| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Lymphocyte Biology Unit, Swiss Institute for Experimental Cancer Research; and
Ludwig Institute for Cancer Research, Lausanne Branch, University of Lausanne, Epalinges, Switzerland
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(CD25),3 IL-2Rß, and
the common 
-chain (c). Resting, naive T
cells express low levels of IL-2Rß, but no CD25 chain. Upon antigenic
stimulation, IL-2Rß expression increases, and the CD25 chain appears
on the cell surface. Together with the c these
molecules can form a high affinity IL-2R. The IL-2R ß-chain is shared
by the IL-15R (1). The c also
participates in the formation of the receptors for IL-4, IL-7, IL-9,
and IL-15 (2), and it is constitutively expressed on most
blood cells. In the absence of CD25, the IL-2R ß-chain and the
c can form, at least in man, an intermediate
affinity IL-2R, stimulation of which enhances the survival of human
peripheral blood T cells (3, 4, 5). Thus, in T cells high levels of IL-2Rß and expression of CD25 correlate with the capability to proliferate in response to IL-2. This raises the question of whether expression of a high affinity IL-2R is not only necessary but also sufficient to render T cells IL-2 responsive. Early experiments with transgenic mice constitutively expressing CD25 and/or IL-2R ß-chains indicated that a fraction of CD8+ T cells from these animals were constitutively IL-2 responsive (6, 7, 28). Recently, Zhang et al. (8) showed that a fraction of CD8+ T cells from normal mice can proliferate in response to IL-15 without antigenic stimulation. They observed that CD8+CD44high T cells express higher levels of IL-2R ß-chain than other peripheral T cells and interpreted their findings to suggest that the expression of a functional IL-2R or IL-15R on the cell surface is sufficient to render cells competent to enter the cell cycle in response to IL-2 or IL-15.
We have used transgenic mice that express a receptor chimera consisting
of the intracellular domain of the IL-2R ß-chain and the
extracellular part of the human IL-4R (hIL-4R/IL-2Rß) to address this
question directly. The hIL-4R/IL-2R ß-chain requires the
constitutively expressed endogenous c, but not
the CD25, IL-15R -chain, or IL-2R ß-chain, to transmit signals in
response to human IL-4 (hIL-4). These signals are expected to be
identical with those induced by IL-2 or IL-15 via their natural high
affinity receptors. The affinity of the chimeric receptor for hIL-4 is
expected to be similar (Kd = 25 pM)
(9) to the affinity of the high affinity IL-2R
(Kd = 10 pM). Preliminary experiments
showed that in IL-2-dependent mouse cell lines the receptor chimera
could deliver IL-2 signals when stimulated with hIL-4 (Ref.
9 and our unpublished results). To constitutively express
the chimeric receptor on T cells, we constructed a vector that
expresses the receptor chimera from the promoter of the human CD2 gene
under the control of the CD2 locus control region. Analogous constructs
have been shown to be expressed homogeneously on peripheral
CD4+ and CD8+ T cells
(10). Because the hIL-4R does not bind mouse IL-4 (mIL-4),
we did not expect any in vivo stimulation of the transgenic T cells by
endogenous mIL-4. Any effect of hIL-4 on these cells must be due to the
signal transducing competence of the receptor chimera.
We show that a fraction of CD8+ T cells that overlaps with memory cells, but not CD4+ or naive CD8+ T cells, is competent to proliferate in response to hIL-4 without any requirement for antigenic stimulation. However, our experiments demonstrate that expression of a functional receptor is not sufficient to make most T cells IL-2 responsive. Our results provide an explanation for the early observations with mice constitutively expressing CD25 and/or IL-2R ß-chains (6, 7) as well as for the results of Zhang et al. (8).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C57BL/6(H-2b) and CBA-J (H-2k) mice were purchased from Harlan (Zeist, The Netherlands). Mice were maintained on standard laboratory chow and water ad libitum in a temperature- and light-controlled environment.
hIL-4R/IL-2Rß construction
For construction of the hIL-4R/hIL-2Rß chimera, a full-length hIL-4R cDNA fragment was excised from plasmid phIL-4REP5AB (11) with Asp718 and BglII, and ends were filled in with T4 DNA polymerase. A full-length hIL-2Rß cDNA was excised from phIL-2RßCDM8 (12) with HindIII and NotI, and the cleavage sites were filled in. Both receptor cDNAs were inserted into EcoRV-cleaved pBluescript SK+/-. An exact fusion between the extracellular region of hIL-4R and the transmembrane region of hIL-2Rß was made by overlap extension PCR (13) using the fusion primer GCCCTTCGAGCAGCACCTCATTCCGTGGCTCGGC, in which the underlined bases are complementary to the IL-2Rß and the T7 primer (Life Technologies, Basel, Switzerland) to amplify the transmembrane domain and the intracellular domain of the IL-2R ß-chain. The fusion primer GCCGAGCCACGGAATGAGGTGCTGCTCGAAGGG, in which the underlined bases are complementary to the hIL-4R, and the T3 primer were used to amplify the extracellular part of the IL-4R. An EcoRI-HindIII fragment of the fusion receptor was inserted into pBluescript SK+/-. The sequence of the receptor was checked by DNA sequencing. The receptor was excised from pBluescript SK+/- by BssH II/HindIII cleavage and was inserted into the SmaI-cleaved hCD2 minigene vector. The hIL-4R/hIL-2Rß-CD2 cDNA was isolated from the hCD2 minigene vector containing the fusion receptor as described previously (10).
Transgenic animals
Transgenic DBA/2 x C57BL/6 F1 mice were generated according to published procedures (14, 15). The presence of the transgene in the offspring was assessed by Southern blot analysis of genomic DNA isolated from mouse tails (14) and was digested to completion with EcoRI and BamHI. A fragment of 2.6 kb indicated the presence of the transgene. Comparison of the intensity of the bands with a control digestion of the construct used for injections, evaluated with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA), allowed estimation of transgene copy number. Transgenic founders were backcrossed to C57BL/6 mice.
Flow cytometric analysis and FACS
Spleen or peripheral blood lymphocytes or Con A-activated blast
cells were isolated by Ficoll-Hypaque gradient centrifugation. The
following Abs were used for cell surface staining: FITC-conjugated
anti-CD8 (H35-17.2) and anti-CD4 (GK1.5; both conjugated by
A.-L. Peitrequin, Ludwig Institute, Epalinges, Switzerland) for flow
cytometric analysis; anti-CD8 (53.6.7.) or anti-CD4 (RM4-5)
conjugated to PE (both from PharMingen, San Diego, CA) for FACS
sorting; anti-CD44 conjugated to Cy-Chrome (1 M7, PharMingen);
anti-hIL-4R (MAB230, R & D Systems, Minneapolis, MN);
anti-mIgG2A-PE (Southern Biotechnology Associates, Birmingham, AL);
anti-CD25-PE (PC61, conjugated by A.-L. Peitrequin) or
anti-CD25-Cy5 (PC61, conjugated by A. Wilson, Ludwig Institute)
(16); and anti-IL-2R ß-chain-PE (TM-ß1,
PharMingen); anti-c-biotin (4G3,
PharMingen). Biotinylated Abs were detected with streptavidin-PE
(Caltag Laboratories, San Francisco, CA). Purified lymphocytes were
stained with excess concentrations of Abs at 4°C for 30 min. Flow
cytometry was performed with a FACScalibur for three-color analysis
involving Cy5 staining or with a FACScan (both from Becton Dickinson,
Sunnyvale, CA) using CellQuest and WinMDI 2.8 software. FACS sorting
was performed with a FACS II, B-D system (Becton Dickinson).
CD8+CD44high T cells included 10–20% of the most strongly CD44-positive CD8+ cells; CD8+CD44low T cells included 50–60% of the CD8+ T cells with the lowest CD44 expression. The remaining 20–40% of CD8+CD44intermediate CD8+ T cells were rejected.
For counting of living CD4+ T cells, cells were resuspended in 200 µl of PBS containing 10 µg/ml propidium iodide and 200,000 microsphere particles (Molecular Probes, Eugene, OR), clearly distinguishable from the cells in forward/side scatter plots. The ratio of microsphere particles to living cells per culture was determined on day 0. On consecutive days the number of surviving cells was estimated from the ratio of microsphere particles to cells excluding propidium iodide.
Cell culture
Single-cell suspensions were prepared from spleens from
transgenic or control mice and passed over Ficoll-Hypaque to remove
erythrocytes and dead cells. Cells were cultured in DMEM-Glutamax (Life
Technologies) supplemented with 10% heat-inactivated FCS, 50 µM
2-ME, 10 mM HEPES, 100 µg/ml gentamicin (Life Technologies), and 50
µg/ml penicillin-gentamicin sulfate (Life Technologies). For
5-carboxyfluorescein diacetate-succinimidyl ester (CFSE) staining,
5 x 107 cells/ml were suspended in PBS.
CFSE was added to a final concentration of 5 µM, and the suspension
was incubated at 37°C for 10 min. To remove free CFSE, cells were
immediately washed three times in cold medium (17). Con A
(Sigma, St. Louis, MO) blasts were prepared by culturing
105/ml spleen cells for 24 h in the presence
of 2.5 µg/ml Con A, anti-mIL2 mAb S4B6.1 (18), and
anti-mCD25 mAb 5A2 (19). Cells were then washed once
with 10 mM -methyl-D-mannosidase (Sigma) to remove bound
Con A and were passed over Ficoll-Hypaque. Subsequently, cells were
cultured in medium containing IL-2-blocking Abs, IL-2 (200 U/ml), or
hIL-4 (400 U/ml) together with IL-2-blocking Abs. Blocking Abs and ILs
were added daily. After culture for 48 h, living cells were
recovered by Ficoll-Hypaque gradient centrifugation and stained for
flow cytometric analysis.
To compare responsiveness to hIL-15 and hIL-4, transgenic and normal spleen cells were passed over Ficoll-Hypaque and sorted by FACS. The sorted cells were labeled with CFSE (5 µM), washed, and cultured in medium alone or in the presence of IL-2 (200 U/ml), hIL-4 (200 U/ml), hIL-15 (200 ng/ml), or hIL-4 (200 U/ml) plus hIL-15 (200 ng/ml). ILs were replenished after 48 h. The CFSE intensity of living cells (excluding propidium iodide) was analyzed by flow cytometry before culture and after 24, 48, and 72 h of culture in the presence of a constant number of added microsphere particles to estimate the recovery of living cells (see above).
Cytokines
Recombinant hIL-2 was provided by Glaxo (Geneva, Switzerland), and hIL-4, in the form of culture supernatants, was supplied by Christoph Heusser (Novartis, Basel, Switzerland). The ED50 values of hIL-4 and IL-2 were determined by the dose-dependent proliferation of the IL-4-dependent CT.4S cell line and the IL-2-dependent proliferation of CTLL-2 cells. Supernatant containing 10 µg/ml hIL-15 was provided by Immunex (Seattle, WA).
Limiting dilutions of mixed lymphocyte cultures
FACS-sorted cells were seeded at various concentrations (1–1000 cells/well) in round-bottom microplates (Costar, Cambridge, MA) containing 0.5–1 x 106 irradiated (5000 rad) allogeneic (CBA-J, H-2k), syngeneic (derived from the T cell donor animal, H-2b/d), or histocompatible (C57BL/6, H-2b) spleen cells in a final volume of 0.2 ml of medium, supplemented with IL-2 (200 U/ml) or hIL-4 (200 U/ml). IL-2 and hIL-4 were replenished weekly. Plates were wrapped in aluminum foil and incubated at 37°C in a humidified atmosphere of 5% CO2 in air. Between weeks 2 and 4 after setting up the cultures, wells were periodically scored for proliferation by microscopic examination. The frequency of proliferating T cells was estimated by taking the percentages of nonresponding cultures as the zero terms of Poisson distributions. The raw data were processed according to Taswell (20).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The chimeric receptor construct (Fig. 1
A) codes for a protein in
which the extracellular part of the hIL-4R is fused to the
transmembrane stretch and the cytoplasmic portion of the hIL-2R
ß-chain. To limit expression of the chimeric receptor to lymphocytes,
we inserted the chimera into a vector containing the promoter and the
3'-locus control region of the human CD2 gene (Fig. 1B). CD2
minigenes are expressed in both early and late stages of T cell
development as well as in B and NK cells (10). We obtained
two founder mice carrying an estimated six and nine copies of the
transgene (Fig. 1C), which were transmitted through the
germline with normal Mendelian ratios. As expected, the transgenic mice
appeared normal with regard to behavior, life span, and physiology.
Lymphocyte numbers and T cell subset distribution were normal in both
lines (data not shown).
|
Expression of the transgene in T cells was monitored by flow
cytometry using an Ab directed against the hIL-4R (Fig. 2). The chimeric receptor was expressed
on all peripheral T lymphocytes. There was no difference between
expression levels on CD44low and
CD44high subsets of CD4+
and CD8+ T cells. B cells also expressed the
chimera, but at lower levels (data not shown).
|
c,
which is required for the formation of a functional chimeric receptor,
was expressed at equivalent levels on all T cells. IL-2Rß expression
was barely detectable on CD44low subsets. As
reported by Zhang et al. (8), both
CD4+CD44high and
CD8+CD44high T cells
clearly expressed IL-2Rß, and levels in the latter subset were
considerably higher. In contrast to Zhang et al., we did not observe
any detectable CD25 expression on the CD44high
subsets of transgenic mice or their nontransgenic littermates. Because
CD25 expression is the transient consequence of T cell activation, this
difference raises the possibility that the
CD44high T cells of the mice described by these
workers had recently been exposed to Ag, whereas this was apparently
not the case in the animals used in our study. The chimeric receptor can substitute for the endogenous high affinity IL-2R
Preliminary experiments with an IL-2-dependent mouse CTL line transduced with the chimeric receptor construct showed that hIL-4 could substitute for IL-2 as a growth factor for these cells. This cell line allowed us to titer the hIL-2 and hIL-4 preparations used subsequently and to make sure that equivalent concentrations of these cytokines were added in the experiments with cells from transgenic mice described below.
To test whether the hIL-4R/IL-2Rß chimera can induce a similar
proliferative response as the endogenous high affinity IL-2R in normal
T cells we primed freshly isolated control or transgenic T cells to
become IL-2 responsive by culturing them for 24 h in Con A. To
prevent auto- and paracrine stimulation by IL-2, a combination of
neutralizing anti-mouse IL-2 and IL-2R Abs was added. The primed
cells were cultured for an additional 48 h either in IL-2 without
Abs or with hIL-4 in the presence of the Abs that block the effects of
IL-2. To follow cell division, cells were labeled with CFSE before
priming. Comparison of the CFSE fluorescence histogram of Con A-primed
cells cultured in the absence of IL-2 or hIL-4 with that of
unstimulated cells showed that Con A priming did not induce any cell
division (Fig. 3A). This shows
that the blocking effect of the Abs against IL-2 and the IL-2R is
complete. Human IL-4 has no effect on nontransgenic cells, whereas it
drives primed transgenic T cells through exactly the same number of
divisions as IL-2. Growth of CD8+ T cells
stimulated with either IL-2 or hIL-4 was faster than that of
CD4+ T cells. The average doubling time of
CD8+ T cells was 12 h, compared with
17.3 h for CD4+ T cells. This is consistent
with the previously observed difference between the proliferation rates
of CD4+ and CD8+ T cells
stimulated with anti-CD3 Abs and cultured in IL-2
(21).
|
B). Human IL-4 had no effect on nontransgenic control
cells. Thus, by two criteria hIL-4 has the same effect on
hIL-4R/IL-2Rß-expressing T cells as IL-2. Most transgenic T cells need Ag stimulation to proliferate in response to hIL-4
IL-2 does not stimulate proliferation of naive T cells unless they
have been activated with Ag or reagents that mimic antigenic triggering
(anti-CD3, Con A). Ag activation results in the appearance of the
CD25 chain and increased expression of the IL-2R ß-chain. Together
with the constitutively expressed c, these
subunits can form a high affinity IL-2R. Having shown that the
hIL-4R/IL-2R ß-chain can form a receptor competent to induce T cell
proliferation, we tested whether the constitutive expression of the
chimera on freshly isolated T cells would render these cells capable of
proliferating without any requirement for antigenic triggering. To
address this question, CFSE-labeled spleen cells were cultured in
medium containing IL-2 or hIL-4 and blocking Abs. Analysis of CFSE
fluorescence after 72 h showed that neither
CD4+ nor most CD8+ T cells
had undergone any cell division (Fig. 8 and data not shown).
Furthermore, the cytokines did not induce detectable CD25
expression.
|
). FACS-sorted normal and transgenic
CD4+ T cells were labeled with CFSE and cultured
in medium alone or in medium containing hIL-4. Using propidium iodide
to exclude dead cells and a standard consisting of microsphere
particles (see Materials and Methods), living T cells were
counted on the following days by FACS. Without ILs or in the presence
of 200 U/ml IL-2 (data not shown), <5% of the cells survived until
day 6, whereas 50% of the transgenic T cells cultured in hIL-4 were
still alive. Monitoring CFSE fluorescence confirmed that the survivors
had not undergone any cell division (data not shown). A similar effect
of high doses of IL-2 on survival has been described for human T cells
(3, 4, 5). This result shows that the hIL-4R/IL-2Rß chimera
is able to form a functional receptor on resting T cells, but cannot
transmit all signals required for entry into the cell cycle. At least
one Ag induced change, apart from the induction of the IL-2R chains, is
required to allow a T cell to proliferate in response to IL-2.
|
The results described above show that the chimeric receptor can
transmit the same signals as IL-2 in Con A-activated T cells. To
compare the efficiency of the chimeric receptor with the endogenous
IL-2R more quantitatively, we resorted to a limiting dilution
microculture system described previously (23). Graded
numbers of FACS-sorted CD4+ and
CD8+ T cells (>99% pure) were cultured in
96-well plates with irradiated allogeneic spleen cells in the presence
of IL-2 or hIL-4. As previously described, in this system proliferation
of alloresponsive normal T cells is strictly dependent on the addition
of IL-2. After 14–21 days, microcultures were scored for proliferation
by microscopic examination. The frequency of responding, colony-forming
T cells (plating efficiency) was calculated according to the method of
Taswell (20). In all experiments presented in this paper
the results obtained with the two transgenic lines fell within the same
95% confidence limits. The results from one such experiment are shown
in Fig. 5A, and the results of
three independent experiments are summarized in Fig. 5B. The
frequency of alloresponsive CD4+ and
CD8+ T cells growing in the presence of IL-2
falls into the normal range (24). Human IL-4 did not
support the proliferation of nontransgenic T cells, while the frequency
of transgenic CD4+ T cells growing in hIL-4 was
comparable to that of IL-2-responsive nontransgenic T cells.
Surprisingly, the frequency of IL-2-responsive transgenic
CD4+ T cells was 2 times lower. Similarly, we
observed a slightly lower (1.2-fold) plating efficiency of transgenic
CD8+ T cells in IL-2. The same differences were
found with both transgenic lines. Strikingly, the plating efficiency of
transgenic CD8+ T cells in hIL-4 was 3 times
higher than that of normal CD8+ T cells in
IL-2.
|
A and 6A). These results indicate that
about 1% of transgenic CD8+ T can proliferate in
hIL-4 without any antigenic stimulus. Similar plating efficiencies were
obtained with CD8+ T cells from transgenic mice
of H-2b/d background that were cultured together
with autologous stimulator cells (data not shown). Because the same
cells failed to respond to IL-2, it is unlikely that they were recently
activated T cells. Statistical analysis showed that the data could be
fitted to a single-hit Poisson distribution (Fig. 6), indicating that single T cells gave
rise to colonies and that plating efficiency was not affected by
interactions between T cells.
|
Limiting dilution analysis of transgenic
CD8+CD44low and
CD8+CD44high T cells in the
presence of hIL-4 and syngeneic feeder cells showed that
CD44high T cells had a 7-fold higher plating
efficiency (1/280:1/38; Fig. 6). No colonies could be detected when
cells were cultured in medium alone or in medium containing
IL-2.
Neither CD4+CD44low nor CD4+CD44high T cells gave rise to detectable colonies when plated on syngeneic irradiated spleen cells in hIL-4 (data not shown). Thus, the ability to proliferate in hIL-4 without antigenic stimulation is restricted to CD8+ T cells the majority of which belong to the CD44high subset.
Ag-independent hIL-4-stimulated proliferation of transgenic CD8+CD44high T cells does not require feeder cells
To test whether feeder cells are needed to support proliferation
of transgenic hIL-4-responsive CD8+ T cells, we
set up a limiting dilution analysis in which total
CD8+,
CD8+CD44low, and
CD8+CD44high T cells were
cultured in hIL-4 without any feeder cells. The plating efficiencies
thus determined for the different populations were comparable to those
observed in the limiting dilutions with syngeneic feeder cells (compare
Figs. 6 and 7). No growth was observed in
medium with or without IL-2.
|
Human IL-4-responsive CD8+CD44high T cells belong to the same population that responds to hIL-15 without Ag stimulation
A recent report showed that a subset of CD8+
T cells responds to IL-15 without prior Ag activation (8).
The authors hypothesized that the responsive cells belonged to the
CD44+ subset of CD8+ cells,
but they did not verify this by sorting the subset before stimulation.
Nevertheless, it appeared plausible that the constitutively
hIL-4-responsive transgenic T cells might be the same as the
constitutively IL-15-responsive cells detected by Zhang and co-workers.
To test this conjecture we compared the proliferative responses of
CFSE-stained transgenic, FACS-sorted
CD8+CD44high T cells to
hIL-4, hIL-15, and a combination of both. As shown in Fig. 8, the combination of hIL-15 and hIL-4
induced the appearance of a population of larger cells (blasts), as
measured by forward scatter. Stimulation with either cytokine alone
resulted in the same size shift in a virtually identical fraction of
cells. IL-2 did not induce the appearance of blasts. The histograms in
the middle and right columns of Fig. 8 show that
the blasts cultured in hIL-15 or hIL-4 underwent exactly the same
number of divisions. Combined addition of the two ILs did not change
the response; no additive effect was observed. IL-2 or medium alone did
not induce proliferation of the same cells (data not shown). A similar
CFSE profile was obtained when nontransgenic
CD8+CD44high T cells were
cultured in hIL-15 or hIL-4 plus hIL-15, but hIL-4 did not lead to
proliferation (data not shown). FACS-sorted
CD8+CD44low cells did not
proliferate under any of the conditions described here (data not
shown). Taken together these data show that, as postulated by Zhang et
al. (8), constitutively IL-15-responsive
CD8+ T cells are already
CD44high before culture. In addition, our results
indicate that in hIL-4R/IL-2Rß transgenic mice these cells are
identical with the constitutively hIL-4-responsive cells.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
c that is constitutively expressed on all T
cells. Because of the species specificity of the IL-4R the chimera does
not respond to mIL-4, and cells from nontransgenic mice do not respond
to hIL-4 in any of the assays used. We have found that the hIL-4R/IL-2Rß chimera can fully substitute for the IL-2R in two assays: 1) hIL-4, in the presence of Abs preventing auto- or paracrine stimulation by IL-2, drives Con A-primed CD4+, and CD8+ T cells through the same number of cell divisions as IL-2; and 2) hIL-4 stimulates CD25 expression on Con A-primed transgenic T cells to exactly the same degree as IL-2.
Because both the chimera and the c are
constitutively expressed on all T cells, naive transgenic T cells
should express a functional receptor that can transmit the same signals
as the high affinity IL-2R present on activated, but not naive, T
cells. However, in bulk cultures freshly isolated
CD4+ or CD8+ transgenic T
cells do not proliferate when cultured in hIL-4 without Con A, nor did
hIL-4 induce the expression of the CD25 chain. Nevertheless, the
chimeric receptor was not only expressed but was also functional on
resting T cells, because hIL-4 strongly enhanced the survival of
transgenic T cells cultured in the absence of Con A or Ag. This effect
is similar to that which high doses of IL-2 exert on human peripheral T
cells (3, 4, 5), presumably through intermediate affinity
IL-2R formed by the IL-2R ß-chain and the c
in the absence of CD25. Con A priming does not affect the levels of
expression of the hIL-4R/IL-2Rß chimera (data not shown) or the
c (Ref. 27 and our unpublished
results). Although we have not tested this directly, it is unlikely
that the affinity of the receptor formed by the hIL-4R/IL-2Rß chimera
is different on resting and activated cells. Thus, our results are
consistent with earlier observations of T cells from transgenic mice
expressing the hCD25 and/or IL-2R ß-chains (6, 7, 28).
They indicate that expression of a functional receptor with the same
cytoplasmic domains as the IL-2R is not sufficient to make a T cell
competent to proliferate in response to signals transduced by this
receptor. IL-2-induced proliferation of normal T cells requires, apart
from the expression of CD25 and an increase in IL-2Rß, at least one
other Con A- or Ag-activated change, such as the expression of a
cytoplasmic signaling component. A likely candidate is JAK3, the JAK
family member that associates specifically with the
c. In IL-2-dependent T cell lines JAK3 is
essential for IL-2-driven cell proliferation (29). There
is no detectable JAK3 in naive T cells, but its appearance is induced
by Ag (4). Other molecules, such as c-Myc, c-Fos, and
c-Jun, that are barely expressed in resting T cells and become
up-regulated in response to antigenic stimulation (30, 31)
may also be required to make T cells capable of entering the cell cycle
in response to IL-2. The hIL-4R/IL-2Rß-expressing mice described here
provide a useful tool to investigate the roles of these components in
IL-2 signal transduction.
We have quantified the frequencies of CD4+ and
CD8+ T cells that respond to IL-2 or hIL-4 using
limiting dilution analysis. Transgenic CD4+ T
cells stimulated with MHC-incompatible splenocytes respond to both IL-2
and hIL-4. The frequency of hIL-4-responsive T cells was the same as
that of IL-2-responsive nontransgenic CD4+ T
cells, whereas the frequency of IL-2-responsive transgenic cells was 2
times lower. A similar difference was not observed between normal and
transgenic CD8+ T cells. Because the association
of the c with the IL-2R ß-chain is expected
to be ligand dependent (32), it is unlikely that the lower
IL-2 responsiveness of transgenic CD4+ T cells is
due to competition between endogenous IL-2Rß and transgenic
hIL-4R/IL-2R ß-chain for the c. It is,
however, possible that hIL-4R/IL-2R ß-chain competes with the
endogenous IL-2R ß-chain for receptor-associated signal transducers
that are limiting in CD4+, but not in
CD8+, T cells.
There are about 3 times as many transgenic CD8+ T cells responding to hIL-4 as to IL-2. Frequency analysis shows that most of the transgenic CD8+ T cells that proliferate in response to hIL-4 require neither allogeneic stimulators nor syngeneic feeder cells. The observation that they fail to proliferate in IL-2 indicates that they are not recently activated T cells. By separating transgenic CD8+ T cells according to CD44 expression we could show that there were about 7 times more cells proliferating in hIL-4, independently of Ag activation, in the CD44high subset than among the CD8+CD44low T cells. CD44 is up-regulated rapidly after antigenic stimulation of T cells, and the expression level remains elevated, in contrast to other activation markers such as CD69 or CD25 (25, 26, 33). These results indicate that signaling through the hIL-4R/IL-2Rß chimera can induce the proliferation of Ag-experienced CD8+ T cells that are no longer IL-2 responsive. The low plating efficiency of the hIL-4-responsive CD8+ T cells suggests that they belong to a particular subset of the CD44high population, but further cell fractionation experiments are required to confirm this hypothesis.
Zhang et al. (8) have recently postulated that
CD8+CD44high T cells
respond to IL-15 without Ag activation. By sorting
CD8+CD44high T cells before
cultivation we showed that this is indeed true, and that among
hIL-4R/IL-2Rß+ transgenic T cells the
hIL-15-responsive cells are most likely identical with the ones that
constitutively respond to hIL-4.
CD8+CD44high T cells
express higher levels of IL-2Rß than other T cell subsets, and
because the IL-2R ß-chain forms part of the IL-15R, Zhang and
co-workers have speculated (8) that the constitutive IL-15
responsiveness of some CD8+ T cells is simply the
result of an increased level of functional receptors. Our results
strongly argue against the hypothesis that the ability of IL-2 or IL-15
to drive cells through the cell cycle depends only on the expression
level of their receptors. All T cell subsets express similar levels of
hIL-4R/IL-2Rß-chain and c, and the chimeric
receptor drives proliferation of all CD4+ and
CD8+ T cells once they are activated by Con A.
However, only cells belonging to the
CD8+CD44high subset
proliferate in response to signals from this receptor without antigenic
stimulation. These cells apparently express all the components required
for the transduction of IL-2 signals that induce cell proliferation,
whereas most naive T cells and
CD4+CD44high T cells lack
at least one of the components.
We found, however, that a low frequency of CD8+CD44low T cells could grow in response to hIL-4 without antigenic stimulus. Additional experiments are required to determine whether these cells are indeed naive cells or, e.g., express isoforms of CD44 (34, 35) that react poorly with the anti-CD44 Ab used.
If our observation that the chimeric receptor is able to trigger the proliferation of a fraction of CD8+ T cells with memory phenotype independently of Ag and feeder cells holds true for human T cells expressing an analogous chimeric receptor (mIL-4R/IL-2Rß), this would have very useful clinical applications. Ex vivo analysis has shown that human tumor-specific CTL express cell surface markers of Ag-experienced cells (36). Thus, transduction of human tumor-specific T cell with such a chimera would presumably render in vitro expansion of such cells much simpler and cheaper, because they are expected to grow in mIL-4 without any requirement for periodic reactivation via the TCR. Furthermore, it should be possible to stimulate adoptively transferred T cells expressing the mIL-4R/IL-2Rß chimera in the patient by administration of mIL-4, which is not expected to have the severe toxic effects of hIL-2.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Markus Nabholz, Lymphocyte Biology Unit, Swiss Institute for Experimental Cancer Research, CH-1066 Epalinges, Switzerland.
3 Abbreviations used in this paper: CD25, IL-2R -chain; c, common -chain; hIL-4, human IL-4; mIL-4, mouse IL-4; CFSE, 5-carboxyfluorescein diacetate-succinimidyl ester.
Received for publication December 27, 1999. Accepted for publication March 20, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-chain transgenic mice. J. Immunol. 144:3809.[Abstract]
and ß chain cDNA’s. Science 244:551. chain in various cell populations of the thymus and spleen. Eur. J. Immunol. 24:2026.[Medline]
This article has been cited by other articles:
|
|
 |
|
  S. Dhanji, M. T. Chow, and H.-S. Teh Self-Antigen Maintains the Innate Antibacterial Function of Self-Specific CD8 T Cells In Vivo J. Immunol., July 1, 2006; 177(1): 138 - 146. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Gesbert, J.-L. Moreau, and J. Theze IL-2 Responsiveness of CD4 and CD8 lymphocytes: further investigations with human IL-2R{beta} transgenic mice Int. Immunol., August 1, 2005; 17(8): 1093 - 1102. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Dhanji and H.-S. Teh IL-2-Activated CD8+CD44high Cells Express Both Adaptive and Innate Immune System Receptors and Demonstrate Specificity for Syngeneic Tumor Cells J. Immunol., October 1, 2003; 171(7): 3442 - 3450. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ilangumaran, S. Ramanathan, J. La Rose, P. Poussier, and R. Rottapel Suppressor of Cytokine Signaling 1 Regulates IL-15 Receptor Signaling in CD8+CD44high Memory T Lymphocytes J. Immunol., September 1, 2003; 171(5): 2435 - 2445. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Berard, K. Brandt, S. B. Paus, and D. F. Tough IL-15 Promotes the Survival of Naive and Memory Phenotype CD8+ T Cells J. Immunol., May 15, 2003; 170(10): 5018 - 5026. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Oh, J. A. Berzofsky, D. S. Burke, T. A. Waldmann, and L. P. Perera Coadministration of HIV vaccine vectors with vaccinia viruses expressing IL-15 but not IL-2 induces long-lasting cellular immunity PNAS, March 18, 2003; 100(6): 3392 - 3397. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Vivien, C. Benoist, and D. Mathis T lymphocytes need IL-7 but not IL-4 or IL-6 to survive in vivo Int. Immunol., June 1, 2001; 13(6): 763 - 768. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. A. Fehniger, K. Suzuki, A. Ponnappan, J. B. VanDeusen, M. A. Cooper, S. M. Florea, A. G. Freud, M. L. Robinson, J. Durbin, and M. A. Caligiuri Fatal Leukemia in Interleukin 15 Transgenic Mice Follows Early Expansions in Natural Killer and Memory Phenotype Cd8+ T Cells J. Exp. Med., January 15, 2001; 193(2): 219 - 232. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
