| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
First Department of Internal Medicine, Tohoku University School of Medicine, Sendai, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Bronchial asthma is essentially under the control of unfavorable Th2 cells from which various inflammatory responses stem (5, 6, 7, 8, 9). We have previously reported that regulatory CD4+ T cells, such as TGF-ß-producing T cells induced by oral or tracheal tolerance and Th1 cells induced upon exposure to Mycobacterium tuberculosis, inhibited Th2 cells and Th2-mediated downstream airway inflammation (10, 11, 12).
More recently, we reported that oligodeoxynucleotides
(ODN)3 containing CpG
motifs (CpG) could be a candidate for allergen-specific immunotherapy
(13). CpG are found in bacterial but not vertebrate DNA
and activate macrophages and dendritic cells to secrete IL-12 and
induce IFN-
-secreting Th1 cells (14, 15, 16, 17, 18, 19, 20, 21, 22, 23). The adverse
effects of CpG, including the increase in serum TNF-
levels and
mortality (24, 25, 26, 27), however, might critically hamper the
usefulness of CpG as a therapeutic immunomodulator. We found that
administration of a minute amount of CpG through airway mucosa
inhibited airway eosinophilia and hyperresponsiveness, with only
minimal adverse effects (13). These effects were achieved
only when CpG were concomitantly instilled with the specific Ag. Our
contention that the coexistence of both CpG and allergen are necessary
for this beneficial effect was challenged by other reports in which CpG
without attendant Ag inhibited airway eosinophilia (28),
or CpG plus Ag were not inhibitory on eosinophilia
(29).
In this report, we extended our previous findings by introducing a covalently linked conjugate between CpG and Ag. We found that the conjugate inhibited airway eosinophilia 100-fold more efficiently than the coadministration of the unconjugated mixture of CpG and the Ag. Improvement of airway eosinophilia and airway hyperresponsiveness was accompanied by a reduction in the responsiveness of Ag-specific Th2 cells in the regional lymph nodes (LNs). The CpG-OVA conjugate was found to be a 100-fold stronger Th1 inducer than the unconjugated mixture in vitro. These results provide an experimental basis for a possible inhalation therapy using minute doses of the allergen-CpG conjugate in patients with bronchial asthma.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BALB/c mice were bred in our animal facility and were used at
6–10 wk of age. These animals were primed i.p. with 10 µg of chicken
OVA (Sigma, St. Louis, MO) precipitated with 4 mg of aluminum hydroxide
(alum) in 200 µl of PBS three times at 1-wk intervals, and then 7
days later were treated with ODN/OVA for 2 consecutive days (Fig. 1
). After 6 days, they were challenged
with OVA via an intratracheal route. Where indicated, keyhole limpet
hemocyanin (KLH) (Calbiochem, La Jolla, CA) was used for the
immunization and challenge in place of OVA. BALB/c mice transgenic (tg)
for TCR specific for OVA323–339 and
I-Ad were established as described previously
(30).
|
The ODN were the same as those used in our previous report (13). The CpG ODN (1826) consisted of 20 bases containing two CpG motifs (TCCATGACGTTCCTGACGTT). The control ODN (1745) was identical except that the CpG motifs were rearranged (TCCATGAGCTTCCTGAGCTT). Phosphorothioate ODN were synthesized by Nihon Gene Research Laboratories (Sendai, Japan) or Takara Shuzo (Osaka, Japan). ODN were thiolated for conjugation. LPS content of ODN was <6 pg of LPS/mg of DNA, as measured by Limulus HS-J Single Test (Wako Pure Chemical, Osaka, Japan).
Direct conjugation of ODN to proteins
The conjugation between ODN and OVA was conducted by mixing thiolated ODN with maleimide-activated OVA at 4°C overnight. Unconjugated ODN were removed by dialysis against PBS. With this method, the CpG-OVA conjugate was prepared by the Peptide Institute (Osaka, Japan). The molar ratio of CpG to OVA in the conjugate was calculated to be 8.3:1 and the CpG:OVA weight ratio was 1.1:1. The control ODN was conjugated to maleimide-activated OVA (Pierce, Rockford, IL) in our laboratory. The molar ratio of control ODN:OVA was calculated to be 6.4:1. CpG was also conjugated to KLH after KLH was maleimide-activated using sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (Pierce) in our laboratory. The weight ratio of CpG ODN:KLH was 1.0:1.One microgram or graded doses of CpG, where indicated, were used for the intratracheal pretreatment.
Bronchoalveolar lavage
BALB/c mice were primed, pretreated, and challenged with OVA as
in Fig. 1
A. Two days after the OVA challenge, the lungs were
lavaged twice with PBS (0.25 and 0.20 ml each time) and 
0.4 ml of
the instilled fluid was consistently recovered. The bronchoalveolar
lavage fluid (BALF) was cytospun onto microscope slides and stained
with Diff-Quik (International Reagents, Kobe, Japan). Differential cell
counts were performed by counting at least 300 cells per mouse. For
cytokine measurement, BALF was recovered after 24 h of OVA
challenge and centrifuged. The supernatants were assayed using
ELISA.
Airway hyperresponsiveness
After 2 days of OVA challenge, airway responsiveness was assessed as a change in pulmonary resistance (RL) after injections of increasing doses of methacholine chloride (MCh) (0.1–30 mg/kg; Wako), as we described previously(13). Mice were anesthetized by i.p. injection of pentobarbital sodium (50 mg/kg;Wako) and were tracheostomized. The air flow rate at the airway opening during spontaneous breathing was monitored by a pneumotachogram (8430B; Hans Rudolph, Kansas City, MO) combined with a differential pressure transducer (LCVR, 0–2 cm H2O; Celesco, Canoga Park, CA). The esophageal pressure monitored by a water-filled tube and a pressure transducer (Ohmeda, Singapore) was used as the transpulmonary pressure, because the pressure difference generated by the pneumotachogram connected to the tracheal tube was very small (more than 100 times) compared with the amplitude of the esophageal pressure. RL was calculated according to the subtraction method of Mead and Whittenberger (31). An average RL of three breaths at 3 min after each injection of MCh was calculated and expressed as a percentage of the baseline RL that was measured and calculated in the same way after the injection of saline used as a diluent of MCh. The provocative concentration of methacholine in milligrams per kilograms that caused a 200% increase in RL, designated PC200, was calculated by linear interpolation of the appropriate dose-response curves.
In vitro stimulation of LN cells from CpG-treated mice
BALB/c mice were primed with OVA and pretreated with CpG plus
OVA or OVA alone as in Fig. 1B. Mediastinal LN cells were
pooled from four or five mice of each group, and 1 x
105 LN cells were cultured with 2 x
105 mitomycin C (Wako)-treated spleen cells of
BALB/c mice as APCs in the presence of OVA (1000 µg/ml) or soluble
anti-CD3
mAb (0.1 µg/ml) (PharMingen, San Diego, CA). The
cultures were incubated in quadruplicate for 2 days in 96-well plates,
and the culture supernatants were assayed for cytokines.
In vitro stimulation of anti-OVA TCR tg T cells with CpG and OVA
Spleen cells (5 x 106) from
unimmunized anti-OVA TCR tg mice were cultured with varying doses
of CpG, a mixture of OVA and CpG, or the OVA-CpG conjugate in 12-well
plates for 3 days. Anti-IL-12 mAb (Genzyme, Cambridge, MA) or
isotype-matched control mAb (rat IgG2a; PharMingen) was added at graded
concentrations at the initiation of culture, including 0.1 µg of
CpG-OVA. After an additional 3-day culture in fresh medium, viable
lymphocytes were recovered from the interface by Ficoll-Paque
(Pharmacia Biotech AB, Uppsala, Sweden) density gradient centrifugation
and cultured with 2 x 105 APCs in the
presence or absence of OVA (1000 µg/ml) in 96-well plates. Anti-CD4
(Gk-1.5) (32) or anti-CD8 (3.155) (33)
mAb was added to the cultures at a 1:1000 dilution of ascites form.
After 2 days, culture supernatants were assayed for IFN- or
IL-4.
Cytokine assay
Cytokine concentrations in the BALF or culture supernatant were
determined using ELISA according to the manufacturer’s
recommendations. Paired anti-IL-4, anti-IL-5, and
anti-IFN- mAbs were purchased from PharMingen.
Tetramethylbenzidine reagent (Kirkegaard & Perry Laboratories,
Gaithersburg, MD) was used for color development, and ODs determined at
450 nm were converted to concentrations (nanograms per milliliter)
according to the standard curve. Standard recombinant mouse IL-4, IL-5,
and IFN- were purchased from Genzyme.
Statistics
Data were expressed as the means ± SEM. For in vivo experiments, each group consisted of four to six mice. Statistical analyses were performed between different groups from the same experiment using Student’s t test. Each experiment was repeated at least twice.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We previously reported that CpG administered through the airway mucosa improved airway eosinophilia and hyperresponsiveness, and that concomitant administration of CpG and Ag was required for efficient improvement with few adverse effects (13). In this report, we introduced a covalently linked conjugate between OVA and CpG and compared the conjugate with the unconjugated mixture of OVA plus CpG, the regime we used in our previous experiments.
Airway eosinophilia was induced by the intratracheal challenge of OVA
in the BALB/c mice sensitized with OVA/alum. One week before the
challenge, these mice were pretreated with either PBS or OVA plus ODN.
In comparison to a PBS-treated control group (Fig. 2A, bar 1), airway
eosinophilia was inhibited in mice pretreated with CpG plus OVA (Fig. 2A, bar 2), as described previously (13). When
mice were preinstilled with a smaller amount of CpG in combination with
OVA, the inhibitory effects of CpG was no longer observed (Fig. 2A, bar 3). Surprisingly, the failure of the low dose of CpG
in a mixed form with OVA to inhibit airway eosinophilia was reversed by
directly linking the two components (Fig. 2A, bar 4); a
covalently conjugated form of CpG-OVA inhibited airway eosinophilia to
a similar extent as the mixture of 50-fold higher doses of CpG plus
OVA. Control ODN and OVA were not effective even in the conjugated form
(Fig. 2A, bar 5). Thus, the inhibitory effects of CpG on
airway eosinophilia were amplified when CpG were covalently conjugated
to the Ag.
|
B). Comparison of the conjugate with the mixture of CpG and OVA
We compared the efficiency of the conjugate with that of the
unlinked mixture of CpG plus OVA by dose-response experiments. Graded
doses of the CpG-OVA conjugate or the mixture of CpG plus OVA were
administered intratracheally to OVA/alum-primed BALB/c mice 7 days
before the OVA challenge and the numbers of eosinophils in BALF were
determined (Fig. 3). The weight ratio of
OVA:CpG was 0.9 for both the conjugate and the mixture. When the
mixture was preinstilled into the OVA-sensitized mice, a slight
inhibition was observed at the dose of 3 µg of CpG, and significant
inhibition was achieved at 10 µg of CpG (Fig. 3, 
), which was
compatible with our previous reports (13). In contrast, as
little as 0.03 µg of CpG appeared able to inhibit eosinophilia and
reached plateau levels at the dose of 0.1 µg when CpG were conjugated
to OVA (Fig. 3, 
). At this CpG:OVA conjugation ratio, the covalent
conjugate was calculated to be 100-fold more potent than the mixture of
CpG and OVA in the inhibition of airway eosinophilia. In the following
experiments, 0.1 µg of CpG was used in either the conjugated or mixed
form with OVA.
|
We examined the Ag specificity of Ag-conjugated CpG. Airway
eosinophilia induced in mice primed and challenged with OVA was
inhibited by OVA-CpG, whereas CpG conjugated to the irrelevant Ag KLH
failed to do so (Fig. 4A). The
failure was not circumvented by the copresence of OVA with the KLH-CpG
conjugate, indicating that direct conjugation between OVA and CpG is
necessary. Reciprocally, in the KLH-primed and KLH-challenged mice,
OVA-CpG or the mixture of OVA-CpG plus KLH failed to inhibit
eosinophilia, whereas the relevant Ag KLH-conjugated CpG successfully
inhibited the KLH-induced eosinophilia (Fig. 4B). Thus,
Ag-conjugated CpG manifested the effects in an Ag-specific manner.
|
We next examined the effects of CpG-OVA pretreatment on
cytokines in BALF and airway hyperresponsiveness. BALB/c mice were
primed, pretreated with PBS or CpG (0.1 µg) either conjugated or
mixed with OVA, and challenged as shown in Fig. 1A. After
OVA challenge, Th2 cytokines in BALF and airway hyperresponsiveness
were measured. In contrast to the control PBS-pretreated group, mice
pretreated with the CpG-OVA conjugate inhibited both IL-4 (Fig. 5A) and IL-5 (Fig. 5B) in BALF, which was in parallel with the eosinophilic
responses. The unconjugated mixture of CpG and OVA tended to inhibit
IL-4 and inhibited IL-5 significantly, in spite of the failure to
inhibit eosinophilia. IFN- in BALF was not detectable in any of the
three groups (data not shown). Airway hyperresponsiveness to
methacholine was affected by the CpG-OVA conjugate in a similar manner
(Fig. 5C). In comparison with the control group, the
conjugated CpG-OVA improved airway hyperresponsiveness, whereas the
unconjugated mixture failed to improve it significantly
(p = 0.053).
|
To examine whether the improvement of airway eosinophilia and
airway hyperresponsiveness by the CpG-OVA conjugate was associated with
the inhibition of Th2 cells in the regional LN cells, OVA/alum-primed
BALB/c mice were treated with OVA either alone, conjugated, or mixed
with CpG (0.1 µg), and the LN cells were assessed for cytokine
production in response to in vitro Ag challenge. LN cells from mice
treated with OVA or a mixture of CpG plus OVA showed comparable levels
of IL-4 production, whereas treatment with the CpG-OVA conjugate
inhibited IL-4 production in response to OVA (Fig. 6A). Another Th2 cytokine,
IL-5, produced from the LN cells was also reduced in the group treated
with CpG-OVA conjugate, but not in the group treated with the mixture
(Fig. 6B). IFN- production by OVA stimulation was not
detected from any of the three groups (data not shown).
|
C). In accord with this observation, there were no
differences in IFN- production induced by anti-CD3 mAb between
CpG-treated and CpG-nontreated groups (Fig. 6D). These
results suggest that the unresponsiveness of IL-4-producing Th2 cells
was induced selectively in the T cells specific for the Ag that is
covalently coupled to CpG, and that CpG did not skew toward the
Th1-dominant phenotype in an Ag-nonspecific manner. Enhanced induction of Th1 cells by the CpG-OVA conjugate
To evaluate the mechanisms underlying the in vivo Th2
unresponsiveness by CpG, we examined the in vitro effects of the
CpG-OVA conjugate on T cell differentiation. Spleen cells from
anti-OVA TCR tg mice were precultured in the presence of CpG or
CpG-OVA, and the activated cells were restimulated with OVA for IFN-
production. IFN- was not produced from the spleen cells precultured
with CpG alone at any concentrations tested (Fig. 7A, 
). In the presence of
attendant OVA, CpG could induce IFN--secreting cells at 10 µg/ml
(Fig. 7A, ), whereas a similar extent of IFN- was
produced by as little as 0.1 µg/ml of CpG when covalently conjugated
to OVA (Fig. 7A, ). Additional experiments with blocking
mAbs confirmed that IFN- was produced by CD4+
Th1 cells, since IFN- production was totally inhibited by
anti-CD4 mAb, whereas anti-CD8 mAb had no effects (Fig. 7B).
|
C). Titration of anti-IL-12 mAb revealed that the
inhibition reached a plateau at 1 µg/ml of IL-12 mAb and complete
inhibition by IL-12 mAb was not attained. The control Ab had no effects
even at the highest concentration (10 µg/ml). Thus, IL-12 secretion
by CpG plays a major, although not exclusive, role in the Th1
development by CpG. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) and the in vitro Th1 differentiation
(Fig. 7A). Airway hyperresponsiveness and Th2 cytokine
levels in BALF were also inhibited (Fig. 5), and these phenomena were
associated with the unresponsiveness of Ag-specific Th2 cells in the
regional LNs (Fig. 6, A and B).
Bronchial asthma is essentially under the control of unfavorable Th2
cells from which various inflammatory responses stem. We have been
investigating regulatory subsets of CD4+ T cells
in regional LNs where activation by Ag and commitment for
differentiation of T cells take place. We reported that
TGF-ß-producing CD4+ T cells induced by oral or
tracheal tolerance or Th1 cells induced upon exposure to
Mycobacterium tuberculosis neutralized Th2 cells in the
regional LNs, along with the inhibition of downstream airway
inflammation (10, 11, 12). As in these previous experiments,
the present study also demonstrated the unresponsiveness of Th2 cells
in the mediastinal LNs (Fig. 6, A and B), namely,
Th2 tolerance.
Then, what are the underlying mechanisms for the Th2 tolerance in the
present experiments? Dominance of Th1 over Th2 cells? We could not
observe an increase in IFN- levels in BALF after the pretreatment
with 0.1 µg of CpG conjugated to OVA (data not shown). In accord with
this was a failure to demonstrate IFN- production in response to Ag
stimulation by the LN CD4+ T cells from the mice
receiving CpG-OVA instillation (data not shown). Nor could we observe
an Ag-nonspecific deviation of the immune responses toward a
Th1-dominant phenotype (Fig. 6, C and D). Thus,
no apparent evidence for an in vivo Th1 induction was obtained. In
contrast to the in vivo results, however, the in vitro experiments
showed that the CpG-OVA conjugate was a 100-fold more potent inducer of
Th1 cells than the unconjugated mixture (Fig. 7A). How can
we reconcile these differences? We used only 0.1 µg of CpG in this
study, which was 1000-fold lower than that in the study by Broide et
al. (28) in which 100 µg of CpG was transmucosally
administered for the regulation of asthma and the induction of
IFN--secreting CD4+ splenocytes. Since the
amount of CpG we used was so minute, the induced Th1 cells might have
been below detection. Based on the notion that a balance between Th1
and Th2 cells could determine the outcome of immune responses, these
Th1 cells could manage to partially counteract the Th2 activity and
inhibit the downstream inflammation, whereas the Th1 cells may not have
been potent enough to demonstrate their presence as IFN- producers.
The precise mechanisms remain to be elucidated.
CpG have been used to control asthma in animal models (28, 29, 37). Our experiments are different from others in two important points. First, we showed the need for Ag coadministration with CpG. In accord with us was the report by Kline et al. (37), who reported that i.p. coadministration of CpG with Ag prevented airway inflammation. However, Broide et al. (28) reported that intratracheal instillation of CpG without the accompanying Ag inhibited airway eosinophilia and hyperresponsiveness. In addition, Sur et al. (29) reported that intratracheal administration of CpG prevented allergic lung inflammation, whereas coadministration of CpG with Ag did not suppress lung inflammation. This absence of a need for accompanying Ag was in sharp contrast to our contention. CpG in the absence of attendant Ag would skew immune responses toward a Th1-dominant phenotype in an Ag-nonspecific manner, because CpG would not know a priori which Ag-specific immune systems they affect. It was also reported that CpG acted as powerful adjuvants only when coinjected with Ag (22).
Another point is the doses of CpG. We instilled 0.1 µg of CpG in a
form of a CpG-OVA conjugate, whereas 30–100 µg of CpG was used in
other studies (28, 29, 37). In light of the pathogenic
roles of Th1 cells in various types of autoimmunity (38),
the effects of CpG on the activation of autoreactive Th1 cells and
autoimmunity are unpredictable and controversial (39, 40, 41, 42).
The toxicity of CpG would be a another problem. Bacterial DNA was
reported to increase the toxicity of LPS (24). CpG also
increased serum TNF- levels and mortality in CpG-treated mice
(25, 26, 27). Exacerbation of local inflammation by CpG was
also reported (43, 44). To avert possible adverse effects,
it would be desirable to minimize the therapeutic doses of CpG for
allergic diseases. In this report, we introduced a covalently linked
conjugate between CpG and OVA and could reduce the doses of CpG owing
to the effective synergism.
Then, what are the mechanisms underlying the synergism of OVA-CpG
conjugate? OVA is picked up, processed, and presented to Th cells by
APCs, whereas CpG promote elaboration from APCs of IL-12, which destine
T cell development toward a Th1 phenotype (14, 16). APCs
engulfing CpG-OVA would present antigenic peptide along with the
secretion of IL-12 (Fig. 8A).
Since anti-OVA Th cells recognize and are in close proximity with
the antigenic peptides presented on the IL-12-secreting APCs, IL-12
could be effectively targeted to the Th cells binding to the
IL-12-secreting APCs. This key step would allow CpG, which is Ag
nonspecific in nature, to behave in an Ag-specific manner because the
effects of CpG are concentrated on the T cells specific for the Ag that
is conjugated to CpG. Such Th1 cells would counteract Th2 cells and
inhibit downstream inflammation upon antigenic challenge
(11). When OVA and CpG are administered in the mixed form,
the chances for CpG-laden APCs to simultaneously pick up OVA are less
likely than when using the CpG-OVA conjugate (Fig. 8B).
Although CpG-laded APCs would secrete IL-12, the secreted IL-12 would
not reach the Ag-specific Th cells because the IL-12-secreting APCs
would not have presented the Ag. Another APC would phagocytose the Ag
without CpG and be likely to induce and activate Th2 cells. Upon
intratracheal challenge with Ag, there would be few Th1 cells that
counteract Th2 cells, resulting in Th2 dominance.
|
Direct conjugation of Ag to ODN might unveil unexpected immunogenic aspects of DNA; it has been reported that DNA complexed to proteins or peptides induces the production of lupus-like anti-dsDNA Abs (45, 46, 47), whereas immunization with the DNA-protein complex was reported to attenuate murine lupus despite the induction of pathogenic Abs (48). As discussed above, the reasons for the possible deteriorating effects of autoimmune diseases by CpG-protein conjugates need to be clarified.
In summary, we described a novel approach that controls bronchial asthma in a murine model. Since the effects of the transmucosally administered CpG-allergen conjugate lasted for >2 mo, periodical inhalation of allergen-CpG conjugate could be a clinically useful therapy for bronchial asthma. Efficient induction of Ag-specific Th1 cells would also be beneficial for infection and cancer therapies.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Kunio Sano, First Department of Internal Medicine, Tohoku University School of Medicine, Sendai 980-8574, Japan.
3 Abbreviations used in this paper: ODN, oligodeoxynucleotide; alum, aluminum hydroxide; BALF, bronchoalveolar lavage fluid; tg, transgenic; KLH, keyhole limpet hemocyanin; LN, lymph node; MCh, methacholine chloride; RL, pulmonary resistance.
Received for publication November 9, 1999. Accepted for publication March 10, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. Proc. Natl. Acad. Sci. USA 93:2879. production is dependent on macrophage secretion of IL-12. Clin. Immunol. Immunopathol. 84:185.[Medline]
in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
-mediated shock. Eur. J. Immunol. 27:1671.[Medline]
This article has been cited by other articles:
|
|
 |
|
  L. Chen, M. Arora, M. Yarlagadda, T. B. Oriss, N. Krishnamoorthy, A. Ray, and P. Ray Distinct Responses of Lung and Spleen Dendritic Cells to the TLR9 Agonist CpG Oligodeoxynucleotide J. Immunol., August 15, 2006; 177(4): 2373 - 2383. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Heit, F. Schmitz, M. O'Keeffe, C. Staib, D. H. Busch, H. Wagner, and K. M. Huster Protective CD8 T Cell Immunity Triggered by CpG-Protein Conjugates Competes with the Efficacy of Live Vaccines J. Immunol., April 1, 2005; 174(7): 4373 - 4380. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Shirota, M. Gursel, and D. M. Klinman Suppressive Oligodeoxynucleotides Inhibit Th1 Differentiation by Blocking IFN-{gamma}- and IL-12-Mediated Signaling J. Immunol., October 15, 2004; 173(8): 5002 - 5007. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Jiao, R. Y.-H. Wang, Q. Qiu, H. J. Alter, and J. W.-K. Shih Enhanced hepatitis C virus NS3 specific Th1 immune responses induced by co-delivery of protein antigen and CpG with cationic liposomes J. Gen. Virol., June 1, 2004; 85(6): 1545 - 1553. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Wang, J. O. Sunyer, and L. J. Bello Fusion to C3d Enhances the Immunogenicity of the E2 Glycoprotein of Type 2 Bovine Viral Diarrhea Virus J. Virol., February 15, 2004; 78(4): 1616 - 1622. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Duramad, K. L. Fearon, J. H. Chan, H. Kanzler, J. D. Marshall, R. L. Coffman, and F. J. Barrat IL-10 regulates plasmacytoid dendritic cell response to CpG-containing immunostimulatory sequences Blood, December 15, 2003; 102(13): 4487 - 4492. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. V. Jain, T. R. Businga, K. Kitagaki, C. L. George, P. T. O'Shaughnessy, and J. N. Kline Mucosal immunotherapy with CpG oligodeoxynucleotides reverses a murine model of chronic asthma induced by repeated antigen exposure Am J Physiol Lung Cell Mol Physiol, November 1, 2003; 285(5): L1137 - L1146. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Marshall, K. Fearon, C. Abbate, S. Subramanian, P. Yee, J. Gregorio, R. L. Coffman, and G. Van Nest Identification of a novel CpG DNA class and motif that optimally stimulate B cell and plasmacytoid dendritic cell functions J. Leukoc. Biol., June 1, 2003; 73(6): 781 - 792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Takabayashi, L. Libet, D. Chisholm, J. Zubeldia, and A. A. Horner Intranasal Immunotherapy Is More Effective Than Intradermal Immunotherapy for the Induction of Airway Allergen Tolerance in Th2-Sensitized Mice J. Immunol., April 1, 2003; 170(7): 3898 - 3905. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Sano, H. Shirota, T. Terui, T. Hattori, and G. Tamura Oligodeoxynucleotides Without CpG Motifs Work as Adjuvant for the Induction of Th2 Differentiation in a Sequence-Independent Manner J. Immunol., March 1, 2003; 170(5): 2367 - 2373. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. N. Hylkema, W. Timens, M. Luinge, N. van der Werf, and M. O. Hoekstra The Effect of Bacillus Calmette-Guerin Immunization Depends on the Genetic Predisposition to Th2-Type Responsiveness Am. J. Respir. Cell Mol. Biol., August 1, 2002; 27(2): 244 - 249. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Shirota, K. Sano, N. Hirasawa, T. Terui, K. Ohuchi, T. Hattori, and G. Tamura B Cells Capturing Antigen Conjugated with CpG Oligodeoxynucleotides Induce Th1 Cells by Elaborating IL-12 J. Immunol., July 15, 2002; 169(2): 787 - 794. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Katagiri, J. Zhang-Hoover, J. S. Mo, J. Stein-Streilein, and J. W. Streilein Using Tolerance Induced Via the Anterior Chamber of the Eye to Inhibit Th2-Dependent Pulmonary Pathology J. Immunol., July 1, 2002; 169(1): 84 - 89. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. N. Kline, K. Kitagaki, T. R. Businga, and V. V. Jain Treatment of established asthma in a murine model using CpG oligodeoxynucleotides Am J Physiol Lung Cell Mol Physiol, July 1, 2002; 283(1): L170 - L179. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Yu, E. R. Kandimalla, Q. Zhao, Y. Cong, and S. Agrawal Immunostimulatory properties of phosphorothioate CpG DNA containing both 3'-5'- and 2'-5'-internucleotide linkages Nucleic Acids Res., April 1, 2002; 30(7): 1613 - 1619. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Ahdieh, T. Vandenbos, and A. Youakim Lung epithelial barrier function and wound healing are decreased by IL-4 and IL-13 and enhanced by IFN-gamma Am J Physiol Cell Physiol, December 1, 2001; 281(6): C2029 - C2038. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Horner, S. K. Datta, K. Takabayashi, I. M. Belyakov, T. Hayashi, N. Cinman, M.-D. Nguyen, J. H. Van Uden, J. A. Berzofsky, D. D. Richman, et al. Immunostimulatory DNA-Based Vaccines Elicit Multifaceted Immune Responses Against HIV at Systemic and Mucosal Sites J. Immunol., August 1, 2001; 167(3): 1584 - 1591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Shirota, K. Sano, N. Hirasawa, T. Terui, K. Ohuchi, T. Hattori, K. Shirato, and G. Tamura Novel Roles of CpG Oligodeoxynucleotides as a Leader for the Sampling and Presentation of CpG-Tagged Antigen by Dendritic Cells J. Immunol., July 1, 2001; 167(1): 66 - 74. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
