimmune encephalomyelitis. J. Immunol., June 15, 2006; 176(12): 7676 - 7685. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Su, P. B. Silver, R. S. Grajewski, R. K. Agarwal, J. Tang, C.-C. Chan, and R. R. Caspi Essential Role of the MyD88 Pathway, but Nonessential Roles of TLRs 2, 4, and 9, in the Adjuvant Effect Promoting Th1-Mediated Autoimmunity J. Immunol., November 15, 2005; 175(10): 6303 - 6310. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wang, S. A. John, J. L. Clements, D. H. Percy, K. P. Barton, and L. A. Garrett-Sinha Ets-1 deficiency leads to altered B cell differentiation, hyperresponsiveness to TLR9 and autoimmune disease Int. Immunol., September 1, 2005; 17(9): 1179 - 1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, J. S. Heuser, S. D. Kosanke, M. Hemric, and M. W. Cunningham Protection against Experimental Autoimmune Myocarditis Is Mediated by Interleukin-10-Producing T Cells that Are Controlled by Dendritic Cells Am. J. Pathol., July 1, 2005; 167(1): 5 - 15. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Visser, H. Jan de Heer, L. A. Boven, D. van Riel, M. van Meurs, M.-J. Melief, U. Zahringer, J. van Strijp, B. N. Lambrecht, E. E. Nieuwenhuis, et al. Proinflammatory Bacterial Peptidoglycan as a Cofactor for the Development of Central Nervous System Autoimmune Disease J. Immunol., January 15, 2005; 174(2): 808 - 816. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zipris, E. Lien, J. X. Xie, D. L. Greiner, J. P. Mordes, and A. A. Rossini TLR Activation Synergizes with Kilham Rat Virus Infection to Induce Diabetes in BBDR Rats J. Immunol., January 1, 2005; 174(1): 131 - 142. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Darabi, A. Y. Karulin, B. O. Boehm, H. H. Hofstetter, Z. Fabry, J. C. LaManna, J. C. Chavez, M. Tary-Lehmann, and P. V. Lehmann The Third Signal in T Cell-Mediated Autoimmune Disease? J. Immunol., July 1, 2004; 173(1): 92 - 99. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Conant and R. H. Swanborg Autoreactive T Cells Persist in Rats Protected against Experimental Autoimmune Encephalomyelitis and Can Be Activated through Stimulation of Innate Immunity J. Immunol., May 1, 2004; 172(9): 5322 - 5328. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shao, S. Lei, S. L. Sun, J. Xiang, H. J. Kaplan, and D. Sun CpG-Containing Oligodeoxynucleotide 1826 Converts the Weak Uveitogenic Rat Interphotoreceptor Retinoid-Binding Protein Peptide 1181-1191 into a Strong Uveitogen J. Immunol., November 1, 2003; 171(9): 4780 - 4785. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. P. Ho, P. Fontoura, P. J. Ruiz, L. Steinman, and H. Garren An Immunomodulatory GpG Oligonucleotide for the Treatment of Autoimmunity via the Innate and Adaptive Immune Systems J. Immunol., November 1, 2003; 171(9): 4920 - 4926. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lundberg, P. Welander, X. Han, and E. Cantin Herpes Simplex Virus Type 1 DNA Is Immunostimulatory In Vitro and In Vivo J. Virol., October 15, 2003; 77(20): 11158 - 11169. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Gursel, M. Gursel, H. Yamada, K. J. Ishii, F. Takeshita, and D. M. Klinman Repetitive Elements in Mammalian Telomeres Suppress Bacterial DNA-Induced Immune Activation J. Immunol., August 1, 2003; 171(3): 1393 - 1400. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Steinman Optic Neuritis, A New Variant of Experimental Encephalomyelitis, A Durable Model for All Seasons, Now In Its Seventieth Year J. Exp. Med., May 5, 2003; 197(9): 1065 - 1071. [Full Text] [PDF] |
||||
![]() |
C. Deng, C. Radu, A. Diab, M. F. Tsen, R. Hussain, J. S. Cowdery, M. K. Racke, and J. A. Thomas IL-1 Receptor-Associated Kinase 1 Regulates Susceptibility to Organ-Specific Autoimmunity J. Immunol., March 15, 2003; 170(6): 2833 - 2842. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. T. Ichikawa, L. P. Williams, and B. M. Segal Activation of APCs Through CD40 or Toll-Like Receptor 9 Overcomes Tolerance and Precipitates Autoimmune Disease J. Immunol., September 1, 2002; 169(5): 2781 - 2787. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Dalpke, M. K.-H. Schafer, M. Frey, S. Zimmermann, J. Tebbe, E. Weihe, and K. Heeg Immunostimulatory CpG-DNA Activates Murine Microglia J. Immunol., May 15, 2002; 168(10): 4854 - 4863. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lassmann, C. Kincaid, V. C. Asensio, and I. L. Campbell Induction of Type 1 Immune Pathology in the Brain Following Immunization Without Central Nervous System Autoantigen in Transgenic Mice With Astrocyte-Targeted Expression of IL-12 J. Immunol., November 1, 2001; 167(9): 5485 - 5493. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Howard and S. D. Miller Autoimmune Intervention by CD154 Blockade Prevents T Cell Retention and Effector Function in the Target Organ J. Immunol., February 1, 2001; 166(3): 1547 - 1553. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |